A  B  C  D  E  F  G  H  I  J  K  L  M  N  O  P  Q  R  S  T  U  V  W  X  Y  Z  

  Subjects -> VETERINARY SCIENCE (Total: 225 journals)
The end of the list has been reached or no journals were found for your choice.
Similar Journals
Journal Cover
Medical Mycology
Journal Prestige (SJR): 0.973
Citation Impact (citeScore): 3
Number of Followers: 3  

  This is an Open Access Journal Open Access journal
ISSN (Print) 1369-3786 - ISSN (Online) 1460-2709
Published by Oxford University Press Homepage  [419 journals]
  • P332 Evaluation of the efficacy of fumigation practices on the mycological
           flora in the Orthopedic Operation theatre environment of a tertiary care
           hospital

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesTo determine the pre and post-fumigation prevalence of fungi in the Orthopedic Operation Theatre of a tertiary care hospital and characterization of fungal isolates.Method: This is a prospective environmental, analytical study conducted from July 2021 to January 2022. Pre- and post-fumigation samples were taken from Ultra and Modular OT of Orthopedic department every week by passive methods of air sampling using Gravity sedimentation method (1/1/1 scheme) on SDA and also by surface sampling using swabs. The fungal load of air was measured by calculating the number of CFU per cubic meter (CFU/m3) of air by Omeliansky formula. Fumigation of OT was done with a complex formulation of stabilized hydrogen peroxide 11% w/v with silver nitrate solution 0.01% (Baccishield®).All surface samples were inoculated on SDA with chloramphenicol and all plates were incubated at 22°C and 37°C. The isolates were identified by using standard mycological procedures. Statistical analysis was done using a T-test.ResultsOut of 19 surface sampling, fumigation was found to be 100% effective only on 3 occasions (15.79%) in Ultra OT and on 7 occasions (36.84%) in Modular OT. In air sampling ≥50% reduction was found in only 4 samplings (21.05%) in Ultra OT and 10 samplings (52.63%) in Modular OT. The counts were much more than the WHO OT permissible limits. A total of 16 species of fungi were isolated belonging to 11 genera.The most common isolate was Aspergillus niger, followed by sterile hyalohyphomycetes, A. flavus, Cladosporium spp., Curvularia spp., Bipolaris spicifera, A. fumigatus, etc. in both Ultra and Modular OT.Additionally, Exophiala spp. and Fonsecaea spp. were isolated in Ultra OT.The concentrations of fungi in Ultra OT before and after fumigation were in the range 22.11-58.97 CFU/m3 and 7.37-51.59 CFU/m3, respectively. Whereas, in Modular OT, the range was 14.74-36.86 CFU/m3 and 7.37-29.48 CFU/m3, respectively. Percentage reduction of fungi following fumigation with Baccishield varied from 0% to 75% both in Ultra OT and Modular OT. The statistically correlated P-value from pre- and post-fungal concentrations in Ultra and Modular OT were found to be .002 and .0002 respectively which was found significant by T-test, albeit ineffective as per standards.ConclusionIn corroboration with our findings, Baccishield has been reported to be less effective even by other researchers. Hence, this needs to be replaced by more effective fumigants. The ineffectiveness of fumigation in Ultra OT was most probably due to the lack of HEPA filters and not strictly following up of aseptic protocols. In Modular OT improper maintenance of ACs and lack of periodic cleaning up of HEPA filters may be contributing factors.Hence, implementing more stringent, frequent, and comprehensive disinfection and cleaning procedures, educating and motivating the health care personnel can help to improve the air quality of OTs that may aid in reducing post-operative infections.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P332
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P333 Candidemia due to Candida pelliculosa in neonates admitted in SNCUs
           of district hospitals of Chhattisgarh: first state-wide study from
           secondary-level health care facilities in Central India

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesTo study the Candida pelliculosa isolates, from the blood culture of neonates admitted to district hospital SNCUs in the state of Chhattisgarh, their antifungal susceptibility pattern, risk factors, and clinical co-relation. Although Candida species remain the leading cause of invasive fungal infections (IFI), there are certain rare species like C. pelliculosa, that can cause fungemia. Various studies reveal that infants, children, and immunocompromised individuals are more susceptible to bloodstream infections of C. pelliculosa. Few cases of fungemia caused by this rare species of Candida have been reported worldwide. We have found a few cases of C. pelliculosa bloodstream infection in neonates admitted to special newborn care units (SNCUs).MethodsThis is an observational study on the Candida isolates from blood cultures of neonates admitted in SNCUs of the state of Chhattisgarh, over a period of 4 years from March 2018 till March 2022. Blood culture isolates of Candida were identified and their AFST was performed on an automated Bacterial ID-AST system by BioMerieux (VITEK -2) and also manually using standard laboratory protocols. Demographic and clinical data of the patients having Candida pelliculosa candidemia were taken from laboratory records.ResultsPaired blood culture samples of total 4997 SNCU neonates were received in the laboratory. Out of these 25% were found positive for bacteria and or Candida spp. Among these positive blood cultures, Candida spp. was isolated in 18.76% patients. Amongst the isolates of Candida, C. pelliculosa was found to be the predominant Candida spp., isolated in 60 neonates, thus comprising of 25.64% of all Candida spp. Further analysis of neonates having C. pelliculosa infection revealed that 40% (24/60) neonates were either low birth weight, very low birth weight (VLBW), or extremely low birth weight (ELBW) babies, 25% cases had respiratory distress, 21.6% neonates were premature and 10% cases had hypoglycemia, as risk factors.Antifungal susceptibility pattern showed 99% isolates of C. pelliculosa as susceptible to amphotericin B, 100% being susceptible to voriconzole, and 95% and 100% isolates were susceptible to fluconazole and flucytosine respectively. More resistance was observed for Echinocandins. Caspofungin was found to be least susceptible in 88.9% of isolates. Various indications for blood culture were also analyzed. Only one neonate, out of 60, succumbed to C. pelliculosa infection.ConclusionCandida pelliculosa is found to be an emerging pathogen responsible for candidemia among neonates in SNCUs, which has shown relatively poor in-vitro susceptibility to Echinocandins. It is of extreme clinical importance that neonates of secondary-level health care facilities should also have access to quality laboratory support in the form of culture and sensitivity, so that pathogen profile and antibiogram data are available from such high-risk units as well, which would prove useful in timely institution of targeted therapy, thereby reducing neonatal mortality.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P333
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P334 Fungal infections in patients with COVID-19 in 1-year pandemic
           2020-2021 from Cote d'Ivoire

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground and Objectives: The COVID-19 pandemic has caused significant public health problems both in Côte d'Ivoire and around the world. Among the different causes of morbidity and mortality in COVID-19 patients, the frequency and impact of co-infections are still little studied, especially in patients with acute respiratory distress syndrome (ARDS).However, people with severe COVID-19 infection are particularly vulnerable to bacterial and fungal infections. This study aims to determine the frequency and susceptibility profile of isolated fungi in severe COVID-19 patients living in west Africa.Methodology: We conducted a retrospective observational study of COVID-19 patients who were tested for invasive fungal infections (IFI) between 2020 and 2021 in the laboratory of mycology at Pasteur Institute of Cote d'Ivoire.ResultsWe received a total of 77 samples (from superficial specimens, deep sites, urine) collected from 35 patients admitted for severe COVID-19. The patients were predominantly female (n = 21, 60%) and had a median age of 54,5 years (range16-79 years).The mycological analysis for IFI diagnosis showed 20% of samples positive only for yeasts, 66.7% of which were Candida albicans and responsible for 90% of invasive infections in COVID-19 patients. No difference in fungal species was found regarding of the sex, age of the patients, and waves of the pandemic. Antifungal susceptibility testing revealed no resistance to antifungals (fluconazole, voriconazole, itraconazole, amphotericin B, and flucytosine) among Candida isolates.ConclusionThese data show significant Candidiasis infection associated with the severe form of COVID-19. Given this prevalence of 20%, it is important for clinicians to remain vigilant and take proactive measures to prevent candidemia in patients with COVID-19. The widespread surveillance for fungal co-infections is still essential to reduce mortality associated with COVID-19.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P334
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P335 Genome plasticity in Candida albicans : acutting-edge strategy for
           evolution, adaptation, and survival

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCandida albicans is the most implicated fungal species that grows as a commensal or opportunistic pathogen in the human host. The genome plasticity is central to its adaptation and has long been of considerable interest. Understanding the factors that affect the genome is crucial for a proper understanding of species and rapid development and adjustment of therapeutic strategies to mitigate their spread.MethodsHere, we present an up-to-date overview of recent genomic studies involving C. albicans and discuss the accumulating evidence that shows how mitotic recombination events, ploidy dynamics, aneuploidy, and loss of heterozygosity (LOH) influence evolution, adaptation, and survival in C. albicans. This review was exclusively based on a thorough literature review on research papers investigating C. albicans and its genome. The Boolean search for relevant literatures was performed in Google scholar, Science direct, PubMed, and Web of science using a combination of the following precise keywords: Candida albicans, Genome plasticity, Parasexual events, Ploidy dynamics, Aneuploidy, LOH, and Mutations. All the papers that relate to the genome and genetics of C. albicans were included in the study.ResultsCandida albicans has a diploid heterozygous genome that is highly dynamic and can display variation from small to large-scale chromosomal rearrangement and aneuploidy, which have implications for drug resistance, virulence, and pathogenicity. The instability in the genome arising from stress or exposure to the host environment can be detrimental to survival. However, C. albicans can tactically exploit this instability in their genome as a survival strategy. Our investigation showed that there is a need for more studies to understand the regulation and the exact mechanisms that lead to chromosomal instability in C. albicans. It is important to understand how increasing ploidy affects genome stability. It is also important to unravel how tetraploids lose chromosomes to revert to diploids. Whether other ploidy states can be efficiently sustained also remains to be unraveled. Moreover, as the understanding of the pathogenicity of fungi continues to evolve, there is a continuing challenge in grasping the processes and factors that mediate the switching from commensal to the pathogen. It remains unclear whether parasexual processes also operate within natural populations. More studies are needed to appreciate better parasexual recombination events and mutational processes in C. albicans evolution and its link to persistence and infection establishment. The interrelationship between the host and the microbes can promote microbial fitness in the host and help the host acquire some beneficial features such as resistance against several pathogens. However, the long-term consequences on host fitness are largely unknown. This evidence provides an avenue to study evolutionary forces controlling C. albicans fitness level after host exposure.ConclusionThe variation in the genome of C. albicans greatly influences its biology, stress response approaches, and its virulence and resistant potentials. Understanding how C. albicans generate diversity is very crucial as this will help to design strategies mitigating their spread.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P335
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P337 Species distribution and biofilm profile of Candida isolated from
           clinical specimens at a tertiary care hospital in India

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMIntroduction: The epidemiology of invasive candidiasis (IC) is dynamically changing, given the increasing population of susceptible hosts, use of indwelling medical devices (IMD), and environmental factors. The presence of an IMD is one of the most important risk factors for persistent infection due to the possibility of biofilm formation. The biofilm cells are significantly less susceptible to antifungal drugs and are able to evade the host immune system, serving as a nidus for reinfections.Objectives:To determine the species distribution of Candida isolated from clinical specimens of hospitalized patients.To evaluate biofilm formation by clinically significant and colonizing isolates of Candida species recovered from clinical specimens.MethodsA total of 100 Candida isolates from patients with suspected invasive candidiasis were tested for the production of biofilm. Based on clinical history, 62% of the isolates were found to be clinically significant, while 38% represented commensals or colonizers. Species identification was done on the basis of germ tube test, CHROMagar, Dalmau plate technique, and carbohydrate fermentation and assimilation tests, and VITEK 2. Four isolates that failed to be identified by conventional methods were subjected to MALDI-TOF MS. Biofilm production was detected and graded by visual (test tube) and spectrophotometric (microtiter plate) methods.ResultsNon-albicans Candida (NAC) were the predominant clinically relevant isolates recovered from cases of IC (71%), while C. albicans was most commonly associated with colonization (68.4%). Among the NAC isolates, C. tropicalis was the most common isolate (23%) followed by C. glabrata (11%), C. krusei (8%), C. parapsilosis (6%), C. lusitaniae (2%), C. kefyr (2%), C. rugosa (2%), C. guilliermondii (1%), and C. famata (1%) (Fig. 1). A total of 55% of the Candida isolates produced biofilm. Biofilm positivity in clinically relevant isolates was found to be significantly higher than commensals/colonizers (P <.05). Biofilm positive Candida spp. were most commonly isolated from urine (84.6%) followed by blood (67.8%). Biofilm production by NAC (69%) was found to be significantly higher than C. albicans (31%) (P <.05). Majority of the biofilm positive isolates produced Grade 2 (moderate) biofilm (36.4%). C. tropicalis accounted for maximum biofilm production comprising 20% of Grade 4, 53.8% of Grade 3, and 50% of Grade 2 biofilm (Fig. 2). There was 72.7% concordance between the two methods in grading of biofilm. Spectrophotometric method was found to be more sensitive than a visual method for the detection of biofilm.ConclusionOur study demonstrated a paradigm shift from C. albicans to NAC with the isolation of C. tropicalis from a large number of cases, highlighting the growing importance of this pathogen. The knowledge about local epidemiological trends of Candida spp. is important to guide therapeutic choices. Moreover, clinically relevant Candida spp. were found to possess a greater ability to produce biofilms than commensals or colonizers. These findings are unique as previous studies haven't differentiated between biofilms formed by commensal Candida populations and those related to infections. This study highlights that biofilm production should be considered a relevant biologic variable while treating patients with invasive candidiasis, particularly those who fail to respond to antifungal therapy.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P337
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P338 Clinicopathologic analysis of COVID-19-associated
           mucormycosis-experience from a tertiary care center in north india

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesDue to the coronavirus disease (COVID-19) pandemic, a rapid increase in the number of opportunistic fungal infections was observed worldwide. Cases of mucormycosis described in patients with COVID-19 have been termed as COVID-19-associated mucormycosis (CAM).We aim toanalyze the clinicopathological spectrum of CAM presenting to our institute.evaluate the histopathological parameters associated with adverse outcomes (mortality).MethodsThe archives of the histopathology department were searched for RTPCR-positive COVID-19 patients with suspected CAM from a period of September 2020 to November 2021. Those cases with follow-up data, adequate material for histopathologic evaluation, and confirmed mucormycosis were included. The medical records of these patients (clinico-demographic details—age, gender, associated comorbidities, steroid therapy, duration of hospital stay) were retrieved. The outcome was defined as death/discharge at follow-up. After routine processing, serial hematoxylin-eosin-stained slides and special stains (Silver Methenamine and Periodic Acid Schiff) were examined for fungal morphology and tissue reaction.The histopathological parameters were neutrophilic infiltrate, fungal load, necrosis, angioinvasion, neural invasion, optic nerve invasion, presence of granuloma, bone invasion, and mixed fungal infection.ResultsA total of 169 cases of CAM met the inclusion criteria. Most common site of involvement was sino-nasal (n = 139) followed by orbital (n = 14), pulmonary (n = 12), gastrointestinal tract, and kidney (n = 2, each).Male predominance was noted (71%, n = 119) with a male: female ratio of 2.5: 1. The patient ages ranged from 19 to 84 years with higher incidence noted in patients above 50 years (49.1%, n = 82) age group. The mean age of the population was 52.8 years. The most common comorbidity was diabetes mellitus (n = 74, 44%) followed by hypertension (n = 16, 9%), hypothyroidism (n = 5, 2.9%), coronary heart disease (n = 3, 1.7%), and chronic kidney disease (n = 2, 1.04). Most common clinical presentation was headache followed by facial pain or swelling.Corticosteroids were administered in 76% (n = 127) of the patients.On histopathology evaluation, 123 cases showed angioinvasion, 30 cases showed perineural invasion and 8 cases showed intraneural invasion. Optic nerve invasion was present in 13 cases of which perineural and intraneural optic nerve invasion was seen in 5 cases. Mixed infection with Aspergillus species was noted in 4.1% (n = 7) cases, also confirmed by fungal culture. Radiological correlation to evaluate extent of bone invasion was done, wherever available. Of the 169 patients, 149 recovered due to timely surgical intervention and medical management while 20 succumbed due to multisystem involvement [mortality in sino-nasal and orbital involvement n = 17 (10%), lung n = 2 (1.1%), GIT n = 1 (0.5%)].ConclusionCOVID-19 causes severe immune dysregulation leading to cytokine storm. An upsurge in CAM during the second wave of COVID-19 pandemic in India was seen in patients with additional co-morbidities; mainly uncontrolled diabetes and injudicious use of corticosteroids. Although mortality is high, timely intervention can prove to be life-saving as was seen in our series.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P338
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P339 A study of environmental risk factors in chronic rhinosinusitis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesChronic rhinosinusitis (CRS) is a complex disease that incorporates many different conditions. Our aim is to determine the role of environmental risk factors in chronic rhinosinusitis.MethodsThis was a case-control study where forty cases of CRS in the age group of 18-62 years were recruited from the ENT-OPD of UCMS and GTB Hospital, Delhi, a tertiary care hospital, along with 40 age-appropriate healthy controls. Informed and written consent was obtained from all the subjects. Detailed history and examination along with routine blood and radiological investigations were done. Subjective assessment of disease was done using visual analog scales of SNOT 22 questionnaire, environmental questionnaire, and saccharine test. Objective assessment was done using endoscopic grading according to Lund and Kennedy scoring. CT scores were also obtained using Lund and Mackay staging system. Passive air sampling was done by the settle plate method and Anderson six-stage cascade impactor was used for active air sampling. Blood agar and Sabouraud dextrose agar plates were inserted on the six stages of the cascade impactor, which were later incubated at 35°C and 25°C respectively, for 18-24 hours. Bioaerosol concentrations were calculated and MicroScan WalkAway system was used to identify bacterial and fungal growth. The correlation between total bioaerosol concentration and the symptom score was done by spearman's correlation coefficient; a comparison of mean total bioaerosol concentration between the case and control groups was done by Mann-Whitney U-test.ResultsThe mean total bio-aerosol concentration from active air sampling in the case group was 458.52 CFU/m3 and 437.63 CFU/m3 in control, which was not significant. It was found to be negatively correlated, but not significant with various parameters in case groups like SNOT 22 score, environmental exposure score, saccharine test, smoking, and endoscopic score. A positive but insignificant correlation was found between total bioaerosol concentration and absolute eosinophilic count and CT score. The mean CFU/100 mm3 counted after passive air sampling between case and control group was 34.03 and 30.88 CFU/100mm3 which was not significant. Fungal growths were mostly Aspergillus flavus and A. Niger followed by Cladosporium spp.ConclusionThe fungal burden was high in all the households of the case as well as control groups, although, a significant correlation could not be established. The environmental conditions found in this study were found to be conducive to future risk of exacerbation of preexisting fungal infections for which, indoor air quality needs to be monitored.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P339
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P340 Detection of emerging genotypes in Trichophyton mentagrophytes
           complex: a proposal for handling biodiversity in dermatophytes

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: The resistant and hypervirulent dermatophytes, which were found in India, have been described as a taxonomic novelty. It is urgent to detect the dermatophytes and their closely related clinical species fast and efficiently. Therefore, we evaluate the efficacy of diagnostic methods for the rapid detection of closely related clinical species.MethodsMembers of the Trichophyton mentagrophytes species complex were analyzed using Realtime-PCR, Dermagenius, LAMP, and MALDI-TOF in comparison with ITS sequencing.ResultsDermagenius correctly recognized genotypes IV, VII, and IX as belonging to Trichophyton mentagrophytes, and all strains of T. interdigitale. However, genotype III and III* of T. mentagrophytes were recognized as T. interdigitale. The real-time PCR cannot distinguish these genotypes. In LAMP assay, T. indotineae, T. mentagrophytes III*, III, and IV, and T. interdigitale were positive. Trichophyton mentagrophytes genotype VII, and one strain of T. mentagrophytes genotype IX. In MALDI-TOF tree, the most of T. indotineae strains can be clustered in one clade. The rest of the genotypes are irregular.ConclusionDermagenius, real-time PCR, and LAMP cannot adequately distinguish among T. indotianeae, T. interdigitale, and T. mentagrophytes. Only T. indotineae from the Indian outbreak was approximately distinguishable with MALDI-TOF other than sequencing. We recommend to distinguish species only when they show an appreciable degree of adaptation and thus are clinically significant. Distinction of remaining clonal diversity is an epidemiological query and can be solved by haplotype numbering.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P340
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P447 Galactomannan lateral flow assay for the diagnosis of invasive
           Aspergillosis among clinically suspected patients in tertiary care center,
           Jodhpur, Rajasthan

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMIntroduction: Invasive aspergillosis is one of the potentially life-threatening diseases in immunocompromised patients. Early diagnosis and prompt treatment improve patient survival. The gold standard method—conventional microscopy and culture have low sensitivity and a long turnaround time. Serum Galactomannan (GM), a polysaccharide that forms a major component of Aspergillus cell wall and is released by the fungus during invasive growth is established as a reliable biomarker, which is available as Enzyme Linked Immunoassay (ELISA). The limitations of ELISA are high cost, expertise, and difficulty in assay standardization. To overcome these limitations, a qualitative Galactomannan Lateral Flow Assay (GM-LFA) a sandwich immunochromatographic test, recently approved by European CE, is evaluated in our study.Objective: To establish the diagnosis of Invasive Aspergillosis according to EORTC/MSGERC Definitions of Invasive Fungal Diseases 2021 guidelines and comparison of GM-LFA with conventional microscopy and culture.Method: We performed a retrospective study from October 2021 to March 2022 on serum and bronchoalveolar lavage fluid (BAL) samples. GM-LFA (IMMY sōna Aspergillus Galactomannan LFA) was performed and the results are read after 10 mins with a cube reader according to the manufacturer’s instructions and compared with conventional microscopy and culture.Result: During the 6 months study period, 185 samples (14 BAL and 171 Serum) were collected from 148 patients. A total of 17/185 (9.18%) samples from 16 patients were positive by GM-LFA, of those 5 (29.41%) are BAL, and 12 (70.58%) are serum samples. One patient tested positive for Galactomannan on both BAL and serum.Among Assay positive samples, 3/17 (17.64%) samples were positive by microscopy and culture, which grew 2 Aspergillus fumigatus and 1 Aspergillus niger.Treatment details of 5 patients could be traced, of which 4 patients improved clinically and radiologically after Inj. voriconazole and 1 patient died before starting treatment.According to EORTC/MSGERC Definitions of Invasive Fungal Diseases 2021 guidelines, 17 patients belong to the proven and probable Invasive aspergillosis category, in which 16 patients were GM-LFA-positive and the remaining 131 patients had no evidence of invasive aspergillosis disease.ConclusionGM-LFA is a cost-effective, easy, convenient, and rapid procedure. We recommend its use for the diagnosis of invasive Aspergillosis in routine healthcare settings, especially where GM-ELISA is not available or affordable.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P447
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P449 Semi-quantitative cryptococcal antigen rapid test (CryptoPS,
           Biosynex®) for cryptococcal meningitis in patients living with HIV in
           Sub-Saharan Africa: prospective multicenter diagnostic accuracy study
           (DREAMM)

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground: Cryptococcal meningitis (CM) remains a leading cause of HIV-related meningoencephalitis in African low- and middle-income countries (LMICs), causing 15%-20% of HIV-related deaths. Rapid Diagnostic Tests (RDTs) are powerful tools and key to speeding-up the diagnosis at the bedside, allowing for rapid and targeted treatment, especially in LMICs. For the past 10 years, Cryptococcal Antigen (CrAg) RDTs have a major role in CM management.Driving Reduced AIDS Meningo-Encephalitis Mortality (DREAMM) was a multicenter implementation science study and a capacity-building project to reduce the mortality of HIV-related central nervous system infections (CNS). One of the main DREAMM approaches was to improve the diagnosis of CNS infections at the bedside and in parallel in local laboratories. Within DREAMM, HIV-infected, adult people living with HIV (>18 years old) with suspected CNS infections were recruited in five hospital sites in Cameroon, Malawi, and Tanzania.ObjectivesOur objective was to evaluate the implementation of CrAg CryptoPS (Biosynex, Illkirch Graffenstaden, France), a new semi-quantitative RDT, in routine care settings in Sub-Saharan Africa.MethodsAll CrAg CryptoPS performed were compared to the reference CrAg lateral flow assay (Immy®). The evaluation was done by the local research teams in four DREAMM laboratories sites. CrAg CryptoPS's implementation was evaluated in 301 plasma samples and 258 cerebrospinal fluid (CSF) samples from 320 participants (patients diagnosed with cerebral toxoplasmosis did not have a lumbar puncture). In this analysis, the results will be considered in a binary way (positive/negative).ResultsBetween January 2018 and March 2021, 356 participants were prospectively enrolled with suspected HIV-related CNS infections, including CM, tuberculous meningitis, cerebral toxoplasmosis, and bacterial meningitis cases. Cryptococcal meningitis was the leading cause of CNS infections in Malawi and Tanzania with 66.3% (53/80) and 59.6% (59/99) cases respectively, and the second cause in Cameroon with 40.0% (39/90) cases after cerebral toxoplasmosis.In plasma, CryptoPS's sensitivity was 99.23% (95% CI, 0.98-1.01) and specificity was 94.15% (95% CI, 0.91-0.98); positive and negative predictive values were 92.8% and 99.4%, respectively. In CSF, the sensitivity and specificity of CryptoPS were 100% (95% CI, 0.0-0.0), and 99.26% (95% CI, 0.98-1.01), respectively; positive and negative predictive values were both 100%. A low number of false-positives were observed (<4% in plasma and <0.5% in CSF).ConclusionCryptoPS was evaluated in a context of hospitalized patients within a project including all causes of HIV-related CNS infection, not only CM. The sensitivity and specificity of CryptoPS calculated in these preliminary results are promising. Semi-quantitative CryptoPS has the potential to be used to tailor antifungal therapy but further optimizations need to be done prior to large-scale implementation in African LMICs. In addition, future work to determine CrAg antigen titres is planned, in the perspective to optimize treatment of CrAg positive cases who decline lumbar puncture.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P449
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P452 Estimation of the detection limit of extracted Candida DNA from
           spiked EDTA blood sample

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground: Candidemia caused by genus Candida, are opportunistic pathogens with life-threatening infection in immunocompromised individuals with a mortality rate being 40%–54% in patients. Blood culture is not a reliable and rapid method for the diagnosis of candidemia as its sensitivity is as low as 50%. Molecular diagnosis is an alternative to conventional culture for early detection of candidemia. An appropriate DNA isolation technique is needed to obtain high purity DNA from blood specimens and improves the sensitivity of the polymerase chain reaction (PCR). In this study, two different methods were used to extract Candida DNA from spiked EDTA blood specimens, the In-house phenol-chloroform and potassium acetate method.Objectives:DNA extraction from the spiked blood samplesQuantification of the Candida DNA extracted from the spiked sampleComparison of the extracted DNA by phenol-chloroform and potassium acetate methodMethodsA total of 5 ml of EDTA blood samples from healthy volunteers were spiked with 104-108 Candida albicans cells (ATCC 90028) to determine the detection limit of our extraction method. DNA was extracted from whole blood using phenol-chloroform and the potassium acetate methods which involves pretreatment with erythrocytes, leukocytes and fungal lysis buffer. DNA from C. albicans were amplified using ITS1 and ITS4 based primers. PCR products were visualized by agarose gel electrophoresis.ResultsThe spiked Candida cells taken were from 104-108 yeast cells. The total extracted DNA by phenol chloroform extraction method ranged from 18.29 to 51.64 ng/μl respectively. Whereas the total extracted DNA from potassium acetate extraction method ranged from 15.58 to 32.30 ng/μl respectively. The presence of a 535 base pair (bp) product was considered positive (Figs. 1 and 2). The lowest detection limit of PCR has been determined as 106-108 Candida cells for our spiked samples.ConclusionIn our study, till date, the extracted quantity of DNA was found to be higher by phenol-chloroform method as compared to the potassium acetate method. Greater numbers and processing are required to obtain conclusive data.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P452
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P453 Aspergillus and aspergillosis in patients in an intensive care unit
           with mechanical ventilation

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMInvasive Pulmonary Aspergillosis (IPA) is a relevant opportunistic disease among neutropenic patients with hematological diseases. Besides them, studies have been showing that critically ill patients in intensive care units (ICU), mainly those infected by respiratory virus such as SARS-CoV-2 are also at risk to be co-infected by Aspergillus and developing IPA.ObjectivesWe aimed to evaluate the detection of Aspergillus in tracheal samples from patients in an ICU on mechanical ventilation from a tertiary hospital from Southern Brazil, and its relationship with their outcome.MethodsAll samples of tracheal aspirate (TA) from patients admitted to the ICU and in mechanical ventilation from July 2020 to June 2021 were included in the study. We performed three different tests to detect Aspergillus spp.: (1) mycological culture in Sabouraud Agar Dextrose, with macro and microscopy evaluation of the colonies to the identification of Aspergillus section; (2) lateral flow assay for the detection of Aspergillus Galactomannan (GM) performed with the cube reader (IMMY® Diagnostics, OK, USA), using a cut-off of ≥4 (nm/ml); (3) quantitative polymerase chain reaction (qPCR) with GoTaq® Probe qPCR (Promega, Wisconsin, EUA) to amplify the small subunit ribosomal RNA target using the forward (3’ TTGGTGGAGTGATTTGTCTGCT 5’), and reverse (5’ TCTAAGGGCATCACAGACCTG 3’) primers, and the probe (3’ TCGGCCCTTAAATAGCCCGGTCCGC 5). Samples presenting the cycle threshold (CT) <40 were considered positive. DNA obtained from an Aspergillus isolate was used as positive control, and DNA-free water as negative control. Probable aspergillosis was defined in those cases that presented positive results to, at least, two of these tests.ResultsA total of 34 patients were included in the study. Causes of ICU admissions were aids complications (n = 11), COVID-19 (n = 9), severe acute kidney disease (n = 6), tuberculosis (n = 1), and other reasons, including post-surgery, septic shock, severe acute respiratory syndrome, and cardiac problems (n = 6). Aspergillus spp. was isolated in culture of the TA in 50% of the patients (17/34), being 12 Aspergillus section Fumigati, three Aspergillus section Flavi, and two Aspergillus section Nigri. TA from eight patients were positive for GM, and five patients had a positive result in the qPCR assay. Probable aspergillosis was confirmed in 20.6% (7/34), being three patients positive in culture and GM, and three in culture and qPCR. One patient was positive in the three tests. COVID-19-associated aspergillosis (CAPA) corresponded to two of these seven cases. The outcome was death in 13/34 patients, 4 of them (31%) had probable aspergillosis. The other three patients, alive, diagnosed with probable aspergillosis, were treated with amphotericin B, desoxicolate plus itraconazole, and survived. The mortality rate was 57.1% (4/7) and 33.3% (9/27) in the group with and without probable aspergillosis, respectively.ConclusionThese partial results suggest that aspergillosis can have an important impact in critically ill patients in the intensive care unit of our hospital.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P453
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P454 Massive parallel fungal sequencing on formalin-fixed tissues:
           development and contribution in integrated histomolecular diagnosis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesHistopathology is the gold standard for distinguishing between colonization and fungal infection, but it does not provide a precise diagnosis of genera/species. However, if the culture is negative or if no specimen is sent to the Mycology laboratory, only the specimen sent to the Pathology department is available. Formalin fixation and paraffin embedding (FFPE) cause DNA damage, making it difficult to perform molecular techniques.The objective was to develop and evaluate the contribution of massive parallel sequencing (MPS) to FFPE tissues.MethodsHistopathological review of all cases was performed. Then, DNA extraction from FFPE tissues was optimized by: (1) macrodissecting the fungal-rich area on the paraffin block; (2) comparing the efficiency of two DNA extraction kits (QIAamp DNAmicro-kit, QIAGEN; Maxwell 16 LEVRNA FFPE Purification kit, Promega, optimized for RNA and DNA extraction), by comparison of Aspergillus fumigatus and Mucorale specific PCR results for 30 cases. For 124 other cases, the sensitivity of two primer pairs (ITS3/4 and MITS2A/2B) was tested for identification by Sanger sequencing and then MPS. Finally, a histomolecular comparison was performed. This work was funded by the Société de Pathologie Infectieuse de Langue Française (SPILF).ResultsTo optimize extraction, DNA was extracted by both kits from samples of 16 mucormycoses and 14 A. fumigatus infections. PCR sensitivity was better with the QIAGEN extraction kit [100% (30/30)] compared to the Promega kit [86.7% (26/30)].PCR amplification of fungal DNA from an additional 124 FFPE samples was performed. The primer pairs ITS3/4 and MITS2A/2B, allowed: (1) identification by Sanger sequencing-histopathological analysis in 38.7% (48/124) of the cases in total, and more specifically 33% (41/124) of cases with the ITS3/4 primers and 32.3% (40/124) of cases with the MITS2A/B primers; and (2) identification by integrated SMP-histopathological analysis in 75% (93/124) of all cases (primers ITS3/4 and MITS2A/2B), and more specifically 66.1% (82/124) for ITS3/4 and 62.1% (77/124) for MITS2A/B (both primer pairs did not detect/amplify the same fungal genera/species). The combination of all results from Sanger sequencing and MPS led to fungal identification in 75.8% (94/124) of cases. In total, the addition of NGS to Sanger sequencing increased the diagnostic proportion by 36.3% (45/124; P <.0001). Example of integrated histomolecular diagnosis (Fig. 1): patient with a pseudotumor presentation of pulmonary invasive aspergillosis (A: thoracic CT scan; B: macroscopic examination of lesion after formalin fixation; C, D, E: Hematoxylin-eosin-safran, x20 and x400: observation of a necrotic mass caused by hyalohyphomycetes; F: Grocott, x400) with no culture or molecular identification available on fresh tissue. In contrast, identification by MPS on FFPE tissue was compatible with morphological analysis: Aspergillus section Fumigati, leading to the integrated histomolecular diagnosis of pulmonary invasive aspergillosis.ConclusionThe development of the fungal MPS on FFPE tissues is innovative and unprecedented for the achievement of an integrated histomolecular diagnosis in fungal pathology. It increases significantly the diagnostic proportion by 36.3%. This strategy can be used in hospitals and could improve patient management, especially when no sample is sent to the Mycology laboratory or when the culture is negative.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P454
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P455 Identification of Cryptic species of Aspergillus using Beta-tubulin
           gene in a tertiary care center in South India

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesTo identify cryptic species of the genus Aspergillus using Beta-tubulin gene by sequence typing.MethodsAspergillus grown from various clinical samples (Ear swab, Bronchial wash, Endotracheal Aspiration, Paranasal sinus, BAL, Sputum) was subcultured on Sabouraud's Dextrose Agar/Oatmeal Agar.Tease mount/Slide culture was done to study the morphological features of the hyphae, size, shape, and arrangement of the conidia.DNA Extraction using phenol-chloroform method: DNA was extracted and purified directly from 4-day-old culture and used as a template for polymerase chain reaction (PCR) amplification.DNA Amplification: A fragment of the target gene were amplified using PCR.The primer pairs used for Beta-tubulin gene was Bt2a (Forward primer) and Bt2b (Reverse primer).Beta-tubulin.Bt2a FGGTAACCAAATCGGTGCTGCTTTCBt2b RACCCTCAGTGTAGTGACCCTTGGCDNA Purification: The PCR product was purified with multi-screen filter plates.Gel electrophoresis: The amplified DNA product was subjected to agarose gel electrophoresis and specific band formation was to be observed for the species of Aspergillus.DNA Sequencing: The purified product will be used as a template for sequencing. An applied biosystem 3730 sequencer will be used to obtain DNA sequences.Phylogenetic Analysis: Parsimony analysis of individual and combined matrices will be conducted using PAUP version 4.0b10 software/free software at phylogeny.fr by the maximum parsimony (MP) and Neighbor-joining methods.The results will be represented using a dendrogram.ResultsA total of 30 Aspergillus isolates were collected and identified using Phenotypic methods.The DNA extraction and PCR amplification were done and sent for Sequencing. The results of Sequence typing are awaited.ConclusionCryptic species are morphologically indistinguishable forms of Aspergillus and their identifications can be confirmed exclusively by using molecular techniques which have led to the description of previously unknown or rare species among different Aspergillus species complex. According to studies, the frequency of such species was found to be 10% in TRANSNET study U.S and 12% in FILPOP study Spain. Most of these species are less susceptible and certain species are multidrug-resistant (azoles and amphotericin B) and the emergence of antifungal-resistance among the Aspergillus species forms the importance in identifying Cryptic species.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P455
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P456 Defungi: direct mycological examination of microscopic fungi images

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: To classify five fungi types using two different deep learning approaches and three different convolutional neural network models, VGG16, Inception V3, and ResNet50.Method: A mycological laboratory in Colombia donated the images used for the development of this research work. They were manually labeled into five classes and curated with subject matter expert assistance. The images were later cropped and modified with automated coding routines to produce the final dataset.ResultsWe present experimental results classifying five types of fungi using two different deep learning approaches and three different convolutional neural network models, VGG16, Inception V3, and ResNet50. The first approach benchmarks the classification performance for the models trained from scratch, while the second approach benchmarks the classification performance using pre-trained models based on the ImageNet dataset. Using k-fold cross-validation testing on the 5-class dataset, the best performing model trained from scratch was Inception V3, reporting 73.2% accuracy. Likewise, the best performing model using transfer learning was VGG16, with 85.04% accuracy.ConclusionThe statistics provided by the two approaches create an initial benchmark to encourage future research work to improve classification performance. Furthermore, the dataset built is published on Kaggle and GitHub to encourage future research.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P456
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P457 Clinical correlation of beta galactomannan with culture and patient
           outcome in a tertiary care center in south india

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground: Invasive aspergillosis has increased in the last decade. They mainly occur in neutropenic patients (following anticancer treatment) and in patients treated with immunosuppressants and corticosteroids. The galactomannan antigen in serum appears to be a serological method able to aid in the diagnosis of invasive aspergillosis also the antigen detection in bronchoalveolar lavage has proven to be advantageous for the diagnosis of invasive aspergillosis.Objectives:To perform galactomannan test on BAL and Serum samples.To correlate the galactomannan results with culture.To correlate the galactomannan positive patients with the clinical outcome.MethodsA total of 175 samples were collected from patients suspected to have fungal infections from the period of January 2018 to March 2022 from a tertiary care center in South India. The galactomannan assay and culture were done for these samples. Data of age, sex, gender, diagnosis, underlying conditions, antifungal treatment, and outcomes were collected.ResultsOut of 175 samples collected from patients suspected with Aspergillosis, 120 were males and 55 were females (7 were repeat samples).The major underlying conditions were diabetes and hypertension, coronary artery disease (CAD), and Hematopoetic malignancy such as B Cell lymphomas, ALL, and AML (Fig. 1).The samples sent for galactomannan assay were serum (107 samples), Bronchial wash (74 samples), BAL (4 samples), and tracheal aspirates (3 samples). The test was performed and cultured (Table 1). The cutoff titer for BAL/sera was taken as an index >0.50A total of 90 patients were galactomannan positive. In which, 13 patients were only KOH positive and 6 were KOH and culture positive.In all, 6 cultures grew Aspergillus sp (1), Aspergillus flavus (2), Aspergillus terreus (1), Aspergillus fumigatus (2).A total of 36 patients out of 90 with galactomannan positive were treated with antifungals like liposomal amphotericin B, voriconazole, itraconazole, and fluconazole.In all, 30 patients were discharged, 10 were discharged at request, 86 left against medical advice, 38 patients succumbed to infection, and 12 were outpatients lost to follow-up.ConclusionGalactomannan alone cannot be taken as a diagnostic marker. Clinical correlation, radiologic findings, as well as underlying risk factors play a major role for decision on the initiation of empiric treatment.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P457
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P251 Disseminated Histoplasmosis in a Ghanaian HIV Patient: Role of Urine
           Histoplasma Antigen Testing in Rapid Diagnosis

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackgroundThe inhalation of the thermally dimorphic fungus Histoplasma capsulatum, may result in a wide spectrum of clinical manifestations, ranging from asymptomatic to acute or chronic pulmonary infection to disseminated infection. Symptomatic infections usually occur with high-level exposures or in immunocompromised patients mainly people with HIV. Despite the improved access to antiretroviral therapy, HIV-associated histoplasmosis remains a significant opportunistic infection in endemic regions including Africa. Unfortunately, histoplasmosis is rarely on the diagnostic radar of clinicians in several African countries such as Ghana due to insufficient awareness, inadequate epidemiological data, and poor fungal diagnostic capacity. Herein, we present a case of disseminated histoplasmosis in an HIV/AIDS patient in a tertiary hospital in Ghana.Case PresentationClinical history: A 43-year-old female was referred to the Dermatology Clinic of the Komfo Anokye Teaching Hospital (KATH) with symptoms of fever, cough, and anorexia. She had a history of a skin rash six weeks prior, which initially began on her face and later spread to the trunk and extremities. She was a known HIV/AIDS patient on anti-retroviral drugs (EFV, TFV, 3TC) with no other chronic conditions. She was anemic with a previous hemoglobin level of 7.6 g/dl. Initial diagnostic workup for cutaneous bacterial or viral infection detected no abnormality.ExaminationShe was semi-conscious, and her nostrils were clogged with crust. The patient appeared pale, warm, and anicteric. The face, trunk, and extremities (including palms) were covered with mucocutaneous erosions, ulcers, multiple papule plaques, and nodules. Examination of the cervix revealed the presence of lymph nodes.InvestigationsA fungal diagnostic work-up was done to rule out cutaneous or disseminated mycosis particularly cryptococcosis which was previously captured as a differential diagnosis. Serum cryptococcal antigen lateral flow assay (LFA) (CrAg LFA, IMMY) and Aspergillus galactomannan (GM) (sona Aspergillus GM LFA, IMMY) tests were both negative, but urine Histoplasma GM enzyme immunoassay (EIA) (clarus Histoplasma GM EIA, IMMY) test was positive with a very high optical density indicating high fungal burden was reported. A skin biopsy was also sent for histopathology and fungal culture. Histopathology analysis revealed the presence of yeast cells with round central nuclei and cytoplasmic clearing. Special staining with Periodic acid–Schiff (PAS) confirmed the presence of yeast cells, suggestive of histoplasmosis. Fungal culture was however negative after 8 weeks of incubation. A diagnosis of disseminated histoplasmosis was made.Treatment and outcomeThe patient was administered 200 mg bid of itraconazole. Few weeks after treatment, most of her skin lesions and ulcers were healed. The patient was discharged on itraconazole after the disappearance of some of her lesions. Few weeks later, the patient was admitted but died due to complications of anemia.ConclusionDisseminated histoplasmosis in HIV may be a relatively common but largely unrecognized condition in Ghana. This case report highlights the need to improve awareness of histoplasmosis among clinicians in Ghana and enhance laboratory capacity to provide timely simple contemporary fungal tests for rapid diagnosis and prompt initiation of effective antifungal agents.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P251
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P252 A rare case of fungal liver abscess in an immunocompetent patient
           from India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo report a case of hepatic abscess caused by Candida albicans, which is a less common cause of hepatic abscesses in a non-onco-hematologic population. Fungal infections represent <2% of the total isolates in pus from hepatic abscesses in patients without onco-hematologic malignancies.MethodsA 68-year-old adult male diabetic patient came with complaints of fever with chills and rigor and right upper abdominal pain and yellowish discoloration of eyes and urine. His LFT, PT-INR, RFT were deranged. CBC report shows anemia and Leukocytosis. His CECT showed irregular multiseptated hypodense lesions in segment V, VI, VII of liver. Direct and mycological and bacterial culture examination was performed.ResultsDirect examination of pus sample showed budding yeast cells with pseudohyphae and in SDA culture at 37°C it showed white pasty colonies. The species was identified by VITEK 2 system as C. albicans. The MICs obtained of antifungals were (ug/mL): fluconazole (≤0.5); voriconazole (≤0.12); caspofungin (≤0.12); micafungin (≤0.06); amphotericin b (1); flucytosine (≤1). The patient was started on caspofungin and improved symptomatically. Then oral fluconazole was started and continued until the resolution of lesion on imaging during the follow-up.Discussion: Colonization of the gastrointestinal tract is thought to be the main origin of the dissemination of Candida; neutropenia facilitates the spread of Candida from the gastrointestinal tract to the liver. The likely source of infection is GIT in this case.ConclusionWe describe a case of fungal liver abscess in an immunocompetent patient caused by Candida albicans which was successfully treated with caspofungin.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P252
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P253 Features of Cryptococcosis in human immunodeficiency virus-negative
           patients, France 1985-2020

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesHIV-negative individuals make up an increasing proportion of cases of cryptococcosis in France, but the features of disease and outcomes in this population have yet to be characterized. We describe the presentations and outcomes according to host factors underlying cryptococcosis in HIV-negative individuals in France.MethodsThe French National Reference Centre for Invasive Mycoses and Antifungals has implemented nationwide surveillance of cryptococcosis since 1985 with the determination of the infecting serotype. We analyzed the characteristics of infection in HIV-negative patients diagnosed up to 2020. We also compared the demographic characteristics, presenting features, treatment regimen, and outcomes according to host factor and infecting serotype in patients diagnosed since 2005.ResultsThe mean age of patients was 56.2 years, 60.8% were male, and 60.1% were born in Europe. Only 26 cases were due to Cryptococcus gattii, all others were caused by C. neoformans. Of the 1051 cases, 349 occurred in patients with malignancy (33.2%, including 268 patients with hematological malignancy, 69% of whom had lymphoid neoplasms), 205 occurred in solid-organ transplant (SOT) recipients (19.5%, including 147 kidney and 27 liver), and 298 occurred in patients with ‘other’ underlying factors (28.4%, including auto-immune disease (n = 86), end-stage liver or kidney disease (n = 47), sarcoidosis (n = 42), chronic pulmonary disease (n = 25), and diabetes mellitus (n = 16). A total of 19% of patients (n = 199) had no apparent underlying risk factor.Among 632 patients diagnosed since 2005, there were significant differences according to the four major categories of risk factors (malignancy, SOT, others, and none) in terms of age, diagnostic methods, proportion of patients with positive cryptococcal antigen (CrAg), antigen titers, disease localization, treatment regimens, and 90-day mortality. In the diagnostic workup, a lumbar puncture and blood culture were performed for 96% and 64.2% of patients, respectively, more frequently for immunocompromised patients than those with no underlying host factor (P = .09 and P <.001, respectively). SOT patients had more frequent central nervous system involvement (P <.001), and positive serum CrAg detection with antigen titers >1:512 (P <.001). Patients with malignancy were significantly older (P = .0001) with more frequent fungemia (P = .007). Isolated lung infections (P = .002) and isolated skin lesions (P <.001) were more frequent in patients with ‘other’ conditions and in those with no underlying factor, respectively. Immunocompromised patients were more likely to receive combination antifungals including flucytosine (66.7%, 45.4%, and 42.7% for SOT, malignancies, and ‘other’ conditions, respectively) compared with patients with no underlying factor (33.3%, P <.001). Overall, all cause 90-day mortality was 27.0% (95% CI: 23, 3-31.0%). Patients with malignancy had the highest 90-day mortality (37.3%, <0.001), compared with SOT recipients (23.7%), those with ‘other' conditions (24.7%), and those without underlying conditions (13.9%). Compared with patients with serotype D infections, those infected with serotype A were significantly younger (P = .004), more likely to be born in Africa (P <.001), to have isolated pulmonary disease (P <.005), and less likely to have isolated skin infections (P <.001).ConclusionHIV-seronegative patients with cryptococcosis are a heterogeneous group of patients encompassing different disease characteristics and outcomes. Management of cryptococcosis in HIV-negative patients should be tailored to underlying host factors, disease localization, and infecting serotype.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P253
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P254 Clinical and microbiological spectrum of invasive trichosporonosis
           from a tertiary care institute in India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionTrichosporonosis has emerged as an opportunistic pathogen causing invasive infections in immunocompromised patients. Invasive trichosporonosis can involve most organs of the human body. Trichosporon species can colonize many parts of our body and hence it is important to differentiate between colonization and infection for appropriate management of the patients.ObjectiveTo understand the clinical and epidemiological features of infections caused by Trichosporon spp.MethodsAll patients with clinically significant isolation of Trichosporon spp from various samples during a period of one year from January 2019-December 2019 were included in the study.In the present retrospective study demographic data, risk factors, clinical features, microbiological data, treatment, and the outcome of patients with invasive trichosporonosis were analyzed.All the specimens were processed by standard mycological procedures. Identification and susceptibility were done by VITEK 2. The isolates were sent to NCCPF, PGIMER Chandigarh for identification by MALDI-TOF. As no clinical breakpoints for Trichosporon spp. have been established by CLSI and EUCAST, antifungal susceptibility results were interpreted as suggested by Lemes et al.ResultsThere were 14 cases of trichosporonosis during the study period. The predominant age group was 60-70 years and the male: female ratio is 6.5:1.The underlying condition of the patient at admission was accidental trauma in 4/14 (28.7%) chronic kidney disease in 2/14 (14.2%), hematological malignancy in 2/14 (14.2%), pneumonia in 1/14 (7.1%), retroviral disease in 1/14 (7.1%), acute febrile illness in 1/14 (7.1%). The risk factors for acquisition of infections with Trichosporon species in the 14 patients were administration of broad-spectrum antibiotics in 13 (92.8%), urinary catheterization in 11 (78.5%), central venous catheterization, and prolonged ICU stay in 8 (57.1%) each, previous antifungal therapy in 6 (42.8%). The other risk factors were chemotherapy, steroid usage, and neutropenia.The clinical presentations were urinary tract infections in 10/14 (71.4%) patients (9 were catheter-associated UTIs), fungemia in 2/14 (14.2%), and wound infections in 2/14 (14.2%) patients.Trichosporon asahii is the predominant species isolated in 12/14 (85.7%) patients. Other Trichosporon spp. isolated include T. inkin and T. dohaense. All the isolates were correctly identified by VITEK 2 except one which was identified as T. inkin in VITEK 2 and T. dohaense by MALDI-TOF.All the isolates were susceptible to voriconazole and amphotericin B. 9/14 (64.2%) of the isolates were susceptible to fluconazole. Trichosporon spp. is inherently resistant to echinocandins.A total of 7 patients (50%) were successfully treated with voriconazole for a period of 14 days with advice to follow up and discharged. In all, 5 patients (35.7%) died due to underlying diseases before treatment could be started.ConclusionUrinary tract infection, mostly CA-UTI was the commonest clinical presentation of Trichosporonosis in our study followed by bloodstream infection and wound infection. The commonest risk factor was prolonged broad-spectrum antibiotic therapy followed by urinary catheterization. The growth of Trichosporon spp. from various samples has to be interpreted with caution as the organism can also exist as a colonizer in different body sites. Voriconazole was effective in the treatment of trichosporonosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P254
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P361 Demystifying the NIH grant application process for international
           investigators

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMThe National Institute of Allergy and Infectious Diseases (NIAID) funds one of the largest medical mycology research portfolios. The portfolio includes the major human fungal pathogens and covers basic fungal biology and the more translational areas of therapeutics, vaccines, and diagnostics. NIAID utilizes many granting mechanisms that are open to US and international researchers. These include investigator-initiated applications (R01, R21, and R03s) and targeted announcements for fungal research. Additionally, NIAID has a suite of preclinical services supporting therapeutic, diagnostic, and vaccine development. These services are free and available to investigators in academia, not-for-profit organizations, industry, or governments worldwide. The NIAID granting mechanism can be complicated. Tips and tricks for navigating the NIAID application process and preclinical services will be discussed.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P361
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P362 Seasonal trend of fungal flora in water of tertiary care hospital in
           North India

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesThe study was conducted to assess the seasonal variation of fungal flora in hospital water of a tertiary care hospital in North India.MethodsA total of 200 water samples from the main reservoir, overhead and underground tanks, and taps of critical care units of the hospital were collected. The water samples were filtered by membrane filtration technique (0.22 micron) and cultured on dichloran rose-Bengal chloramphenicol agar with and without benomyl. The plates were incubated for upto 15 days and fungal colonies recovered were sub-cultured on Sabouraud Dextrose Agar and identified by phenotypic methods. Yeasts were identified by Matrix Assisted Laser Desorption Ionization Time of Flight (MALDI-TOF-MS).ResultsMycelial fungi were isolated from 100% of the water samples which included Alternaria, Curvularia, Nigrospora, Penicillium, Aspergillus, Paecilomyces, Scytillidium, and Mycelia sterilia as depicted in Figure 1. Different fungi were prevailing in different water storage units like: Advance eye center— A. fumigatus, A. flavus, Fusarium solani, Alternaria spp. Rhizopus arrhizus, Ustilago spp., mycelia sterilia, Trichosporon spp.; Advance trauma Center—Cladophaialophora spp., Alternaria alternata, Penicillium, spp. A. flavus, A. nidulans, A. fumigatus, F. solani, Rhodotorula spp.: Bone marrow transplant unit— Alterneria alternata, A. niger, A. flavus, A. versicolor, Cladosporium spp., Fonsecaea pedrosoi, Fusarium spp., Nigrospora spherica, Penicillium spp., Rhodotorula spp., Trichosporon ashaii. The seasonal variation of fungal isolation is depicted in Figure 2. Isolation rate of Aspergillus species was 35% in winters, 31% in post-monsoon, 25% in summers. Isolation rate of Penicillium species was 19% in post-monsoon, 16% in winter and 15% in summers. Maximum number of dematiaceous fungi were isolated in summer season with isolation rate of 30% in summers as compared with 21.5% in post-monsoon and 19% in winters. Few yeasts isolated were Rhodotorula, Trichosporon, and Ustilago. Mucorales isolated rarely included Rhizopus, Absidia, Syncephalastrum, and Mucor species. Fungal colony forming units in the water samples ranged from 50 to 450 colony forming units/liter of water.ConclusionThe distribution of fungi in hospital water showed diversity and seasonal variability. Aspergillus species were isolated in maximum number in the winter season, Penicillium species in post-monsoon season and dematiaceous fungi in the winter season. Water as a source of fungal infection in critical care units, remains a relatively neglected area. Water supply could be a source of nosocomial fungal infections. Improving the quality of water by regular testing for fungal contamination and appropriate action to reduce its burden may reduce the hospital-acquired fungal infections.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P362
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P363 Mycoflora diversity in stored water from selected households in
           nairobi

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMIntroduction: Water is a very vital natural resource for all life on earth as it is used widely. Water plays an important role in the world economy, the uses can be categorized into; commercial use where it is used in hostels, restaurants, offices, and other commercial activities. Fungi are ubiquitous in nature; they produce spores that are small-sized, able to stay airborne for a long duration, and transported over long distances during air dispersal. These are major sources of allergens and airway irritants that are detrimental to health. Biofilms in water distribution systems and storage containers provide favorable habitat for microorganisms as they accumulate better in solid-liquid interfaces that enable them to be embedded in the gelatinous matrix of extracellular polymers excreted by the microorganisms leading to resistance of microbes from environmental stresses. Fungi hydrophobicity and adaptability have enabled them to assemble and colonize different surfaces in domestic settings. The potential health effects caused by fungi in treated water are still not well highlighted and thus the need to carry out this study to investigate the mycoflora isolated from stored water.MethodsThis was a cross-sectional study conducted from 2019-2021, whereby 120 water samples were collected from stored containers in households in Nairobi county Kenya. The fungal strains were plated onto Sabouraud's dextrose agar (SDA), Potato Dextrose Agar, and Czapecks Agar media with chloramphenicol (0.05 mg/mL) (Oxoid, U.K.). The plates were incubated for 7 days at 25°C. Fungal identification was done by direct microscopy and morphological features.ResultsA total of 101 fungal species were isolated from water samples. Yeasts 48 (47.5%), Rhodotorula 34 (33.6%) accounted for the unicellular fungi. Among Filamentous mycoflora, the most common isolated fungi were Aspergillus species 13(12.8%), followed by Fusarium spp 4 (3.9%) with Mucor and Rhizopus species accounting for 1 (0.9%) respectively. Yeasts species were the most common species isolated from water species and Aspergillus species were more frequently isolated from filamentous fungi.ConclusionYeasts species were the most common species isolated from water species and the roles they play in biofilm needs to be further investigated.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P363
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P364 Quantitative monitoring of Aspergillus fumigatus mycelial growth by
           optical density

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesFilamentous fungi generally form hyphal pellets in liquid culture. This property prevents filamentous fungi from applying the growth monitoring methods used for unicellular organisms such as yeast and bacteria. We have analyzed the biological functions of cell wall polysaccharide α-1,3-glucan and extracellular polysaccharide galactosaminogalactan (GAG) in Aspergillus species, and revealed that both α-1,3-glucan and GAG contribute to the pellet formation. Here we constructed the double disruption mutant of α-1,3-glucan and GAG biosynthesis-related genes (Δags1Δgtb3) in Aspergillus fumigatus AfS35 strain, and used the mutant for quantitative monitoring of the mycelial growth by optical density.MethodsTo measure the optical density of conidia and mycelia in shake-flask culture, conidia (final concentration, 1.0 × 10⁷/ml) of AfS35 or Δags1Δgtb3 strain were inoculated into 50 ml of Aspergillus minimal medium (AMM) medium in a 200-ml Erlenmeyer flask and rotated at 160 rpm at 37°C. At each sampling point, the culture (2 ml) was withdrawn, and 100 μL of the culture was mixed with 100 μL of 4% paraformaldehyde solution in a 96-well plate. OD₆₀₀ was measured in a microplate reader. To evaluate the susceptibility of the Δags1Δgtb3 strain to antifungal agents, conidia (final concentration, 5.0 × 10⁶/ml) were inoculated into 500 μL of RPMI medium containing an antifungal agent (voriconazole, itraconazole, amphotericin B, flucytosine, or micafungin) in a 48-well plate and rotated at 300 rpm using a microplate mixer at 35°C for 15 h, and OD₆₀₀ was measured in triplicate.ResultsIn AMM flask culture, pellets became visible in AfS35 from 9 h, and their size increased with time, whereas the Δags1Δgtb3 hyphae were continuously dispersed (Fig. 1a). The OD₆₀₀ measurements of AfS35 suggested no correlation between apparent AfS35 growth and OD₆₀₀ (Fig. 1b). In the Δags1Δgtb3 strain, the first and third quartiles were 0.633 and 0.595 at 15 h (Fig. 1b), suggesting that the measurement of OD₆₀₀ is suitable for monitoring the growth of the mutant. As an application of the monitoring method, the Δags1Δgtb3 strain was grown in an RPMI medium containing the indicating antifungal agent for 15 h in a 48-well plate (Fig. 2). Growth was repressed in the presence of antifungal agents tested, except for micafungin (Fig. 2). Growth was completely inhibited at 2 μg/ml of voriconazole, 1 μg/ml of itraconazole, 0.5 μg/ml of amphotericin B, and 256 μg/ml of flucytosine (Fig. 2), which was in agreement with MICs determined by CLSI M38-A2.ConclusionWe established a convenient strategy to monitor A. fumigatus hyphal growth. Our method can be directly applied to screening for novel antifungals against Aspergillus species.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P364
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P268 Laryngeal Mucormycosis: does mucor take the voice away'

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjective: This case aims to highlight a unique presentation of Mucormycosis.Methods and Results: A 57-year-old retired office supervisor, presented to the ENT department with complaints of hoarseness of voice ending with almost complete dysphonia over 6 months. There were no complaints of stridor, dyspnea or dysphagia. He had no history of prior surgery or tracheal intubation. On examination, a lesion over his right vocal cord was noted (Fig. 1) and underwent surgical excision of the lesion.HPE of the lesion (Fig. 2) showed hyperplastic stratified squamous epithelium which was partly ulcerated and covered by thick bands of necro-inflammatory material. Within the necrotic material were seen broad aseptate fungal hyphae. Beneath the necrotic material was inflamed granulation tissue with fibrosis. No tissue or vascular invasion was noted as per the report, however there was a recurrence of the lesion after 15 days.ID team opinion was sought in view of need for antifungals. Owing to financial constraints, CT chest could not be done, but his chest X-ray was normal. His HbA1c was 7.5%, which was suggestive of newly detected diabetes mellitus (DM).In this case, even though no angioinvasion or tissue invasion was reported, the presence of hyphae in the area of necrosis, the presence of inflammatory local tissue reaction, coupled with newly detected DM, prompted the ID team to advise treatment with amphotericin B followed by suspension posaconazole (GR was not available at the that time). The patient was not willing for treatment at the time. However, local recurrence of the lesion occurred 2 weeks later. Surgical resection along with posaconazole, TDM and close follow-up was advised. However, the patient was lost to follow-up, possibly due to loss of confidence in us'ConclusionThe importance of sending every surgically excised tissue for histopathology and culture has been highlighted by this case. Early ID opinion and AF therapy could have averted recurrence and loss of patient confidence. Chronic Granulomatous form of mucormycosis though rare, needs timely diagnosis and treatment in the form of surgical resection as well as systemic antifungal therapy.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P268
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P205 Uncommon Aspergillus species encountered in human infections

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveAspergillus species are ubiquitously found in environment and have propensity to infect both immunocompromised as well as immunocompetent individuals. Though the most common species implicated in human illness include Aspergillus fumigatus and A. flavus, many uncommon Aspergillus species are increasingly being reported. Moreover, these Aspergillus species have the potential to afflict varied organ systems and can thereby, be implicated in a wide array of infections. Here, we describe three patients infected by rare Aspergillus species viz. A. sclerotium, A. cristatus, and A. japonicum causing brain abscess, corneal ulcer and chronic dacrocystitis.MethodsUncommon Aspergillus species were isolated from clinical samples (nasal scraping, corneal scraping, and brain biopsy). Samples were inoculated on Sabouraud dextrose agar (incubated at 37°C and 25°C) and brain heart infusion agar (incubated at 25°C), followed by slide culture and lactophenol cotton blue (LCB) mount. The isolates were further subjected to molecular identification using polymerase chain reaction (PCR) targeting ITS region, followed by sequencing. Demographic details, clinical characteristics, risk factor, and management profile associated with these Aspergillus species were evaluated. We conducted systematic review using the search terms ‘A. sclerotium’ AND ‘humans’, ‘A. cristatus’ AND ‘humans’ and ‘A. japonicum’ AND ‘humans’.ResultsWe isolated three newer Aspergillus species from nasal scraping, corneal ulcer and brain biopsy. Direct microscopy using potassium hydroxide-calcofluor mount from all these clinical samples showed hyaline septate hyphae in background of pus cells. After 3-5 days of incubation, yellow-green mycelia were observed on the obverse in all the isolates. However, their microscopic features did not relate with the typical lactophenol cotton blue (LCB) picture of A. flavus, owing to which these were sub-cultured on Czapek Dox agar. After 4-5 days of incubation, LCB of these isolated again failed to divulge any specific picture and these isolates were subjected to molecular identification.Nasal scraping from 31-year-old immunocompetent male who presented with post-traumatic chronic dacrocystitis and recurrent orbital cellulitis yielded A. japonicum. He responded well with empirical antibiotics and oral voriconazole.Corneal scrapings from 56-year-old immunocompetent male who presented with post-traumatic blurring of vision yielded A. cristatus. He was treated with nystatin and voriconazole with good response.Brain biopsy from 45-year-old male with hypertension and subarachnoid hemorrhage, who presented with fever, headache, vomiting and periorbital swelling yielded A. sclerotium. He was treated with amphotericin B and had favorable outcome.The systematic literature review didn't yield any results of infection caused by these species in humans.ConclusionThis is the first report of isolation of A. sclerotium, A. japonicum, and A. cristatus from human tissue, though these fungi have been isolated from ambient air and environment. The present report highlights the emergence of uncommon Aspergillus species causing invasive infections even in immunocompetent patients and the requisite of molecular modalities to aid in identification of these rare, emerging species.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P205
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P206 Phenotypic and molecular characterization of emerging Basidiomycete
           Schizophyllum commune isolated from clinical samples from India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveSchizophyllum commune is an environmental basidiomycete capable of causing human infections. Its identification is difficult as often it produces sterile, cottony white colonies without any conidia formation. S. commune is characterized by clamp connections and hyphal spicules. Though it produces basidiocarps with basidiospores it is difficult to induce in vitro. Molecular techniques are essential to confirm its identification. Here, we present the description of Schizophyllum commune isolates collected at our center over the last 5 years.MethodsAll the isolates used in this study was received from various part of India and accessioned at the National culture collection of pathogenic fungi (NCCPF), Chandigarh India. Isolates were grown on Sabouraud dextrose agar and malt-extract agar (MEA) at 25°C for 5-7 days. Lacto phenol cotton blue mounts were prepared and a microscopic examination was done. For observing basidiocarps, MEA plates were incubated for 6-8 weeks. DNA extraction was done using the phenol-chloroform method and ITS region was amplified using pan-fungal primers followed by Sanger sequencing.ResultsAmong total of 22 Schizophyllum commune cultures, 19 were isolated from lower respiratory samples, two from corneal scrapings, and one from the brain. Upon microscopic examination, the major identification feature of this fungi, i.e., clamp connection and spicules were observed only in 8 (36%) isolates. The remaining 14 (64%) were identified up to species level using ITS sequencing. Basidiocarps could be induced only in two isolates.ConclusionAlthough rarely involved in human disease, Schizophyllum commune is being isolated from the clinical specimens. As microscopic identification is difficult and needs expertise, molecular identification is required for early diagnosis and treatment.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P206
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P373 Does biofilm forming capacity of Candida tropicalis vary with
           echinocandin susceptibility'

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCandida tropicalis is a common cause of nosocomial candidemia and candiduria. The role of biofilm formation in virulence and antimicrobial resistance in C. tropicalis remains under-investigated. We aimed to evaluate the biofilm-forming capacity of C. tropicalis isolates exhibiting resistance, borderline resistance, and sensitivity to echinocandins.MethodsThe echinocandin resistant, borderline resistant, and susceptible isolates of C. tropicalis were collected based on their minimum inhibitory concentration (MIC) values according to Clinical and Laboratory Standard Institute (CLSI) broth microdilution guidelines. The isolates were subjected to FKS1 gene sequencing. To estimate biofilm production, echinocandin resistant (n = 2), borderline resistant (n = 5), and susceptible isolates (n = 3) were seeded at the cell concentration of 1 × 10⁶ cells/mL in RPMI-1640 with 0.165 M MOPS in polystyrene 96-well microtiter plates and incubated for 24 and 48 h at 37°C. The biofilm was quantified by crystal violet/safranin-based spectrophotometric method and XTT (2,3-Bis-(2-Methoxy-4-Nitro-5-Sulfophenyl)-2H-Tetrazolium-5-Carboxanilide) reduction assay. Statistical analysis was performed using one-way ANOVA with Bonferroni's post-hoc test for multiple comparisons among the groups.ResultsFKS1 sequencing analysis revealed S654P mutation in HS1 in both resistant isolates while isolates exhibiting borderline MIC to echinocandins carried wild-type FKS1 gene. Biofilm formation in borderline echinocandin-resistant C. tropicalis isolates was significantly (P <.005) higher compared with resistant and susceptible isolates. However, no significant difference in biofilm formation was noted among resistant and susceptible isolates.ConclusionThis study suggests differential biofilm-formation capacity among C. tropicalis isolates with reduced susceptibility to echinocandins. However, this warrants further studies before any definitive inference can be made.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P373
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P374 Fungal coinfection in patients with SARS-CoV-2: Atertiary care
           hospital study

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground: There is a high risk of developing fungal co-infections in patients infected with SARS-CoV-2, few studies have been conducted on the incidence and risk of these secondary infections. The incidence of Candida infection due to different Candida species is increasing in COVID patients.MethodsThis retrospective study comprised a total of 23 patients with upper respiratory infection investigated in the Department of Microbiology of University College of Medical Sciences (UCMS) and Guru Teg Bahadur Hospital (GTBH), Delhi from April 2021 to June 2021. Identification was done using DNA sequencing.ResultsOf the 23 cases, identification by DNA sequencing, C. albicans was present in 34.78%, C. tropicalis in 30.43%, Pichia kudriavzevii in 26.08%, C. parapsilosis in 4.3%%, and C. auris in 4.3%.ConclusionC. albicans is the leading pathogen in our patients, along with the rise in the incidence of P. kudriavzevii which is usually an environmental contaminant. Regular surveillance and infection control practices are future ventures to reduce the burden of infection.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P374
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P377 Study of the prevalence of candidemia and its antifungal
           susceptibility pattern in a tertiary care hospital

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesStudy of the prevalence of candidemia and its resistance pattern in a tertiary care hospital.Methods:Retrospective observational studyStudy period—January 1, 2020-December 31, 2021Blood culture bottles (aerobic and anaerobic) were received in the laboratoryIncubated in BacT Alert 3D (Biomerieux) for 5 daysAfter flagging positive, a direct gram stain was prepared from the culture bottle and informed to the clinician. Culture plating was done on Blood agar and Mac Conkey Agar which were incubated for 18-24 h at 37°C.After 24 h, growth was obtained on the culture plate and identification was done by using MALDI-TOF MS (Biomerieux) and Susceptibility Testing was done using VITEK 2 Compact (Biomerieux).Antifungal sensitivity testing was done using VITEK 2 Compact for fluconazole, voriconazole, caspofungin, micafungin, amphotericin B, and flucytosine.Results:During the study period, 18 235 blood culture bottles were received, and 1652 blood culture bottles were flagged positive. The most common organism causing bloodstream infection belonged to Burkholderia spp.Candida sp (4%) was found to be the sixth most common organism causing bloodstream infection.Among Candida spp most common isolate was C. tropicalis 42% followed by C. parapsilopsis 21%, C. albicans 21%, and C. auris 12%, and the least isolated species was C. glabrata 4%.Maximum number of Candida spp were isolated from intensive care units.Susceptibility testing was given by VITEK 2 compact for all Candida spp except for Candida auris.The isolated Candida spp showed the least susceptibility to fluconazole (resistant rate R 30.6%) as compared to micafungin, caspofungin, flucytosine, and amphotericin B (R 13.9%, 13.9%, 22.2%, and 5.6%,) respectively.Candida glabrata showed less sensitivity toward caspofungin as compared to other antifungals.ConclusionCandida spp. are a part of the normal flora of healthy hosts but are also found to be a major cause of invasive fungal infections which is now found to be one of the leading causes of mortality in hospitalized patients. The emergence of unusual and relatively unknown Candida species as nosocomial pathogens with increasing treatment failure, emphasizes the need to isolate and identify all species and to start early definitive treatment according to the susceptibility pattern reported to decrease mortality and morbidity rates.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P377
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P378 Insecticidal potential of isolated fungal species in targeting
           Drosophila melanogaster and Zaprionus indianus

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesFruit flies are polyphagous insects that attack a variety of commercially significant plants, which resulted in the build-up of insecticide resistance making the research focus shift toward alternative pest management tools in order to reduce risks to humans, environment, and non-target organisms.MethodsFungal species were isolated and molecularly characterized from Drosophila culture medium. Virulence assay was conducted against third instar larvae and adults of Drosophila melanogaster and Zaprionus indianus. Percent adult emergence and larval mortality were calculated.ResultsThree species: Meyerozyma caribbica, Pichia kudriavzevii, and Aspergillus flavus were identified by ITS region sequencing. A. flavus was the most virulent against larvae and adults of D. melanogaster and Z. indianus followed by P. kudriavzevii and M. caribbica (44%-100% mortality). Lethal time to 90% mortality (LT90) ranged from 4.5 to 7 days (P. kudriavzevii) and 3.2 to 4.5 days (A. flavus).ConclusionThese preliminary findings suggest that the isolated fungal species can be deployed in targeting the developmental life stages of Drosophila species and hence, controlling invasive insect pests in an eco-friendly way. The use of these biological control agents could further minimize the use of harmful insecticides which has substantial global health benefits.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P378
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P379 Antifungal activity of α defensins 5 like peptide against
           Cryptococcus neoformans var. grubii and in silico designing of its
           peptidomimetics

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCombinatorial and retroviral therapies have been found effective in the treatment of cryptococcosis, but safer and more potent antifungal therapeutics are the need of the hour. In this regard, the natural antifungal peptides (AFPs), the essential components of the innate immune system have drawn the attention of researchers and drug developers. AFPs are 12-50 amino-acids-long host defense peptides of cationic nature. Although AFPs have certain limitations like low stability, susceptibility to proteolysis, loss of activity in the presence of metal ions and salts, short half-lives, and peptide aggregation in oral formulation, but these can be addressed by designing and synthesizing the peptidomimetics.Methodology: The whole blood of the rat was collected by cardiac puncture. The blood was mixed with 0.83% aqueous ammonium chloride. The neutrophils were separated from lysed WBCs by centrifugation. The purification of the peptide was carried out by SDS-PAGE, size exclusion, cation exchange chromatography, and HRLCMS. The MSA of the characterized peptide was performed using a T-coffee program. The in vitro antifungal activity of crude was tested against C. n. grubii (ATCC 6352) using flow cytometry. The structure of peptides was altered through ChemDraw by replacing the elements with their bioisosteres to form mimetics. The peptide and its mimetics were docked upon the target of C. n. grubii, i.e., O-acetyl transferase (modeled through Phyre2 web server) using PatchDock, and FireDock web servers.ResultsThe peptide isolated from rat PMNs had a molecular weight of 3 kDa. It has lysine and arginine which are the characteristic residues of an antifungal peptide. The eluted peptide has the highest (83%) similarity with α defensins 5 (accession no NP_001013071 XP_214 386). The mild antifungal activity of peptide was evident against C. n. grubii. The structure of O-acetyl transferase was modeled with 100% confidence and 92% query coverage (Table 1). The mimetic 1 (M1) showed the best interaction with O-acetyl transferase with −54.47 Kcal/mol binding energy and 4 hydrogen bonds (Table 2).ConclusionThe designed M1 of α defensins 5 like peptide could be a promising lead in antifungal drug development. As mimetic 1 was designed using an in-silico approach, its synthesis and wet lab validation are desirable.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P379
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P458 Comparison of PCR protocols for detecting Histoplasma capsulatum and
           Coccidioides spp. DNA through a multicenter study

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMIntroduction: In-house real-time PCR (qPCR) is increasingly used for the diagnosis of endemic mycoses and diverse assays are in use in specialized laboratories. External quality control is currently lacking.Objective: To compare the performance of different molecular detection protocols for the detection of Histoplasma capsulatum and Coccidioides spp. in a multicenter study involving five European laboratories.MethodsTwo test sample panels were sent to each laboratory which performed the analysis with their in-house assays. Recipients were blinded to sample content. The Histoplasma-panel included 14 samples representing a range of concentrations of Histoplasma DNA (n = 7), as well as a negative control and DNA from other fungi to test for specificity (Paracoccidioides lutzii n = 1; Blastomyces dermatitidis n = 1; Aspergillus fumigatus n = 1; Emergomyces spp. n = 2, and Candida albicans n = 1). The Coccidioides-panel included 10 samples representing a range of DNA concentrations of Coccidioides posadasii (n = 6), as well as a negative control and DNA from other fungi to test specificity (Uncinocarpus reesii n = 1; Trichophyton violaceum n = 1; and Candida albicans n = 1). Regarding techniques used, four laboratories used Histoplasma qPCRs, and one laboratory a conventional PCR and a broad-range PCR (brPCR) for fungal DNA. Four laboratories used different Coccidioides qPCRs and one laboratory a brPCR to detect Coccidioides DNA.ResultsConcerning the Histoplasma panel, qPCR assays were the most sensitives and agreement in the lowest detected amount of Histoplasma DNA was very suitable, ranging from 1 pg to 4 pg [<1 genomic equivalent (mean sensitivity: 96.4%)]. The lowest detected amount of Histoplasma DNA by cPCR (sensitivity 71.4%) and the brPCR (sensitivity 42.9%) was 0.1 and 10 pg, respectively. Overall, sensitivity ranged from 42.9-100% (mean 83.3%). Overall specificity ranged from 78.6%-100%, with false positive results occurring with high DNA concentrations (200 pg/μl) of Blastomyces spp. in two laboratories that used qPCR, Emergomyces spp. by qPCR in one laboratory and Aspergillus in one laboratory that used cPCR. Concerning the Coccidioides panel, sensitivity ranged from 33.3-100% (mean 76.6%), and agreement of the lowest detected amount of Coccidioides DNA by qPCR ranged from 1-16 pg (<1 genomic equivalent) (mean sensitivity: 87.5%) and in the brPCR 10 pg (sensitivity 33.3%). Specificity was between 87.5%-100%, with one false positive result occurring with high DNA concentrations (20 pg/μ) of Uncinocarpus in one laboratory using qPCR.ConclusionSpecific protocols based on qPCR showed better sensitivity than conventional and brPCR. These methods are useful for the rapid and sensitive detection Histoplasma and Coccidioides. Application of these tests on clinical samples may speed up diagnosis and potentially limit laboratory exposure to these fungi. Comparisons of in-house tests are essential to assess the performance and detect potential cross-reactivities and achieve a consensus.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P458
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P459 The Aspergillus lateral flow assay for the diagnosis of chronic
           pulmonary aspergillosis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesChronic pulmonary aspergillosis (CPA) is an uncommon and problematic pulmonary disease, complicating many other respiratory disorders. Measurement of Aspergillus-specific IgG antibodies had a higher sensitivity than either IgM, IgA, or IgE and it should therefore be considered the most appropriate test for screening CPA. Aspergillus-specific IgG antibody levels have been successfully used to monitor the response of CPA to medical therapy. Recently, a novel rapid test for Aspergillus-specific IgG antibody from Dynamiker Biotechnology (Tianjin) Co., Ltd. was released as a screening test of CPA. It is a fluorescent immunochromatographic cassette test using a monoclonal antibody against Aspergillus-specific IgG antibody and Europium nanoparticles (Eu NP) (Fig. 1). It is a semi-quantitative test which was easy to operate, rapid with portable detection devices, and can be widely accepted by clinical and primary medical (Fig. 2). We collect clinical samples to verify the detection performance of the Dynamiker Quic™Aspergillus-specific IgG antibody (LFA) test.MethodsIn total, 102 patients were included and 42 patients were diagnosed with CPA. The pathogen was identified from sputum, BALF culture, lung resection surgery, bronchos copy biopsy, percutaneous lung biopsy and BALF GM assay.ResultsThe sensitivity, specificity, PLR, NLP and Kappa index of the IgG antibody test were 85.6%,94.4%,14.0%,0.23% and 0.72, respectively.Conclusions: The current work indicates that the Dynamiker Quic™ Aspergillus specific IgG antibody (LFA) test shows a promising application in the diagnosis of CPA. The results are accurate and reliable, and it could be used as an aid for the early rapid screening test of CPA.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P459
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P460 The Aspergillus Lateral Flow Assay for the diagnosis of invasive
           Aspergillosis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesInvasive Aspergillosis (IA) is a life-threatening opportunistic mycosis that occurs in some people with a compromised immune system. The detection of Aspergillus galactomannan (GM) rapidly gained widespread acceptance as part of the diagnostic workup of a patient suspected of IA. Recently, a Novel QuicGM™ Aspergillus Galactomannan Ag Lateral Flow Assay (LFA) from Dynamiker Biotechnology (Tianjin) Co., Ltd. was released as a screening test of IA. It is a fluorescent immunochromatographic cassette test which using a monoclonal antibody against GM and Europium nanoparticles (Eu NP) (Fig. 1). It is a semi-quantitative test which was easy to operate, rapid with portable detection devices, and can be widely accepted by clinical and primary medical (Fig. 2). We conducted a comparative study between the Dynamiker QuicGMTM Aspergillus Galactomannan Ag (LFA) and the Bio-Rad Platelia™.MethodsA total of 66 serum samples and 54 BALF samples were collected, 15 serum samples from the College of American Pathologists (CAP) certificated lab were also included in this study. The samples were tested in parallel using the Bio-Rad Platelia™ Aspergillus Ag (ELISA) and Dynamiker QuicGM™ Aspergillus Galactomannan Ag (LFA).ResultsThe total coincidence rate of the two assays was 98.48% (Kappa value was 0.97 >0.75) and 90.74% (Kappa value was 0.81 >0.75) in 66 serum samples and 54 BALF samples respectively.Conclusions: The performance of the Dynamiker QuicGM™Aspergillus Galactomannan Ag (LFA) and Bio-Rad Platelia™ Aspergillus Ag (ELISA) were highly consistent, and the performance of Dynamiker Aspergillus Galactomannan kit were all in line with the statement of the manufacturer. The results are accurate and reliable, and it could be used as an aid for the early rapid screening test of IA.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P460
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P461 Cryptococcosis screening and isolates characterization in
           asymptomatic people living with HIV in Kinshasa, DRC

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCryptococcal meningitis (CM) is a life-threatening invasive mycosis affecting people living with HIV (PLHIV) and has a high prevalence and case fatality rate in sub-Saharan Africa. While most PLHIV presenting CM are symptomatic, the asymptomatic ones are diagnosed following routine screening tests indicated for all advanced PLHIV (CD4 <200/μl). We, therefore, hypothesized that asymptomatic CM patients would be infected with different Cryptococcus spp. strains than those in symptomatic CM patients (referring to the parallel study conducted in the same clinics). This study describes the prevalence of serum and meningeal cryptococcosis in asymptomatic PLHIV presenting a CD4 count of <200 cells/μl in the screening context. We then characterized and determined the antifungal susceptibility of Cryptococcus spp. strains isolated from these patients.MethodsWe performed cross-sectional screening for serum cryptococcal antigen (CrAg) in ambulant PLHIV with <200 CD4/μL in three clinics in Kinshasa (DRC). Lumbar puncture was indicated in positive patients to exclude a meningeal location for therapeutic purposes. The resulting cerebrospinal fluid (CSF) was then analyzed for CrAg and Cryptococcus spp. was isolated and characterized by MALDI TOF MS, serotyping PCR, ITS sequencing, and multilocus sequence typing (MLST). In addition, the EUCAST E.Def.7.3.2 microdilution procedure was followed to determine the susceptibility of strains to antifungal agents.ResultsA total of 47 PLHIV out of 262 included were tested positive for serum CrAg (19%, 95% CI: 14.2–24.3) from which 46.8% (22/47) had a high antigenic titer (≥1/160). The prevalence of asymptomatic CM was then estimated at 50% in CrAg serum-positive patients who consented to lumbar puncture (19/38). Although the female proportion included in the study was higher than that of men, serum CrAg was more positive in men (21.4%, 18/84 men included) than in women (18.0%, 29/161 women included). While the mean CD4 count of CrAg serum-positive patients were significantly lower than that of negative patients (P <.05), the median viral load between the two patient groups was approximately similar (P >.05). Only four CSF samples were positive in culture for Cryptococcus spp. and were all characterized as Cryptococcus neoformans/serotype A.At this stage, two isolates have been analyzed using the ISHAM MLST scheme and two different sequence type (ST) profiles were identified, namely: ST93 and ST63. While ST93 is the main Cryptococcus neoformans profile described in Congolese (DRC) PLHIV with CM, ST63 has not yet been identified in the DRC before. Of note, epidemiological and clinical specificities of ST63 have so far been poorly characterized in the literature. Susceptibility testing against the major antifungals and the MLST typing of the two remaining strains are still ongoing.Conclusions: The prevalence of cryptococcosis should not be neglected among asymptomatic PLHIV in the DRC, to meaning that screening and preventive treatment measures should be integrated into the national policy for HIV management and related diseases. For the rest of the analyses still in progress, conclusions can only be drawn once they have been fully finalized.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P461
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P462 Spread of sporothrix brasiliensis from the sneeze of infected cats: a
           potential novel route of transmission

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCat-transmitted sporotrichosis (CTS), caused by Sporothrix brasiliensis, is an emerging fungal disease that has become a major public health concern in Brazil. Transmission of CTS usually occurs through the implantation (e.g., scratches or bites) of infectious yeast from feline Sporothrix lesions. Recent reports on transmission events have suggested that S. brasiliensis might be transmitted through feline respiratory droplets created while sneezing. The aim of our study is to determine whether infectious respiratory secretions are expelled when cats with sporotrichosis sneeze.MethodsWe collected respiratory secretions expelled while sneezing from 28 cats diagnosed with sporotrichosis. We placed a Mycosel agar plate, a fungal culture medium, in front of the animals’ nostrils and used a nasal swab to stimulate sneezing (Fig. 1). Samples were incubated at 28-30°C for 4 weeks in the Mycology laboratory of Hospital de Clinicas. Molecular identification of the isolates was performed by sequencing the calmodulin gene. The infected cats enrolled in the study were subsequently treated at the School Veterinary Clinic of the Pontifical Catholic University of Paraná, a referral hospital for the treatment of feline sporotrichosis.ResultsOut of the 28 respiratory samples collected, 20 (70%) had evidence of fungal growth morphologically consistent with Sporothrix. Sequencing of all isolates identified Sporothrix brasiliensis (Fig. 2).ConclusionWe identified a possible novel route of transmission of Sporothrix spp. through infectious feline respiratory secretions expelled during sneezing. The respiratory droplets created by a sneeze could contain viable Sporothrix yeast that could infect humans and other animals after mucosal exposure. One health partner and collaborator such as veterinarians, physicians, health authorities, epidemiologists, and fungal disease researchers should be made aware of the potential spread of Sporothrix through respiratory droplets and sneezing to prevent and control the further spread of CTS. To prevent cat-to-human transmission of Sporothrix brasiliensis, personal protective equipment (PPE) should be worn while handling a cat with suspected sporotrichosis. Veterinarians, veterinary clinic employees, students, and pet shop owners are at increased risk due to their professions. Veterinary care frequently involves procedures that encourage respiratory droplets (e.g., nasal swabs); restraint and other close contact may directly expose staff to infectious secretions. Because this study identified viable yeast in respiratory droplets from sneezing, decontamination and disinfection of exposed surfaces is increasingly important, as surfaces and objects can serve as fomites for Sporothrix. Physicians who diagnose and treat human cases of sporotrichosis should be aware of this new transmission method to improve clinical suspicion, diagnosis, and treatment for sporotrichosis. Approximately half of the human patients with conjunctival sporotrichosis did not report experiencing traumatic injury from cats; mucosal exposure to infectious yeast is a likely alternative transmission method.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P462
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P463 Toxicological evaluation of Aureobasidum pullulans var. pullulans
           induced mycotoxicosis in amurine model

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesThe genus Aureobasidium includes 14 species, amongst which Aureobasidium pullulans is the most well-known species. Aureobasidium pullulans, includes two well-documented varieties found in indoor environments and associated with health issues: A. pullulans var. pullulans and A. pullulans var. melanogenum. Aureobasidium pullulans is a mold belonging to the family Dothioraceae. It colonizes nails, hair, and skin in humans. Deleterious immune reactions may occur in humans, like hypersensitivity pneumonitis and allergies. Respiratory allergies may result due to high levels of Aureobasidium in the air. The metabolites of the mold, like mycotoxin, are known to cause toxic-irritant effects. In view of this, the present work evaluates the effects of the toxic secondary metabolites of A. pullulans var. pullulans (CBS 577.93) in a murine model.In order to maximize the toxicological potential of A. pullulans pullulans (CBS 577.93) for the production of mycotoxins, an understanding of its mode of action in an animal model is necessary. In the present study, we report the mycotoxicological activity of A. pullulans pullulans (CBS 577.93) in experimental mice.Material and Methods: Mycotoxins isolated from A. pullulans pullulans (CBS 577.93) were used for the experimental induction of mycotoxicosis in Swiss mice (C3HHC strain). The mycotoxin was administered intraperitoneally (IP) and intranasally (IN). To assess the toxic effects of the A. pullulans mycotoxins, eight organs, namely liver, lungs, kidney, spleen, stomach, heart, brain, and testis, were taken into consideration. The hematological, histopathological, and biochemical aspects of A. pullulans-induced mycotoxicosis were investigated.Results:Behavioral observations—A significant decrease in the consumption of feed in both IN and IP groups was noted. The weights of the mice increased in both the IP and IN groups.Anatomical observations—Gross lesions on the liver and lungs and the presence of cysts or polyps were noted on autopsy in both groups. Likewise, relative organ body weight percentage also increased in all the organs except the testis.Hematological analysis—Lymphocytosis and neutropenia were observed in IP as well as IN groups.Biochemical analyses—Elevated malondialdehyde (MDA), reduced catalase (CAT) and superoxide dismutase (SOD) production; abnormal levels of aspartate transaminase (AST) and alanine transaminase (ALT) were observed, which signifies A. pullulans mycotoxin induced oxidative stress.Histological observations—Histopathological changes characterized by inflammation and amyloid in the liver, edema in the lungs, tubule hypertrophy in renal tissues, angiectasis in the spleen, hyperplasia in gastric tissues, neurodevelopmental anomaly in the brain, and degeneration in the testis were observed.Cell apoptosis factor—The reduced activity of caspase-3 enzyme was noted in both the mycotoxicosis-induced groups.ConclusionThus, from the present study, we concluded that mycotoxins isolated from A. pullulans (CBS 577.93) documented toxicity in all eight organs, with the testis and lungs being the worst affected organs. Even at a very small concentration and short exposure, the mycotoxin caused severe damage to the vital organs. New risk assessment approaches should be considered to investigate the toxicological interactions of A. pullulans mycotoxins in the indoor environment and in animal models.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P463
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P464 Feline sporotrichosis: an emerging disease in the Brazilian side of
           the Southern Triple Border

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMSporotrichosis is a neglected tropical disease caused by fungi of the genus Sporothrix spp. Transmission can occur through sapronotic, enzootic, and zoonotic pathways. Sporothrix schenckii and S. brasiliensis are the most common etiologic agents in human and animal diseases in Brazil.ObjectivesThe objective of this work is to alert about the emergence of feline sporotrichosis on the Brazilian side of the Southern Triple Border (Brazil, Paraguay, and Argentina).MethodsFrom July 2021 to March 2022, biological samples and clinical-epidemiological data were collected from 57 domestic cats with typical sporotrichosis lesions and residents of Iguassu Falls (Foz). The cats were selected through notification of the citizens themselves, health agents of Zoonosis Control Center of Iguassu Falls (CCZ–Foz), veterinarians from private veterinary clinics and hospitals, and the receipt of suspected animals by CCZ–Foz. From the samples, direct mycological examinations and fungal culture were performed and a set of 10 fungal isolates from the microbiological tests were selected for molecular analysis based on calmodulin (CAL) gene sequences. From each collection point, the geographic coordinate was taken using the Google Earth® software and the Quantus Gis software (QGIS) was used to assemble the maps.ResultsOf the 57 samples collected, 45 were considered positive in the microbiological tests (Fig. 1), and the first 10 isolates were identified as S. brasiliensis. Based on clinical-epidemiological, and geographic data (Fig. 2), the following problems associated with feline sporotrichosis in this region were identified: the presence of sporotrichosis positive cats in high-density regions population of Foz; the epidemic profile of the disease with cases spreading quickly by neighborhoods in the South region of the city to neighborhoods in the North region; the easy access to the street and other homes of infected cats, which facilitates the zoonotic and enzootic transmission cycle of this disease; the free movement of animals positive for backyards and vacant lots where they can defecate and even come to death the that feeds the sapronotic cycle; and the profile most associated with the animal positive being that of an uncastrated male, not vaccinated and with little or no access to veterinary services.ConclusionFor being a region of the Triple Frontier, there are many differences in political, administrative, and operational between the Public Health Systems of the three countries, with Paraguay and Argentina, the political-administrative-operational centralization is configured as a great node critical for the development of health actions in an adequate way to the needs at a loco-regional level and, above all, on time for the implementation thereof. With the situational diagnosis provided for this study it is possible to understand the factors that influence the emergence of the disease in Iguassu Falls contributing to the development of programs and specific strategies, focusing on raising the population's awareness of safekeeping practices for your animals; free diagnosis for animals (dogs and cats) suspected of sporotrichosis, and treatment with a free supply of medication for patients animals with a confirmed diagnosis of sporotrichosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P464
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P465 Aspergillosis in free-ranging Magellanic penguins

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMAspergillosis is an opportunistic fungal disease caused by the Aspergillus genus, mostly by Aspergillus section Fumigati. Captive Magellanic penguins are vulnerable to Aspergillus infection, being this mycosis a limiting factor during the process of rehabilitation with a mortality rate of around 50%.ObjectivesGiving the scarce data regarding the occurrence of aspergillosis in non-captive penguins, we aimed to evaluate the proportional mortality by aspergillosis in free-ranging Magellanic penguins during their migration and reproductive season.MethodsCarcasses of Magellanic penguins were collected from the Southern coast of Brazil between June 2017 and October 2019 between Barra do Chui beach (Southern RS, Brazil - 33°44'19.9‘S 53°21'56.3’W) and the isthmus with the Lagoa do Peixe (Southern RS, Brazil - 31°26' S, 51°10' W 31°14'S, 50°54'W). In addition, in January 2019, penguins found dead in the reproducing colony in four islands localized in Puerto Deseado City (Santa Cruz, Patagonian, Argentina - 47°45′00″S 65°55′00″W) were collected. All animals were necropsied, and macroscopic alterations were observed. Samples of macroscopic lesions and/or respiratory systems were collected for histopathology and mycological culture. Only proven aspergillosis cases, defined by suggestive lesions at necropsy, associated with hyaline, septate, and 45° branched hyphae in histopathological slides and isolation of Aspergillus sp. in the culture were computed. Fungal isolates were identified by molecular techniques.ResultsA total of 98 Magellanic penguins were included in our study, being 80 recovered on the Southern RS beach, and 18 from the Patagonian colony. Two penguins collected in Southern Brazil were diagnosed with aspergillosis, both juveniles, one showing nodules in the lung parenchyma, and the other nodules and fungal colonies at the lung and air sac, resulting in a proportionate mortality rate of 2.5%. Both isolates were identified as A. fumigatus sensu stricto. Regarding the carcasses collected from the reproductive colony (Patagonian islands), no penguin had anatomopathological or mycological evidence of aspergillosis.ConclusionGiven the already known importance of aspergillosis in seabirds undergoing rehabilitation, these data suggest that penguins may already arrive in these centers infected by Aspergillus spp. The absence of aspergillosis cases in the reproductive period could be attributed to the low number of carcasses included. Our study is an initial step to demonstrate aspergillosis as one of the causes of mortality also in free-living penguins, especially during the migration process, instigating more studies, in other routes of migration, as well as in reproductive colonies.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P465
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S9.4b Trimetallic Cu-Zn-Fe nanoparticles induced apoptosis and cell cycle
           arrest in multidrug-resistant Candida auris S9.4 Free oral presentations
           (late breaking), September 23, 2022, 4:45 PM - 6:15 PM

    • Abstract: AbstractBackgroundCandida species are opportunistic fungus that can cause serious infections, particularly in immunocompromised population. The number of fungal infections has increased steadily with Candida species being responsible for ˃ 70% of these instances, particularly in hospitalized patients with significant underlying conditions. Pharmacological resistance in Candida species and the advent of Candida auris have elevated candidiasis to a major public health concern. Candida auris is an emerging multidrug-resistant fungus that can cause catastrophic bloodstream infections and high fatality rates, particularly in hospitalized patients with major medical issues. Antifungal study of trimetallic nanoparticles (NPs) of various types have been studied as a therapy option for efficient and safe control of candidiasis. These NPs were highlighted for being environmentally friendly and sustainable synthetic preparative possibilities.Objective: This work aimed to synthesize and characterize novel Cu-Zn-Fe trimetallic NPs and determine their in vitro antifungal activity and mechanism of antifungal action against Candida auris isolates.MethodsThe synthesis and characterization of Cu-Zn-Fe trimetallic NPs was done by standard methods. The antifungal capability of these NPs were determined by calculating minimum inhibitory concentrations (MIC) and minimum fungicidal concentrations (MFC) following CLSI recommended guidelines. Susceptibility on planktonic cells and biofilms was further confirmed by MuseTM cell count and viability assay and scanning electron microscopy (SEM) respectively. For insight antifungal mechanisms, apoptosis and cell cycle arrest were studied by exploring different apoptotic markers and MuseTM cell analyzer.ResultsCharacterizations by Fourier-transform infrared spectroscopy (FTIR), diffuse reflectance UV-visible spectroscopy, X-ray diffraction (XRD), scanning electron microscopy (SEM), and transmission electron microscopy (TEM) determine the successful biosynthesis of Cu-Zn-Fe trimetallic NPs. Susceptibility assay confirmed the fungicidal activity of Cu-Zn-Fe NPs with MIC and MFC values of 12.5 and 25 μg/ml respectively. These results were further confirmed by viability assay reporting the cell viability of 45.5%, 13.5%, and 1.8% when C. auris cells were treated with 1/2 MIC, MIC, and 2MIC respectively. Cell cycle analysis revealed that 91.2% of healthy developing untreated control cells were in G0/G1 phase, whereas 5.2% and 3.7% of cells were in the S phase and G2/M phase, respectively. In contrast, NP-treated cells were observed to be arrested in S phase with 49.3% cells at 2MIC. To study the physiology of cell death caused by NPs, we investigated mitochondrial membrane potential (∆ψm), with live cells having stable (∆ψm) whereas treated cells showed loss of (∆ψm). Another important parameter of apoptosis in yeast cells is the release of cytochrome C from the mitochondria to the cytosol and NP-treated cells resulting in decreased mitochondrial cytochrome C and elevated cytosolic cytochrome C levels. Both results confirmed the potential test NPs in causing apoptotic cell death in C. auris.ConclusionThe trimetallic (Cu-Zn-Fe) nanoparticles displayed strong antifungal activity against C. auris, with a potential to arrest the cell cycle at S-phase, which could be linked to the DNA damage. Important yeast apoptotic markers suggested that the test NPs have a potential to cause apotosis in C. auris. All these findings suggest the potential of these trimetallic NPs to be taken to the next level of research in the development of novel antifungal medications.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S9.4b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S9.4c Diverse environmental inputs mediate changes in β-glucan exposure
           at the Candida albicans cell surface thereby influencing tissue
           colonisation during systemic infection

    • Abstract: AbstractS9.4 Free oral presentations (late breaking), September 23, 2022, 4:45 PM - 6:15 PMCandida albicans adaptation to host niches affects the exposure of key pathogen-associated molecular patterns (PAMPs) on its cell surface and, consequently, the detection of C. albicans cells by the immune system. Focusing on β-(1,3)-glucan, we screened for host inputs that influence the exposure of this immune-stimulatory PAMP on the C. albicans cell surface. We used a combination of fluorescent microscopy, flow cytometry, and cytokine assays, and then analyzed certain conditions in more detail using transmission electron microscopy and time-lapse video microscopy of C. albicans-phagocyte interactions. We found that some nutrients, micronutrient limitation, stresses, and antifungal drugs trigger β-glucan masking, whereas other inputs, such as nitrogen sources and quorum sensing molecules, exert limited effects on β-glucan exposure. In particular, host- or bacterial-derived L-lactate, hypoxia, or iron limitation induce β-glucan masking, and this leads to attenuation of phagocytic responses [Nature Micro 2, 16 238; mBio 9, e01318-18; Nature Comms 10, 5315]. Lactate signals through Gpr1 to activate Crz1 in a calcineurin-independent manner, whereas hypoxia signals via mitochondrial ROS, and iron limitation signals through Ftr1 and Sef1. β-glucan masking also depends upon downstream signaling via the cAMP-PKA pathway. We conclude that C. albicans has evolved to exploit a range of specific host-derived signals to modulate the exposure of a major PAMP at its cell surface in an attempt to evade phagocytic uptake. Using barcode-sequencing in direct competition assays in vivo, we showed that preadaptation to specific β-glucan masking signals affects the ability of this fungus to colonize particular tissues during systemic infection in a murine model. This reinforces the view that β-glucan masking promotes C. albicans infection.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S9.4c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S9.4d Main reservoirs of Trichophyton mentagrophytes Type V in Iran

    • Abstract: Abstract S9.4 Skin mycoses and microbiome, September 23, 2022, 4:45 PM - 6:15 PMObjectivesDermatophytosis in livestock receives attention because of its contagiousness, high treatment costs, and lack of control programs. Compared with cattle, mycological aspects of dermatophytosis in sheep and goats have been studied less frequently. Dermatophytosis in these animals (small ruminants) may lead to serious economic losses due to the negative impact on the growth of involved animals, as well as their milk and meat production. Recent studies showed that the old Trichophyton verrucosum var. verrucosum (which is known to have some African and Asiatic sheep as its reservoirs) is currently synonymous with T. mentagrophytes Type V, the most common genotype of T. mentagrophytes isolated from Iranian patients. But the animal reservoirs of this genotype are not well known in Iran and in this investigation, we aimed to determine them.MethodsA total of 678 skin and hair samples from animals including sheep (n = 190), cows (n = 79), goats (n = 9), camels (n = 20), stray and domestic cats (n = 195), stray and pet dogs (n = 146), horses (n = 27), foxes (n = 2), hedgehogs (n = 2), and poultries (n = 8) were subjected to direct microscopy and culture on Mycobiotic agar. Most animals had skin lesions, though some stray cats and dogs were asymptomatic. Molecular identification of dermatophyte cultures was done by ITS-rDNA RFLP. To confirm the RFLP identification, 59 representative isolates from all studied animal species were subjected to ITS-rDNA sequencing. The likelihood for isolation of a specific species or genotype with regard to the type of infected animal was determined using the chi-square test.ResultsWe obtained 334 dermatophyte cultures. ITS-RFLP and ITS region sequencing revealed the species T. verrucosum (n = 62; all from cows), T. mentagrophytes Type V (sheep = 95; goat = 6; cat = 1; horse = 2), T. mentagrophytes Type II* (cat = 2), T. mentagrophytes Type VII (dog = 2), Microsporum canis (cats, n = 94; dogs, n = 55; cow, n = 1; horse, n = 1), T. quinckeanum (fox, n = 1), Nannizzia gypsea (cats, n = 5; dogs, n = 4; cow, n = 1; horse, n = 1), and N. fulva (cow, n = 1). No dermatophytes were isolated from camels, hedgehogs, and poultries. There was a statistically significant difference in the isolation rate of T. mentagrophytes Type V between sampled animals meaning that with a high probability it is isolated from sheep and goats.ConclusionPurposive sampling from suspected animals confirmed that sheep are the main animal reservoir of T. mentagrophytes Type V, at least in Iran. Further international sequence-based investigations can test our conclusion.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S9.4d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S9.4e Molecular epidemiology of Microsporum canis infection in Japan

    • Abstract: Abstract S9.4 Free oral presentations (late breaking), September 23, 2022, 4:45 PM - 6:15 PMObjectivesFrom a series of epidemiological surveys by the Japanese Society for Medical Mycology, it is estimated that the number of Microsporum canis (M. canis) infections in Japan has increased in recent years. The purpose of this study was to observe this trend by multilocus microsatellite (MLMT) analysis, a sensitive molecular marker.MethodsDNA was extracted from 103 strains of M. canis isolated between 2017 and 2022 from Japanese patients and pet animals. Using the DNA, PCR targeting six individual microsatellites was performed. The size of each of these amplicons was measured by capillary electrophoresis, and their genotypes were determined from the combinations of their sizes.ResultsA total of 27 genotypes were detected among the 103 strains. Among the 27, 15 had been reported in studies of strains isolated before 2017, whereas 12 were newly determined in the present study. The genotype most frequently detected in the present study was genotype A, being present in 28 of the 103 strains. By geographical region, genotype A was found in strains distributed over a wide area of Japan. Genotype A strains have been isolated from cats purchased at pet shops and/or owners of these pet animals. The highest incidence of genotype in a study of strains isolated in 2010-2014 was also genotype A. Therefore, a large number of M. canis infections originating from pet shops and animal breeders are likely prevalent in Japan today. Furthermore, a relatively large number of strains were identified as genotypes rare or absent in 2010-2014.Conclusions: The increase in the number of M. canis infections in recent years may be the increase in infections of different genotypes, in addition to the base of constant infections by genotype A, by the present MLMT analysis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S9.4e
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S9.5c Malassezia-host interactions and the Il-23/17 axis

    • Abstract: AbstractS9.5 Malassezia: pathogenesis and disease, September 23, 2022, 4:45 PM - 6:15 PMThe mycobiome of the skin is dominated by a single fungal genus, Malassezia. While Malassezia normally exists as a commensal without inflicting disease, the fungus has also been associated with numerous skin disorders ranging from mild conditions such as dandruff or pityriasis versicolor to severe chronic pathologies such as seborrheic or atopic dermatitis. Maintaining stable colonization and preventing pathogenicity of Malassezia is key for skin homeostasis. Our understanding of the fungal factors and host mechanisms that, through mutual interactions, promote Malassezia commensalism in healthy skin remains incomplete. From studies in humans and mice, we learned that homeostatic immunity against Malassezia is characterized by IL-17-producing T cells, including Th17 and γδT17 cells. Recent endeavors start to unravel the cellular and molecular pathways responsible for driving the protective antifungal response in the skin. While Malassezia-responsive T cells are non-inflammatory and host-beneficial, they can bear pathogenic potential and thereby be involved in the pathogenesis of inflammatory and allergic skin conditions, as preclinical studies suggest. During my lecture, I will report on recent findings from my lab regarding the role and regulation of the IL-23/IL-17 axis in response to Malassezia under normal and diseased skin conditions.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S9.5c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S9.5d Genotyping of Malassezia species from seborrheic dermatitis/dandruff
           patients

    • Abstract: Abstract S9.5 Malassezia: pathogenesis and disease, September 23, 2022, 4:45 PM - 6:15 PMObjectivesSeborrheic dermatitis/dandruff (SD/D) are common chronic inflammatory skin disorders characterized by recurrent greasy scales with erythema and itchiness. Malassezia lobose and M. restricta are the predominant agents associated with SD/D. The aim of the study was to differentiate Malassezia strains causing SD/D from commensal using a highly discriminatory DNA fingerprinting technique, Fluorescent Amplified Fragment Length Polymorphism (FAFLP).MethodsA total of 154 (M. globosa, n = 85; M. restricta, n = 55; M. arunalokei, n = 14; standard strains, n = 3) isolates from SD/D patients and healthy controls were analyzed using FAFLP. DNA sample was digested with restriction enzymes EcoRI and HindIII, and the fragments were linked to prepared adapters. Pre-selective followed by selective amplification reactions were performed using EcoRI-AC [6-carboxyfluorescein (6-FAM) labeled] and HindIII-T selective primers. The similarity coefficient was determined by Pearson correlation with negative similarities clip to zero. The densitometric curve cluster analysis was performed by unweighted pair group method with arithmetic means using Bionumerics software. The similarity co-efficient of 70% was taken as a cut-off.ResultsM. restricta and M. arunalokei isolates had a similarity co-efficient of 20%, whereas it was 50% among M. restricta and 60% among M. arunalokei isolates (Fig. 1). Majority of the isolates (n = 38.69%) clustered to form FAFLP type-I, followed by type-II (n = 14.25%), and type-III (n = 3.6%). All three FAFLP types formed tight clustering among themselves (>80% similarity co-efficient) showing less genetic diversity within each FAFLP type. Type-II clustered strains were isolated from the scalp of SD/D patients (P <.05). M. arunalokei isolates were clustered into two FAFLP types (P = .05). All FAFLP type-I isolates (n = 10,71%) were from the scalp of moderate and severe SD/D patients, whereas all type-II isolates (n = 4,29%) were from nasolabial folds of either SD/D patients or healthy controls. All 11 FAFLP types of M. globosa formed very loose structured cluster showing high genetic diversity in intra and inter-FAFLP types (Fig. 2). Majority of the isolates (n = 63,74%) clustered to form FAFLP type-II, followed by type X (n = 5.6%), type-I (n = 4.5%), type-III (n = 3.3.5%), type-IV (n = 3.3.5%), type-V (n = 2.2%), type-VIII (n = 2.2%), and type-VI, VII, IX, XI (n = 1.1% each). No geographic specific isolate clustering was observed in FAFLP.ConclusionM. restricta type-II and M. arunalokei type-I strains were isolated only from the scalp of moderate to severe forms of SD/D. However, no such severity-specific clustering was observed in M. globosa. The results strongly suggest the role of certain genotypes of M. restricta and M. arunalokei in the causation of SD/D.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S9.5d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P079 Virulence factors and azole-resistant mechanism of Candida tropicalis
           isolated from candidemia

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMBackgroundLimited knowledge exists on the virulence factors of Candida tropicalis and the mechanisms of azole resistance that lead to an intensified pathogenicity and treatment failure. We aimed to evaluate the virulence factors and molecular mechanisms of azole resistance among C. tropicalis isolated from patients with candidemia.Materials and MethodsSeveral virulence factors, including extracellular enzymatic activities, cell surface hydrophobicity (CSH), and biofilm formation were evaluated. Antifungal susceptibility pattern and expression level of ERG11, UPC2, MDR1, and CDR1 genes of 8 (4 fluconazole resistance and 4 fluconazole susceptible) clinical C. tropicalis isolates were assessed. The correlation between the virulence factors and antifungal susceptibility patterns was analyzed.ResultsDuring a 4-year study, 45 C. tropicalis isolates were recovered from candidemia patients. The isolates expressed different frequencies of virulence determinants as follows: coagulase 4 (8.9%), phospholipase 5 (11.1%), proteinase 31 (68.9%), esterase 43 (95.6%), hemolysin 44 (97.8%), biofilm formation 45 (100%), and CSH 45(100%). All the isolates were susceptible to amphotericin B and showed the highest resistance to voriconazole. There was a significant positive correlation between micafungin minimum inhibitory concentrations (MICs) and hemolysin production (rs = 0.316). However, we found a negative correlation between fluconazole MICs and esterase production (rs = −0.383). We observed the high expression of ERG11 and UPC2 genes in fluconazole-resistant C. tropicalis isolates.ConclusionCandida tropicalis isolated from candidemia patients extensively displayed capacities for biofilm formation, hemolysis, esterase activity, and hydrophobicity. In addition, the overexpression of ERG11 and UPC2 genes was considered one of the possible mechanisms of azole resistance.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P079
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P113 Expression profile of ABC and MFS multi-drug transporter genes in
           terbinafine- and fluconazole-resistant Trichophyton spp.

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesOver the past few decades, an unprecedented increase in recalcitrant and chronic dermatophytosis with atypical clinical presentations have been noted in the Indian subcontinent. Recent studies have reported Trichophyton mentagrophytes/interdigitale complex as predominant etiological agent of chronic/recurrent dermatophytosis followed by T. rubrum. Multiple factors, including unregulated use of antifungal drugs, poor compliance to treatment, and irrational fixed-drug combinations are associated with emerging resistance. However, molecular studies investigating the underlying mechanisms related to terbinafine and fluconazole resistance in dermatophytes are sparse.The present study was designed to explore the role of multidrug efflux transporters in terbinafine- and fluconazole-resistant T. mentagrophytes/interdigitale complex and T. rubrum.MethodsThe expression of MDR transporter genes was evaluated in 36 isolates with terbinafine resistance (with or without F397L or L393F mutation in squalene epoxidase gene, SE) of T. mentagrophytes/interdigitale complex (n = 26), and T. rubrum (n = 10) isolates along with 16 susceptible wild-type isolates of T. mentagrophytes/interdigitale complex (n = 10), and T. rubrum (n = 6) isolates. In addition, 19 fluconazole-resistant T. mentagrophytes/interdigitale complex (n = 11), and T. rubrum (n = 8) isolates along with 13 susceptible T. mentagrophytes/interdigitale complex (n = 9), and T. rubrum (n = 4) were also included. Quantitative real-time PCR (qRT-PCR) was used to evaluate the expression of ABC transporter (MDR1, MDR2, MDR3, MDR4, and MDR5) and MFS transporter genes (MFS1 and MFS2).ResultsIn terbinafine-resistant T. mentagrophytes/interdigitale complex, the mean expression of MDR1 and MDR2 was 4.98 and 5.27-fold in isolates with wild-type SE, compared with 0.64 and 1.04-fold in isolates with non-wildtype SE gene (P <.0001) and susceptible isolates at 0.4, and 0.88-fold (P <.0001), respectively. For MFS1 gene, 3.4-fold-change expression was noted in isolates with wild-type SE compared with 1.51-fold in isolates with non-wild type SE (P <.001). In resistant isolates with non-WT SE, the upregulation of the SE gene was noted at 6.3-fold compared with 1.8-fold in isolates with wild-type SE (P <.001), and 0.63-fold in susceptible isolates (P <.0001). However, there was no significant upregulation of MDR3, MDR4, MDR5, and MFS2 genes among the three groups. In terbinafine-resistant T. rubrum, the mean inducible expression of MDR1 was significantly higher in isolates with wild-type SE at 3.88-fold compared to isolates with non-wild type SE at 0.5-fold (P <.05) and susceptible isolates at 0.33-fold (P <.01). Only resistant isolates with wild-type SE showed significant up-regulation of MDR2 (P <.01) compared to susceptible isolates. Other genes, MDR3, MDR4, MDR5, MFS1, MFS2, and SE, did not show substantial overexpression among the groups (Resistant WT vs. Resistant NWT vs. susceptible WT). In fluconazole-resistant and -susceptible isolates of T. mentagrophytes/interdigitale complex, and T. rubrum, similar findings were observed. In both the species, the mean inducible expression of MDR1, MDR2, and MDR3 was significantly higher (P <.05) in resistant isolates compared to susceptible isolates.ConclusionIn conclusion, this study demonstrates the overexpression of MDR1 and MDR2 in terbinafine-resistant Trichophyton spp. isolates lacking drug-target gene mutation, suggesting the role of multidrug transporters in resistance. This study also suggests the importance of MDR2, and MDR3 transporter genes in imparting fluconazole resistance in Trichophyton spp.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P113
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P114 Clinical and microbiological spectrum of dermatophytosis from a
           tertiary care institute

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThere is an increasing incidence of recalcitrant dermatophytosis in India due to irrational use of antifungals, inappropriate treatment, and also in vitro resistance of the organism by itself. This study is done to determine the clinic-mycological profile, antifungal susceptibility, and outcome of patients with dermatophytosis in our institute.MethodsAll patients with culture-proven dermatophytosis attending the outpatient department of our hospital from January 2019 to December 2019 were included in the study. Detailed clinical data of all the patients were collected.Morphological Identification of the dermatophytes was done by conventional mycological methods. The isolates were sent to PGIMER Chandigarh for further identification by MALDI-TOF and antifungal susceptibility testing. Antifungal susceptibility testing was done for 47 isolates of Trichophyton species.ResultsOf the 155 clinical suspected cases, growth of dermatophytes was observed in 55 (35.4%) of the cases. Tinea corporis 39/55(70.9%) was the predominant clinical type The duration of infection was less than 6 months in 22/55(40%) of cases and >6 months in 33(60%) of the cases. Majority of the patients were in the age group of 20-30 years and were male. A total of 36/55 (65.4%) of the patients belong to middle socio-economic status and 19/55 to lower socioeconomic status (34.5%). In all, 10/55(19.2%) of the patients were students and 10/55 (19.2%) housewives; others include auto drivers, mechanics, teachers, cashiers, etc. All except 4 patients were from urban areas. Comorbid conditions noted were diabetes mellitus in 7/55 (12.7%), hypertension in 6/55 (10.9%), systemic steroid usage in 3/55 (5.4%), post-renal transplant status in 1/55 (1.8%), and SLE in 1/55 (1.8%). Sharing of personal use items was found in 12/55 (21.8%) of the patients and 9/55 (16.3%) of patients complained of excessive sweating.Previous therapy with topical and systemic antifungals was given in 32/55 (58.8%) of the patients, other modes of treatment like homeopathy, and ayurveda in 4/55 (7.2%). Topical steroids were given to 4 patients and 19/55 (34.5%) of the patients were not treated for the infection.Trichophyton mentagrophytes complex (69%) was the predominant species complex isolated followed by T. rubrum, M. gypseum, M.canis, and T. tonsurans.Of the 47 Trichophyton isolates subjected to AFST, all the isolates showed MIC >1ug/ml for fluconazole and griseofulvin. Majority of the isolates showed MIC of <1 ug/ml for other antifungals; high MICs (MIC >1) were exhibited by 5 isolates for terbinafine and naftifine, 2 isolates for sertoconazole, and 1 isolate for voriconazole. Molecular detection of terbinafine resistance done in 15/55 isolates showed mutation in the squalene epoxidase (SE) gene leading to F397L substitutions in 2 isolates. In the present study, the patients were treated with both oral and topical antifungalsOf the 55 cases, complete cure was observed in 21 (38%), partial cure in 9 (16.3%), and relapse in 5 (9%) on 2 years follow-up. However, 20/55 (36.3%) of the cases were lost to follow-up.ConclusionTrichophyton mentagrophytes complex was the predominant species isolated and Tinea corporis was the commonest clinical presentation. Resistance to terbinafine, griseofulvin, and fluconazole has been noted. Dermatophytosis has become a difficult to treat disease due to antifungal resistance, and chronicity/recurrence of the lesions. Early diagnosis followed by rational antifungal therapy are essential for improved outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P114
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P115 Reversed-phase high-performance liquid chromatography as rapid and
           simple method for quantifications of terbinafine drug in human serum from
           dermatophytosis cases

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThe alarming situation of treatment failure cases in dermatophytosis and resistance to the first-line drug (terbinafine) is a worrisome condition for the management of tinea cases. However, studies also reported non-responders to terbinafine treatment even when the isolates are susceptible to this drug in vitro. Thus, evaluating the pharmacokinetic profile of terbinafine might help better manage dermatophytosis. This study was conducted to standardize and validate a rapid and simple reversed-phase high-performance liquid chromatography (HPLC)-based protocol for terbinafine in serum/plasma of dermatophytosis cases.MethodsHPLC analysis was standardized for terbinafine drug on an Agilent 1290 infinity system (Agilent Technologies InC., USA). Chromatographic parameters including mobile phase [acetonitrile (A), methanol (M), and water (W)], flow rate (0.7-1.5 ml/min), injection volume (20 μl), and various wavelengths ranging from 220 to 265 nm under isocratic conditions were assessed and optimized. The mobile phase consisted of a filtered and degassed mix of A: W and M: W with various ratios of 85:15, 60:40, 50:50, and M-100%, respectively. Quality control samples were prepared in drug-free serum by spiking with the terbinafine at 0.0312-100 μg/mL concentrations. An equal volume of serum and acetonitrile (A) were mixed. The mixture was vigorously vortexed for 30 s, followed by high-speed centrifugation at 13 000 rpm at 40°C for 10 min. The supernatant was transferred into the chromatographic vials and placed in the autosampler of HPLC for injection. The standardized method was tested in 6 dermatophytosis patients’ serum/plasma samples collected at 3-time points (first, second, and third week of start of antifungal).ResultsLinearity of calibration standard for terbinafine was optimized at 250C at a flow rate of 1.0 ml/min, injection volume 20 μl, 8 minutes run time with the standardized wavelength at 245 nm under isocratic conditions. The best suitable graph was determined by plotting the area under the curve (AUC) and peak height separately against the drug concentrations measured by reversed-phase- HPLC for terbinafine drugs (Fig. 1a and b). The standardized mobile phase consisted of filtered and degassed Methanol (100, v/v). The chromatographic separation was achieved on an Agilent C18 column, and 4.3 ± 1 time represents the peak for terbinafine drug. Based on the standardized protocol, six tinea cases were included for validation, and the therapeutic range achieved for terbinafine in clinical samples was 0.6 to 1.13 μg/ml.ConclusionsThe standardization of HPLC method was successfully applied to quantify terbinafine in spiked samples with terbinafine drug and showed no observable interferences at the standardized parameter. Further evaluation with larger number of samples is warranted.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P115
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P116 Cutaneous fungal infections in elderly population from Bhopal

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTo know the distribution of fungal infections based on various demographic characteristics.To study the clinical presentation of the lesions and their distribution.To isolate and identify the fungal pathogens.MethodsHospital-based cross-sectional study for 5-year duration January 2017-December 2021. Study location is the department of Microbiology AIIMS, Bhopal. Elderly patients (60 years and above) visiting as Outpatient and Inpatient of dermatology and venereology, General Medicine, and other departments with cutaneous infections suspected to be of fungal etiology and fulfilling the inclusion criteria comprised the study population. Patients already on antifungals topical or systemic were excluded. Data extraction was based on predesigned proforma for a detailed history and clinical examination entries. Necessary ethical approval and patient consent were obtained. Samples of skin, hair, nail, and exudates were processed for direct microscopy, culture isolation in suitable media, and identification phenotypically.ResultsA total of 480 elderly patients clinically suspected of cutaneous fungal infections were included in the study. Majority of the suspected cases were in 60–70 years age group 360/480 (75%). Males were 349/480 (72.71%) and females were 131/480 (27.29%) of the total suspected cases. Male to female ratio in study population was 2.66: 1. Tinea corporis 140/480 cases (29.17%) was most common clinical type followed by onychomycosis 64/480 cases (13.33%), ulcerations 62/480 (12.92%), T. cruris 56/480 (11.67%), T. pedis 35/480 (7.29%), T. mannum 25/480 (5.21%), and T. facei 12/480 (2.50%) in suspected cases of cutaneous fungal infection. Majority of cases were found in non-dependent 253/480 (52.70%) population. Out of 480 clinically suspected cases of cutaneous fungal infection was demonstrated in 193 cases (40.20%) either by direct microscopy and/or culture.A total of 176/480 cases (36.67%) were KOH positive and 113(23.54%) cases were culture positive.Taking culture as a gold standard sensitivity and specificity of KOH in diagnosing fungal infection was 84.96% and 78.2% respectively. Among 113 culture isolates dermatophytes 53.10% (60/113) were most common mold isolates followed by non-dermatophyte molds 28.3% (32/113), and yeasts 18.59% (21/113). Trichophyton mentagrophytes most common 21.24% followed by T. tonsurans 9.73%, and T. violaceum 7.96% are the common dermatophyte isolates. Aspergillus species is the most common non-dermatophyte mold isolated.Diabetes was the most common comorbid condition in culture-confirmed cases followed by hypertension and thyroid disorder.ConclusionThis study showed the prevalence of cutaneous fungal infection among elderly visiting AIIMS, Bhopal as 23.54% (113/480). With increase in elderly population, changing environmental conditions, and association with non-communicable diseases it becomes important that all elderly patients visiting hospital OPD and those hospitalized for long should be evaluated for fungal infections especially cutaneous.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P116
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P143 Incidence of chronic pulmonary aspergillosis in a cohort of
           bacteriologically confirmed TB patients at a tertiary hospital in Ghana

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesChronic pulmonary aspergillosis (CPA) is a common complication of tuberculosis. Previous studies on CPA in TB had involved general TB patients with a majority not bacteriologically proven. Although, ruling out evidence of TB is critical in diagnostic algorithms for CPA, in rare cases, CPA may occur in patients with active TB. This prospective longitudinal study aimed to determine the incidence of CPA at three timepoints in a cohort of bacteriologically confirmed TB patients placed on anti-TB therapy in Ghana.MethodsConsecutive patients in whom MTB was detected by molecular analysis (GeneXpert MTB) and subsequently placed on anti-TB treatment were enrolled. They were screened for CPA at baseline or the time of TB diagnosis (0-1 week), end of treatment (6-7 months), and post-treatment (12-13 months). Screening involved assessment of signs and symptoms, quality of life (QoL) using St. George's Respiratory Questionnaire, imaging investigations (chest radiograph and/or CT scan), and mycology testing (LDBio Aspergillus IgG & IgM ICT and culture). CPA cases were defined based on a diagnostic algorithm developed for resource-constrained settings. During follow-up timepoints, CT scan was done when Aspergillus serology changed from negative to positive. GeneXpert MTB or acid-fast bacillus (AFB) smear results were obtained from laboratory records during follow-up timepoints.ResultsA total of 46 patients were enrolled at baseline, of whom 34 (74%) were resurveyed at the end of treatment. Only 13 patients have been screened post-treatment so far. There were 6 (13%) relapse cases. At baseline, Aspergillus serology was positive in 4 (8.7%) patients and later increased to 6 (17.6%) and now 3 (23.1%) at the end and post-treatment respectively. Specifically, 4 (8.7%), 2 (6.9%), and 1 (10.0%) patient(s) met the criteria for CPA at baseline, end of treatment, and post-treatment respectively. All four cases of CPA described at baseline occurred in relapse patients. Among these patients, the initial MTB load determined by GeneXpert MTB was either trace or very low and follow-up AFB smear and/or GeneXpert MTB were negative between 2 to 3 months. Among relapse patients, average years since the primary episode of TB was four in those with CPA versus nine in those without CPA. Persistent cough and hemoptysis were the common symptoms of CPA. All CPA patients had cavitation, irregular intraluminal lining of cavity, and all but one had pleural thickening and/or paracavitary fibrosis. Two CPA patients at baseline have been rescreened post-treatment, one still has features of CPA and one had died. Also, the two CPA patients at the end of treatment continue to have CPA features when rescreened. Quality of life score improved significantly at the end of treatment for TB without CPA (51.4-3.8) while for those with putative CPA co-infection the improvement was less (53.8-25.7).ConclusionCPA should be considered in patients with suspected TB relapse, a very low or trace GeneXpert MTB, and positive Aspergillus serology. These patients had a less satisfactory symptom improvement after TB treatment. Aspergillus serology testing at the beginning of TB relapse therapy may provide prognostic information.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P143
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P144 The uncommon meets the common: Invasive Aspergillosis and
           tuberculosis co-infection in non-neutropenic patients— arare association
           

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackground and ObjectiveInvasive aspergillosis (IA) is known to occur in immunocompromised patients including neutropenic patients. But, recently increasing cases have been reported in patients with non-classical risk factors and non-neutropenic patients like diabetes mellitus, chronic lung disease, HIV infection, critically ill patients, etc. According to ISHAM these non-classical risk factors should be included in EORTC/MSG host criteria for diagnosis of invasive aspergillosis.India has a high tuberculosis (TB) burden, and this is always considered as the first differential for any patient with fever, cough, hemoptysis, and weight loss. Post-tubercular chronic pulmonary aspergillosis common reported condition. However, co-infection of active TB and invasive aspergillosis is less reported. This co-infection could be one of the contributors of high morbidity and mortality in cases with tuberculosis.We hereby present a series of five cases of TB concomitant with invasive aspergillosis in non-neutropenic patients.MethodsThis is a prospective observational study, all patients admitted with molecular diagnosis (GeneXpert) of tuberculosis and with at least one non-classical risk factor for invasive aspergillosis were subjected to further evaluation. Diagnosis of invasive aspergillosis was considered in patients who had at least one clinical and one mycological EORTC criteria. Galactomannan level in different samples was measured via PlateliaTM ELISA. The efficacy of different antifungals and outcomes were analyzed.ResultsTotal 57 patients with TB underwent for evaluation of invasive aspergillosis. Among them, five patients were diagnosed to have concomitant TB and invasive aspergillosis, of which three cases of CNS TB and CNS aspergillosis and two had concomitant pulmonary infections. The average age was 31 ± 12 years with a female preponderance (4/5). Two patients were HIV positive, while among non-HIV patients, one had CD4 cytopenia (CD4-171). One patient had no known predisposing factor. Radiologically, most common pulmonary lesions were patchy consolidation with centrilobular nodules with tree in bud appearance, while CNS lesions showed multiple ring-enhancing lesions. All the patients had CBNAAT positive, two from BAL sample, 1 from CSF, and 1 from the lymph node. Rifampicin was sensitive in all, except one who had rifampicin resistance indeterminate. Of these patients, four were probable invasive aspergillosis satisfying the host, mycological and clinical factors as per the EORTC/MSGERC 2021 guidelines. The treatment of coinfection is challenging due to the interaction of rifampicin with voriconazole, which is the drug of choice for invasive aspergillosis. Here, 3 patients were treated with Inj amphotericin B, while the other 2 patients were started on voriconazole with rifampicin sparing regimen for TB. Of the 5 patients, 4 patients survived with excellent response to the treatment, with one fatality.ConclusionThe possibility of concurrent TB and invasive aspergillosis in non-neutropenic hosts should be considered to avoid devastating outcomes. The lack of clinical suspicion may result in misdiagnosis, and most importantly, the chronicity of the infection makes it indistinguishable from TB. Moreover, the co-administration of antifungal and anti-TB medications presents significant therapeutic challenges necessitating thorough evaluation and monitoring.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P144
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P145 Co-infections due to Aspergillus and Mucorales: Case series from a
           superspecialty medical center in India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo present details of a case series of fungal co-infection (aspergillosis and mucormycosis) including clinical course, laboratory diagnosis, treatment, and outcome.MethodsClinical histories of 7 cases of fungal co-infection (3 pulmonary, 4 rhino-orbito-cerebral or sino-nasal) were collected by chart review, and reports of samples sent to the mycology laboratory for direct microscopy and fungal culture were retrieved from laboratory records. Presence of septate and aseptate hyphae in direct microscopy of clinical samples and/or growth of Aspergillus spp and Mucorales in culture was considered as evidence of probable co-infection with mucormycosis and aspergillosis (as per EORTC guidelines).ResultsMechanical ventilation, cavitary lung disease, and renal failure with metabolic acidosis were unique risk factors observed for pulmonary co-infection, while use of systemic corticosteroids for treatment of SARS-CoV-2 infection was common in rhino-orbito-cerebral (ROC) or sino-nasal (SN) co-infection. Diabetes mellitus was a common risk factor for both groups of cases.Fever, cough, chest pain, and shortness of breath were the most common features in pulmonary fungal co-infection cases, while headache, facial swelling and pain, nasal stuffiness, decreased vision, and altered sensorium were the most common features in ROC/SN co-infection.Consolidation or collapse, bronciectasis, cavitatory changes in and nodules were the most frequent radiological features in pulmonary fungal co-infection cases, while mucosal thickening in multiple paranasal sinuses, and involvement of orbit and cavernous sinuses were the most frequent features in ROC or SN co-infection.Presence of aseptate and septate hyphae in direct microscopy was seen in tissue samples from all ROC/SN cases, which enabled early intervention. However direct microscopy was not indicative of co-infection in any of sputum samples from pulmonary cases, and diagnosis was only established by culture, leading to delayed initiation of treatment or no treatment. Liposomal amphotericin B (lAMB) ranging from 50-200 mg/day was used for treatment of fungal co-infection, with posaconazole 600-800 mg/day as step-down therapy or if lAMB was not tolerated.Out of three pulmonary fungal co-infection cases, only one received appropriate antifungal treatment but expired nonetheless. Out of the two untreated patients, one expired, and one was discharged against medical advice without resolution of symptoms. Surgical intervention was not done for any patient. In comparison, 3 out of 4 cases of ROC/SN co-infection were appropriately managed with immediate surgical debridement and survived. The remaining patient received appropriate antifungals but refused surgical intervention and expired.ConclusionsFungal co-infection with aspergillosis and mucormycosis is a serious condition requiring early intervention. This is facilitated by high sensitivity of direct microscopy in tissue samples used for diagnosis in ROC/SN co-infection, but hindered by low sensitivity of direct microscopy in sputum/BAL samples used for diagnosis in pulmonary cases rather than lung biopsy. Robust clinical advisory services, early diagnosis, and combined surgical and pharmacological approaches are crucial to a favorable outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P145
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P146 Penicillium-like mo ld: caught red-handed, but remained unidentified

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveThis case highlights the presence of a self-limited respiratory mycosis in an immunocompetent host and need for fungal sequencing in diagnosis of such rare cases.Methods and ResultsMs X, a 25-year-old, apparently healthy software engineer, had an overnight journey in an air-conditioned bus from Hyderabad to Pune. The next day, she developed throat irritation followed 3 days later by fever and cough without dyspnea nor wheezing. Her chest X-ray was found to be normal at the time. Three days later she was admitted to our hospital, wherein X-ray chest and CT chest showed bilateral randomly scattered nodular shadows (Fig. 1). She was referred to ID as a case of suspected tuberculosis, but her presenting symptom being sore throat, the acuteness of symptoms, presence of nodular lung shadows which were absent on the X-ray chest done just 3 days earlier were against the diagnosis of TB. Inhalational fungal or viral pneumonitis were hence considered.Transbronchial biopsy showed an intense alveolar inflammatory exudate, but GMS staining did not reveal any fungal hyphae. BAL Galactomannan, Xpert MTB/RIF were negative. Both BAL and CT guided lung nodule biopsy samples grew a mold. Red pigment formation in culture and its morphological appearance on LPCB mount (Fig. 2) led to a diagnosis of Penicillium species infection. MALDI TOF MS, which had only a few Penicillium spp in its 2018 database, failed to identify the organism, leading us to believe that it could be a different Penicillium species.Since the patient was showing clinical improvement, a self-limited infection was thought of and therapy was withheld with cautious follow-up. The patient was completely asymptomatic after 10 days and CT chest done 20 days later showed complete resolution of the nodules.We believe that this illness was due to inhalation of spores from the air-conditioning vent, eliciting a brisk inflammatory response in the alveoli. The organism grew from BAL and CT guided biopsy from viable spores, but it failed to germinate into hyphae in the human host and hence was not seen on histopathology and did not produce galactomannan which is only released from the tips of growing hyphae.ConclusionFungi are often isolated from poorly maintained air conditioning vents. In this case, the Penicillium like organism failed to produce progressive disease in the immunocompetent host. If the same organism could be cultured from the AC vent, showed genetic relatedness with the clinical isolate; the source, transmission, and disease linkage could have been established in this case.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P146
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P178 An unusual recurrent case of Cryptococcal sacroilitis in an
           immunocompetent elderly female in Rajasthan, India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackgroundCryptococcus lives in the environment all over the globe. Although it spreads via inhalation route still most of the exposed individuals never get sick as the majority of cases are seen in immunocompromised. Objective of this clinical case report is to highlight the rare fungal etiology associated with iliac bone abscess to avoid incorrect diagnosis and prompt management of case.Case PresentationA 70-year-old elderly female presented with hip pain for a month duration, not relieved with analgesics in September, 2021. In MRI a well-defined irregularly marginated hyperintense focal lesion was found in left iliac bone with joint effusion suggestive of infective etiology, tubercular, or less likely metastasis.CT-guided biopsy reported occasional hyphae-like fragments giving an impression of acute on chronic osteomyelitis with suspicion of fungal infection. Culture reported Cryptococcus neoformans. Fungal markers and Beta-d glucan were indeterminate and Galactomannan was found negative for the sample. Extrapulmonary TB was ruled out by AFB staining, MGIT Culture, and GeneXpert MTB. Bone scan, tumor markers, and PET scan ruled out osteolytic lesion secondary to metastasis. Though PET Scan and HRCT thorax confirm pulmonary involvement giving a picture of bilateral interstitial lung disease along with multiple enlarged lymph nodes.Patient serum was found negative for HIV, HBV, and HCV. Liver and renal function tests were within normal range and in hematology, ESR was raised (50; normal range:0-20). Patient is hypertensive with HbA1c of 5.3. There was no history of travel, avian exposure, weight loss, and COVID-19 infection. Patient was started on voriconazole and considering generalized lymphadenopathy, a therapeutic trial of anti-tubercular therapy was started which was stopped within a week on patient non-compliance. Abscess resolved with voriconazole and patient was discharged.In February 2022, Patient presented with similar complaints. CT scan of this fluctuant nodule depicted hypoechoic lesion which was ultrasound-guided drained. Sections show many rounds of oval fungal organism which were found PAS positive with mucicarmine and alcian blue positive capsule. Budding yeast cells were seen on KOH mount and India ink preparation demonstrated capsule which was confirmed by Cryptococcal Antigen test giving an overall impression in favor of Cryptococcosis. Patient was started on oral fluconazole and Injection liposomal amphotericin B 250 mg for 14 days.Discussion and ConclusionThis is the first case of skeletal Cryptococcosis at our institution which was managed by antifungals without surgical debridement resulting in resolution of abscess. Isolated focal iliac bone cryptococcosis is unusual but may occur in immunocompetent with everyday exposure to the organism. Herein, Patient had bilateral lung involvement along with multiple lymphadenopathies with no evidence of TB bacilli which inferences that the isolate most likely originated from environmental bird droppings and has disseminated from pulmonary lesion to the iliac bone. The radiological findings of iliac cryptococcosis abscess were nonspecific. A definitive diagnosis was made on histopathological and fungal examinations of ultrasound-guided drained abscess. Patient will be followed in the near future for relapse or any other medical issues related to the case.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P178
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P180 Is gene sequencing only way forward'

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionFungal peritonitis (FP) associated with peritoneal dialysis (PD) is an uncommon complication. Candida peritonitis accounts for 70%-90%. A total of 55 cases of Aspergillus peritonitis have been reported from 1968 to 2019 with A. fumigatus and A. niger as the most common isolates.FP is associated with high mortality and often results in discontinuation of PD and switching to hemodialysis (HD).ObjectivesTo identify and report the pathogen from peritoneal abscess.Methods and ResultsA 54-year-old post-menopausal lady, a known diabetic, hypertensive with chronic kidney disease (CKD) on PD for 2 years presents with acute onset breathlessness. She was dialyzed and improved. During her hospital stay, she developed a fever which was managed with intravenous antibiotics, piperacillin-tazobactam, teicoplanin, and fluconazole. The PD was bacterial culture negative. Patient improved on HD and was discharged.A total of 10 days later she was readmitted due to complaints of fever. Her PD fluid analysis was clear with high leucocyte count. The same was sent for the presence of acid-fast bacilli and aerobic bacterial culture, both of which were negative. Her blood was sent for automatic aerobic bacterial culture which yielded no growth. Patient developed pain in abdomen and PD catheter was removed. Abdominal Computed Tomography (CT) imaging revealed a thick-walled intra-peritoneal collection in the left subdiaphragmatic region. In view of persistent fever, antibiotics were changed to meropenem, metronidazole, and amikacin. Pus aspirated was received for aerobic bacterial culture and fungal culture. KOH—Calcofluor examination revealed septate fungal hyphae. Bacterial culture yielded Enterococcus species sensitive to penicillin and gentamicin. Patient was treated with amphotericin B and HD. Repeat aspirate also revealed septate fungal hyphae. However, on both occasions fungal cultures were negative. She improved symptomatically and was discharged.Sample was sent to Post Graduate Institute of Medical Education and Research, Chandigarh for the identification of the fungal pathogen directly from the sample using Gene sequencing. The pathogen was identified as A. niger.ConclusionAspergillus peritonitis in a PD patient though rare is associated with high mortality and morbidity. They are often associated with concurrent or prior bacterial peritonitis. Treatment with antibiotics often predisposes to fungal peritonitis. Clinical presentation is similar to bacterial peritonitis, a high index of suspicion is warranted to establish the diagnosis. Identification of fungal pathogen to rule out species inherently resistant to certain classes of antifungals is critical for successful management. This is possible only by molecular methods, especially in culture-negative cases. In this case of culture-negative invasive fungal infection, the preliminary diagnosis was based on microscopic evidence of two consecutive samples. Gene sequencing helped us to confirm the diagnosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P180
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P181 Mucor in the land of the liver: a case report

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroduction and ObjectivesMucormycosis is a rare, highly lethal opportunistic fungal infection affecting immune-compromised patients. It accounts for about 2% of invasive fungal infections occurring within 1 year after solid organ transplantation. Among renal recipients, Rhinocerebral is the commonest manifestation and Rhizopus species is the most frequent pathogen.The objectives are:To report a case of Hepatic mucormycosis in a renal transplant recipient.To resolve the dilemma in identification of Mucorale species detected on microscopy but culture negative.MethodA 29-year-old male patient was admitted with severe abdominal pain on day 28 post-live related renal transplantation. Patient was hypertensive, on oral steroids for idiopathic thrombocytopenic purpura, chronic kidney disease with venous thromboembolism-presumed chronic interstitial nephritis, and maintained on hemodialysis for the last 1 year. Post-transplant he was on triple immunosuppressants.Initial ultrasound of abdomen and transplant doppler were normal. CT of abdomen in view of worsening hypotension and non-resolving abdominal pain, revealed hepatomegaly with multiple discrete, coalescing hypodense areas in both lobes of liver with minimal subcapsular extension. Initial cultures included interventional radiology-guided liver aspirate and blood culture. Patient was started on antibiotics and antifungals. Patient continued to deteriorate and a repeat abdominal CT revealed an increase in liver size and rupture of liver abscess. Sample collected on pigtail catheter insertion was also sent for culture.ResultsThe pus aspirate was received for bacterial and fungal culture. Aerobic bacterial culture yielded Klebsiella species. Examination with KOH Calcofluor revealed broad aseptate fungal hyphae. However, fungal culture did not yield any growth. Pain resistant (PDR) Klebsiella species was isolated from blood culture. Pigtail catheter sample also yielded the same. Aseptate fungal hyphae were observed in the pigtail catheter sample also. The team decided on conservative management and patient was started on intravenous amphotericin B deoxycholate(50 mg/day), tigecycline, and meropenem. Immunosuppressants were withheld. The clinical course worsened and the patient succumbed to illness after 18 days of antifungal therapy. The pus sample was then sent to the referral center PGIMER for PCR and sequencing where it was identified as Lichtheimia species.ConclusionMucormycosis is an increasingly emerging invasive fungal infection especially in immune-compromised patients, including solid organ transplant recipients. Though uncommon it is frequently a fatal mycosis in transplant patients. Hepatic mucormycosis in renal transplant recipients has been reported in three patients so far. None are due to Lichtheimia species. The diagnosis of hepatic mucormycosis was confirmed as microscopy was positive in two successive samples. Our patient also had bacteremia with PDR Klebsiella.Diagnosis is challenging and often delayed, as the clinical presentation is non-specific. Although mucormycosis in a renal transplant recipient is rare, a high index of suspicion and critical microscopic examination is warranted for early initiation of specific therapy which includes liposomal amphotericin B and surgery. Often cultures yield no growth and gene sequencing proves to be efficient and time-saving. This probably is the way ahead, especially for culture-negative samples to establish the etiological diagnosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P181
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P182 Mucormycosis in Northwest Iranian cases with a history of delta
           COVID-19, a brief report

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesMucoral fungi are the opportunistic organisms causing invasive or localized infections in persons with conditions such as diabetes mellitus, immune suppression, and corticosteroid therapy. During the recent surge of delta-type Coronavirus disease 2019 (COVID-19) in Iran, the rate of invasive mucormycosis considerably increased as a cluster in society. COVID-19-associated mucormycosis (CAM) immerged as a severe and life-threatening infection. The present report includes demographic, clinical and laboratory diagnostic information about newly emerged CAM in Northwest of Iran.MethodsDuring three months, from August to October 2021, about 65 cases with clinical manifests suspected of mucormycosis and a history of recent severe COVID-19 and corticosteroid therapy with dexamethasone were studied. Clinical specimens obtained from sinuses and upper respiratory tract, transported to Clinical Mycology Center, UMS University, Urmia, Iran for the detection of and molecular identifications of mucoral and other agents. Our subjects were the clinical specimens including 31 nasal biopsies, 24 paranasal sinus biopsies, 2 facial and palate biopsies, skin and sutures, one each. Also, two samples of bronco-alveolar lavage were used for investigating fungi in the respiratory tract.ResultsMore than 52% of the patients were men and the most frequent age range was 50-60 years. Most frequent clinical specimens were sent from ENT wards and ICUs, 22 (33.8%) and 12 (18.5%) respectively. Among all confirmed cases of CAM, 18 (27.7%) suffered from a background of diabetes but 46 (70.8%) had no underlying diseases. Our findings of direct examination showed 55 (84.6%) mucoral elements. The suspected cases of CAM showed clinical manifests including acute sinusitis, rhino-sino-cerebral 25 (38.5%), rhino-sino-orbital 7 (10.8%), and sino-facial 3 (4.6%), involvements. The culture and identification resulted in Rhizopus oryzae as the most frequent isolate (44.6%) and Candida yeasts (albicans and non-albicans Candida species) 6.2%-7.7% respectively. Aspergillus species were detected 5 (7.7%) as well. A considerable number of cultures, 20 (30.8%) could result no growth for any fungi.ConclusionAs a conclusion, delta-type Coronavirus causing a considerable increased invasive Mucormycosis in the recorded COVID-19 cases in the north west of Iran. Although, opportunistic candida and aspergillus were identified in lower frequencies as well.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P182
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P183 Monitoring of candida colonization in the respiratory tract of
           COVID-19 cases

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesOpportunistic yeasts potentially cause infection or colonization in the lower respiratory tract. Candida albicans is a common agent of yeast infections but other yeasts such as non-albicans Candida are important as resistant fungi to antifungal drugs. The predisposing factors for the overgrowth and invasion by Candida species include corticosteroid therapies, long-time hospitalization, antibiotic therapies, and primary infections by Mycobacterium tuberculosis and viral agents. The screening of Candida colonization in the lower respiratory tract of the cases with a history of COVID-19 was performed in this study at a great training hospital in Northwest of Iran.MethodsDuring the pandemic COVID-19, about 445 cases with severe COVID-19 hospitalized and used dexamethasone were investigated for Candida infections and colonization by the laboratory data of Medical Mycology Center, UMS University, Urmia, Iran. Our subjects were sputum, bronco-alveolar and bronchial specimens. Candida elements including pseudo-hypha and blasto-spores microscopically were investigated. Differential cultures and PCR-RFLP were used for the identification of Candida yeasts at the level of species.ResultsTotally, 54 yeast overgrowth was detected in the clinical specimens including Candida albicans 28 (51.8%), non-albicans Candida species 24 (44.4%) and a case of Pneumocystis jirovecci. All of the cases with Candida detections were Covid-19 positive. Moreover, two cases of rhino-cerebral Mucomycosis, two cases of TB, two cases of asthma, and one case of cystic fibrosis were included.ConclusionAs a conclusion, Fungi especially Candida yeasts be considered as the potential pathogens in cases with a history of severe COVID-19 and corticosteroid therapy during stay at the hospital.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P183
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P184 Candida auris candidemia in COVID-19 and post-COVID-19 patients in a
           tertiary care hospital in North India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionCandida spp. accounts for 70%-80% of invasive bloodstream fungal infections. It is most commonly spread in long-term care facilities, caring for people with severe medical conditions. Patients hospitalized for COVID-19 are at risk for healthcare-associated infections like candidemia. Candida auris is an emerging, multidrug-resistant, healthcare-associated fungal pathogen. Candida auris is currently one of the most common clinical fungal pathogens, causing nosocomial infections. Due to its higher drug-resistance rate, C. auris is more difficult to treat, requires longer hospitalization periods, and results in higher morbidity and mortality than other Candida species.Aim and ObjectivesTo analyze the risk factors associated with C. auris candidemia in COVID-19 and post-COVID-19 patients at tertiary care center.Material and MethodsWe prospectively analyzed all positive blood samples which were received in the Microbiology department at SGPGI, Lucknow for a period of 1 year (March 2020-March 2021). Blood samples were inoculated and cultured in BACTEC Bottles (BD) and incubated for 5 days at 37°C. The bottles which flagged positive, a Gram's stain was performed and were sub-cultured on SDA for isolation of yeast colonies. Isolated yeasts were identified by phenotypic method and confirmed by MALDI-TOF MS. Demographics details of the patients were collected and recorded. The significant associated risk factors with C. auris candidemia were analyzed.ResultsA total of 13 000 blood samples were received during the 1-year study period from different departments of the hospital.1.25% (n = 163) of the blood culture samples were positive for candidemia. Out of 163 Candida culture-positive blood samples, 27.61% (n = 45) were C. auris. A total of 64% (n = 29) C. auris candidemia was seen in non-COVID-19 patients, 31.1% (n = 14) in COVID-19 patients, and two patients had a history of post-COVID-19 infection. The associated risk factors included the use of broad-spectrum antibiotics, intravenous catheterization, underlying respiratory illness, mechanical ventilation, use of steroids, and dialysis. A total of 46.6% (n = 21) mortality was seen with C. auris candidemia.ConclusionsCandida auris candidemia continues to be a threat in hospitalized patients. This study shows prevalence of C. auris candidemia in COVID-19 and post-COVID-19 patients with 47% mortality. Candida auris is continuously reported from different departments in our institute, especially from intensive care units with high morbidity and mortality. An alertness, awareness and infection control practices by the healthcare personnel will help in early diagnosis and appropriate antifungal therapy and control the spread of C. auris.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P184
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P185 Epidemiology of human fusariosis in Greece: results from a 16-year
           nationwide multicenter survey

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesFusariosis in humans comprises a vast array of rare but serious and difficult-to-treat infections, ranging from keratitis and onychomycosis in immunocompetent hosts to life-threatening systemic infections in immunocompromised patients such as those with hematologic malignancies. We aimed to assess the disease burden and baseline epidemiology of fusariosis in Greece.MethodsFrom 2004 through 2020 a prospective, nationwide, multicenter survey took place. Demographic and clinical data of fusariosis cases were recorded. Fusarium strains isolated were identified to species level with molecular methods and/or MALDI-TOF MS, and tested for antifungal susceptibility in vitro with the EUCAST methodology.ResultsA total of 54 cases were registered. The most frequent infection was keratitis (n = 21, 39%), followed by bloodstream infections in patients with hematologic malignancy (n = 12, 22.2%). Other infections involved the respiratory tract (n = 3, 5.5%), and sinuses (n = 3, 5.5%) in immunocompromised patients, soft tissues after trauma (n = 5, 9.3%), or diabetic foot (n = 2, 3.7%), and onychomycosis (n = 8, 14.8%). The estimated incidence of invasive Fusarium infections was 2.9 cases/year (0.027 cases/100 000 population). The most frequently isolated species were: F. solani species complex (SC) (n = 13, 24%), F. oxysporum SC (13, 24%), F. fujikuroi SC (n = 12, 22.2%, of which 6 F. verticillioides and 6 F. proliferatum). Other SCs included F. brachygibbosum, F. chlamydosporum, and F. dimerum. In keratitis cases, F. solani was associated with infection secondary to injury with plant material, whereas F. fujikuroi with soft contact lens wear. Fusarium oxysporum was more frequently isolated from nails or soft tissue infections (53.8%). Antifungal MICs were high, with no clear interspecies differences (geometric mean 1.6, 2.5, 3.2 mg/l for amphotericin B, voriconazole, and posaconazole, respectively, median values 2, 4, 8 mg/L, respectively). Fluconazole and the echinocandins showed no activity (MIC >32 mg/l). The most frequently used antifungals were amphotericin B and voriconazole, usually in combination. Treatment failure in keratitis was 38.5%. In patients with hematologic malignancy the crude mortality rate was 71.4%, usually related to the underlying disease. Soft tissue infections complicating diabetic foot or trauma were treated surgically, with favorable outcomes.ConclusionFusarium infections in Greece remain rare, but with considerable morbidity and mortality in the immunocompromised. Early diagnosis and initiation of the appropriate treatment were critical for a successful outcome in keratitis cases, despite moderately high MICs of the antifungals used.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P185
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P186 Disseminated Histoplasmosis in an immunocompetent patient in a
           tertiary care center in North India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesHistoplasmosis is a geographically restricted dimorphic fungi that causes disseminated infection in immune-competent as well as immunocompromised patients. Adrenal involvement is seen in disseminated disease but sometimes it may be the only site where then infection can be demonstrated. Early diagnosis and treatment are needed to save the patient from fatal adrenal insufficiency. We present a case of bilateral adrenal histoplasmosis in immunocompetent patient.MethodsA 63-year-old male presented to our hospital with a history of insidious onset of decreased appetite and unintentional weight loss for the last 6 months associated with generalized weakness. Patient had a history of mild to moderate intensity epigastric pain and discomfort which was intermittent in nature. Patient originally belongs to Azamgarh, Uttar Pradesh, but he was residing in Kolkata for the last 8 months.Patient had no history of fever, cough, hemoptysis, jaundice, chronic diarrhea, and steatorrhea. No history of orthostatic hypotension, salt craving, hyperpigmentation, headache, visual field disturbances, polyuria, behavioral changes, episodic headache, palpitation, diaphoresis, systemic hypertension with episodic all four-limb weakness. There was no history of abdominal striae, easy bruisability, difficulty in standing from squatting position. There was no history of tuberculosis among family members. On detailed history, it was revealed that he fed pigeons every day in the slum house where he lived in Kolkata.On the CECT abdomen it was found that there is an ill-defined hypodense enhancing lesion (72 × 52 × 77 mm) in right suprarenal region and bulky, necrosed 25 × 26 × 19 mm lesion in left suprarenal gland associated with multiple nonnecrotic paraaortic and aortic caval lymphadenopathy. He also received empirical anti-tubercular therapy for 15 days in the form of ethambutol and levofloxacin.ResultsIn all, 10% KOH wet mount of crushed smear of adrenal biopsy samples showed tissue debris and small narrow neck budding yeasts. Giemsa stain shows few small budding yeasts. Culture was put in SDA at 25°C and 37°C and incubated. On day 12, growth of colony in 25°C appears as white cottony growth with yellowish white reverse. On day 24, colony appears as buff brown with yellowish brown reverse. LPCB was done from the colony showing presence of characteristic tuberculate macroconidia (8–14) μm in diameter formed on short, hyaline, undifferentiated conidiophores and production of plenty round to pyriform microconidia (2–4 μm) in diameter, occurring on short branches and directly on the sides of the hyphae. Based on the direct microscopy and culture characteristics a diagnosis of Histoplasma capsulatum was given.ConclusionSystemic histoplasmosis is typically acquired through inhalation of microconidia or small hyphal elements in soil contaminated with bird and bat droppings leading to primary infection. This patient only manifested bilateral adrenal involvement with nonspecific symptoms.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P186
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P245 Arthrinium species, a filamentous ascomycetes isolated from samples
           of human cutaneous infections-report from a medical mycology laboratory of
           Assam, North-East India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesThis study aims to report the isolation of closely related Arthrinium species from superficial skin lesions of five cases from a medical mycology laboratory of Assam, North East India.MethodsThe lesions were decontaminated with 70% ethanol and skin scrapings were collected on a sterilized glass plate. Direct mounts were prepared in 10%-20% KOH and cultures were put in Saboraud's Dextrose Agar with antibiotics, 5% sheep blood agar, and dermatophyte test medium (Himedia, India). Plates and tubes were incubated as per standard mycological techniques described. Molecular identification was done using ITS sequence analysis using ITS1 and ITS4 universal primers.ResultsDirect mount showed presence of hyphae with arthrospores in 3/5 cases. In one case, fungal hyphae was seen along with spore-like oval or round structures of about 3-4 μm diameter. Pure growth was seen after 7-14 days in multiple culture tubes in all five cases. Colonies were white, downy initially becoming white, and floccose on further incubation. Subculture on PDA in all the cases for 15-20 days revealed black, round, and oval spores of 3-5 μm suggesting Arthrinium spp.The taxonomical identification was done by constructing a phylogenetic tree of the ITS sequences of the Arthrinium isolates of this study along with reference Arthrinium strains and Seiridium phylicae as the outgroup taxa.The phylogenetic analysis clustered the isolates of this study into closely related Arthrinium species.ConclusionThe genus Arthrinium belonging to the family Apiosporaceae, class Sordariomycetes which comprises of a group of filamentous ascomycetes fungi is rarely reported from human infections. We are reporting closely related Arthrinium spp from five cases of skin lesions from Assam, North East India. Three of the 5 cases hailed from tea garden areas of Assam. Arthrinium isolation in clinically significant cases and in multiple tubes may not be disregarded as a contaminant.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P245
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P246 Neglected keratitis caused by Exserohilum rostratum from the arid
           region of north-west India leading to vision loss—a case report

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo report a case of complete loss of vision due to delay in diagnosis of fungal keratitis caused by Exserohilum rostratum in an immunocompetent patient from the arid area of north-west India.MethodA 65-year-old female farmer was admitted to ophthalmology with a history of pain, redness, watering, and foreign body sensation in the left eye for 2 months. She had a history of trauma by splinters 2 months back. On ocular examination, a large corneal ulcer of about 7 × 8 mm size at 2-8‘o’ clock position in the left eye was present with diffuse corneal edema. She had no history of diabetes mellitus, hypertension, tuberculosis, COVID-19, and steroid eye drops instillation. There was no relevant previous history of any ocular surgery also. She was negative for hepatitis-B and human immune deficiency virus on serology. All her hematological parameters were within normal limits.Patient was treated with moxifloxacin, carboxy methyl cellulose eye drops, and Neosporin eye ointment for around 2 months at primary health care facilities and later referred to our hospital for further management.Corneal scraping of the patient was sent to our laboratory for potassium hydroxide mount and culture identification.ResultsFungus was identified as E. rostratum on the basis of gross, macroscopic, and microscopic morphology. Gram's staining was bacteriologically negative while true fungal hyphae were seen. In KOH mount pigmented, septate, and branched true hyphae were seen. Bacterial culture was reported sterile.Lactophenol cotton blue mount of culture revealed dematiaceous hyphae along with 4-9 septate elongated, ellipsoid macroconidia of 14-90 μm with prominent dark conspicuous hilum and geniculate conidiophore arranged sympodially. On the basis of these characteristics, it was diagnosed as E. rostratum.After the diagnosis patient was switched over to topical natamycin 5% two hourly and oral itraconazole 200 mg BD from moxifloxacin and neosporin. To which the patient responded symptomatically. Ulcer healed in a month leaving behind a lateral scar. However, vision is permanently compromised and the patient is advised for therapeutic penetrating keratoplasty (TPK).ConclusionExserohilum rostratum is generally regarded as a pathogen in hot and humid climates. However, the isolation of this organism in our area highlights the pathogenic potential of this emerging fungus in arid climates also. Ophthalmologists need to be made aware of the significance of prompt mycological identification to prevent vision loss.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P246
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P248 Fungal meningitis in an immunocompetent individual

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveFungal meningitis is commonly seen in individuals who are immunocompromised. It's a significant cause of morbidity and mortality in people living with HIV worldwide. Among HIV-infected patients of Manipur, it is the most common cause of meningitis and Cryptococcus neoformans is the only species identified so far both in HIV infected population and non-HIV patients in Manipur. The aim of this paper is to highlight the detection of C. gattii meningitis in the high HIV prevalence state of India.MethodA 53-year-old male, mechanic by profession residing in a village in Thoubal district of Manipur attended Medicine OPD with complaints of intractable headache, aggravated by sound and light, generalized weakness, hiccups, vomiting, and decreased appetite for 2 weeks. There was no history of altered sensorium. He is a known case of hypertension and was recently diagnosed with T2DM, not on medication.ResultsAn MRI brain (Fig.1) showed a tiny sub-centric lesion in the bilateral centrum semiovale. Cerebrospinal fluid examination by India Ink preparation revealed capsulated budding yeast cells suggestive of Cryptococcus sps. Cryptococcal antigen testing (CryptoPS, Biosynex) was positive with a high titer. Culture on SDA and BSA showed growth of Cryptococcus sps. For phenotypic identification and antifungal susceptibility testing, the isolate was processed in VITEK 2(Biomerieux) system which identified it as C. gatti (94% probability). The isolate was sensitive to amphotericin B (mic: 0.5 μg/ml) and flucytosine (mic: 2 μg/ml). He tested negative for HIV on two occasions and his CD4 + count was 888 cell/mm3. Blood sugar was 225 mg/dl, with urine glucose leakage in traces. Blood and urine were collected for fungal culture which showed no growth. The patient was put on liposomal amphotericin B 200 mg daily. After 1 week, patient's condition was not deteriorating, although the improvement was minimal. The isolate was sent to the National Culture Collection of Pathogenic Fungi, PGIMER, Chandigarh, and it was confirmed as Cryptococcus gattii by MALDI-TOF assay.ConclusionDetection of C. gattii in an immunocompetent patient in Manipur state, with a high prevalence of HIV is alarming because cryptococcal meningitis is the commonest form of meningitis in this population. In future, whenever Cryptococcus sps is isolated, it will be pertinent to keep in mind the possibility of other species of Cryptococcus to be the causative pathogen. We emphasize the importance and need for surveillance to detect its environmental niche.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P248
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P249 Predictors of adverse outcome in sarcoidosis complicated by chronic
           pulmonary aspergillosis

    • Abstract:  Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionAspergillosis complicating pulmonary sarcoidosis is associated with high mortality.1 The specific prognostic impact of fibrocavitary sarcoid disease, however, remains poorly understood. A better understanding of the factors that determine adverse outcomes in such patients may improve the management of both the underlying sarcoid disease and associated secondary fungal infection.MethodsWe implemented a clinical informatics pipeline to data-mine the hospital's clinical data warehouse and identify patients for inclusion in this study. Cases of pulmonary sarcoidosis with elevated Aspergillus IgG (>40 mgA/l) presenting between January 2009 and March 2021 were retrospectively identified. Controls (sarcoidosis with normal Aspergillus IgG titer) were case matched by baseline percentage-predicted gas transfer factor (TLco; ±5% variance). CPA cases were identified by using ISHAM criteria for diagnosing CPA, that is Aspergillus IgG >40 mgA/l plus keyword search for cavities or fungal ball in the CT reports based on search terms for aspergilloma, cavity, intra-cavitary, and mycetoma. Computed tomography (CT), baseline lung function, and survival data were analyzed.ResultsAmong 179 cases (high Aspergillus IgG) and 477 controls (normal Aspergillus IgG), no inter-group difference was evident in the median age at presentation [48 (IQR 40-58) vs 50 (IQR 42-59)] or gender (proportion female: 45.5% vs 51.1%). Amongst the cases, 80/179 (45%) had fibrocavitary changes, compared with 14/477 (2.9%) of the controls (P <.001). Radiologically-evident aspergilloma was present in 80% (64/80) of the cases with fibrocavitary sarcoidosis. Evidence of fibrocavitary destruction was associated with higher overall mortality (60% vs 9.1% in the non-fibrocavitary subgroup; <.0001), and poorer median survival (Fig. 1). The median age at death was lower where there was fibrocavitary disease, and even lower with high Aspergillus IgG, and this was statistically significant. These cases also had poorer lung function compared to non-fibrocavitary disease (Fig. 2): mean %-predicted forced vital capacity (FVC) 71.3% vs 91.4% (P <.0001), and in the controls: 69.9% vs 86.0% (P <.01). A similar trend was observed in %-predicted TLco amongst the fibrocavitary cases: 45.8% vs 64.2% non-fibrocavitary (P <.0001) and in the fibrocavitary controls: 39.7% vs 59.0% non-fibrocavitary (P <.0001). Comparing only those with fibrocavitation, neither the percentage-predicted FVC (71.3% vs 69.9% predicted; P = .82) nor the percentage-predicted TLco (45.7% and 39.7% predicted; P = .16) differed between cases and controls.ConclusionsFibrocavitary sarcoidosis is associated with worse lung function and poorer median survival. In this group, elevated Aspergillus IgG highlights a greater incidence of aspergilloma.ImplicationsFibrotic transformation of pulmonary sarcoidosis heightens symptom burden, predisposes to chronic Aspergillus infection, and is prognostically important particularly when there is supervening fibrocavitary lung destruction. Sensitive stratification of such patients for the long-term outcomes may help identify particular individuals for earlier and more focused therapeutic intervention.Sources:Uzunhan et al., Chronic pulmonary aspergillosis complicating sarcoidosis, European Respiratory Journal 2017 49: 1 602 396;
      DOI : 10.1183/13993003.02396-2016
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S2.3d Mixed biofilm of Aspergillus fumigatus and Stenotrophomonas
           maltophilia: Microscopic visualization of galactosaminogalactan and
           galactomannan polysaccharides in the extracellular matrix

    • Abstract: Abstract S2.3 Novel diagnostic tools for invasive mold infection, September 21, 2022, 3:00 PM - 4:30 PMIntroduction: Aspergillus fumigatus (Af) and Stenotrophomonas maltophilia (Sm) are commonly co-isolated from the airways of cystic fibrosis patients, especially in mixed biofilms. A mixed Af-Sm biofilm model, developed by our lab, demonstrated that Sm exhibits an antibiosis effect on Af by (1) inhibiting fungal growth, (2) rendering the fungal mycelia highly branched, and (3) increasing the fungal cell wall thickness.1 The presence of three Af cell wall polysaccharides, galactomannan (GM), galactosaminogalactan (GAG), and α-1,3-glucan, have been described in the extracellular matrix (ECM) of Af biofilms.2 GM and GAG are known to be released out from the cell wall of Af.3 GAG contains N-acetylgalactosamines (GalNAc) which undergo partial deacetylation extracellularly, to be converted to GalN, and thus transform this polysaccharide into a polycation with strong surface binding properties.4Aim of the study: Analyze the structure of fungal cell wall polysaccharides in the formation of Af biofilm alone or mixed with Sm.MethodsThe Af-Sm co-culture was prepared on an 8-chambers Lab-Tek slide as described previously1. Anti-GAG and anti-GM monoclonal antibodies produced at the Aspergillus Unit at Pasteur Institute of Paris, were used to focus on the 3D structure of GAG and GM in the ECM of the biofilm. These polysaccharides were analyzed by fluorescence confocal microscopy at 24 h.Results and Conclusion: GM was found, as expected, in the hyphal Af cell wall but was very little in the ECM. GAG was also found in the cell wall but mainly formed a beautiful fibrillary network between the hyphae, showing the importance of this polysaccharide in cell-cell interaction and in the structuration of Af biofilm. GAG could be the surface receptor for Sm, which would promote strong adhesion between Sm and Af in the biofilm.Sources:1. Melloul E et al. Front Microbiol. 2018;2. Beauvais A et al. Microbiol Spectr. 2015;3. Fontaine T et al. J Fungi. 2020;4. Briard B et al. Mycologia 2016.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S2.3d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S2.4a Pythiosis: An emerging disease in Hong Kong

    • Abstract: Abstract S2.4 Veterinary mycology research, September 21, 2022, 3:00 PM - 4:30 PMOomycosis is an emerging disease of humans and animals caused by oomycetes in the Stramenopiles-Alveolata-Rhizaria super group, mainly Pythium insidiosum and occasionally Lagenidium giganteum or Paralagenidum species. In surface freshwater, oomycetes produce motile biflagellate asexual zoospores with marked chemotactic attraction to epithelial surfaces of vertebrate hosts. Infection is the result of encystation and invasion of damaged skin or gastrointestinal mucosa.Of ∼ 4200 cases of pythiosis reported globally between 1980 and 2021 only ∼ 20% involved humans while 80% involved animals, mainly horses, dogs, and cattle. Most human cases occur in India and Thailand, whereas most animal infections were reported in the United States and Brazil. Pythiosis has been reported in mainland China, but the burden of the disease is low and comprises <1% of overall cases in humans.Neither pythiosis nor lagenidiosis has been previously reported in humans or animals in Hong Kong. From January 2018 to January 2022, the Veterinary Diagnostic Laboratory of City University of Hong Kong diagnosed 10 cases of oomycosis (5 canine, 5 feline) after identification of non-parallel walled, irregularly branching, and poorly septate hyphae in the center of necrotic regions of histological sections of formalin-fixed paraffin-embedded tissues (FFPET). Species identity was confirmed by PCR and sequencing of 28S rDNA from DNA extracts of FFPET. There were 8 cases of P. insidiosum and 2 of L. giganteum infection. Serum ELISA was positive for Pythium antibodies in 5/6 cases tested and negative for Pythium/Lagenidium/Paralagenidum antibodies in a German shepherd dog (GSD) with disseminated disease caused by L. giganteum.Affected dogs were young to middle-aged at presentation (9 months to 5 years old). Two dogs had focal cutaneous infections, two had extensive gastrointestinal involvement, and the GSD had disseminated disease with cutaneous, mediastinal, and abdominal involvement.Affected cats were young (8 weeks to 18 months) and presented with subcutaneous/cutaneous disease. Three cats had a distinctive perianal ring of bulging subcutaneous granulation tissue, including one that also had an ulcerated, proliferative and necrotic lesion involving two adjacent hind-limb digits. One cat had facial subcutaneous swelling with mandibular lymph node enlargement and the remaining cat presented with extensive circumferential swelling of one hind limb from the distal paw to the mid-stifle.All cats tested negative for the Feline leukemia virus and Feline immunodeficiency virus. Traumatic or surgical wounds preceding infection were identified in a kitten caught in a rodent glue-trap with skin wounds, in a cat with facial involvement that had an injured globe surgically enucleated, and in a dog with cutaneous pythiosis that had chronic dermatitis.Treatment data were available for one canine case. The GSD with lagenidiosis was treated with combination antimicrobial therapy including voriconazole, terbinafine, minocycline, and azithromycin. The dog responded poorly. Mefenoxam was substituted for voriconazole and hyperbaric oxygen therapy was administered. After initial response, the dog succumbed 4 months from diagnosis. We have had success with the treatment of four feline cases using combination therapy including surgical debridement, immunotherapy with a Pythium vaccine, and combinations of antifungal drugs (posaconazole and terbinafine), and/or antimicrobials (doxycycline/minocycline and azithromycin).
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S2.4a
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P086 Clinical outcome and in vitro antifungal susceptibility of clinical
           isolates of rhino-orbito-cerebral mycosis associated with post COVID 19
           from North India

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThis study aimed primarily to determine the etiology, clinical features, and comorbidities of patients with rhino-orbito-cerebral mycosis. Secondly, antifungal susceptibility pattern of the isolates and lineage by ITS-sequencing was also studied.MethodsThe study was conducted from May to December 2021 on all suspected cases of rhino-orbito-cerebral mycosis in post-COVID-19 patients at a tertiary care center. Data pertaining to demographics, recent COVID-19 infection, clinical features, comorbidities, laboratory, radiological investigations, management, and outcomes were collected after obtaining informed consent from all patients. Staging of ROCM was done using the proposed code Mucor and diagnosis of COVID-19 was done on basis of real-time polymerase chain reaction (RT-PCR) test. KOH Mount examination, fungal culture, and histopathological examination was performed on samples collected endoscopically or post-debridement. Mucormycosis was proven based on fungal culture or specific histological features from biopsy specimens. In vitro susceptibility profiles for antifungal drugs as per CLSI microbroth dilution method (M38-A2) was studied by HiMIC™ plate (HiMedia) for amphotericin B, voriconazole, posaconazole, itraconazole, and isavuconazole. MIC ranges and the drug concentrations required to inhibit 50% (MIC50) or 90% of isolates (MIC90) were determined. ITS Sequencing was also performed on representative isolates.ResultsA total of 70 patients were diagnosed with mucormycosis. Rhino-orbital and rhino-orbito-cerebral forms were observed in 35.7% of cases each. Diabetes mellitus (DM) was present in 95.7% patients while 78.5% of the patients were treated with corticosteroids in recent past, and 25.7% presented with active COVID-19 pneumonia. Most cases showed onset of symptoms of mucormycosis between 29 ± 17 days from diagnosis of COVID-19. On imaging, orbit was involved in 52.8% and cranial involvement is seen in 35.7% of patients. Diagnosis of mucormycosis was established on KOH direct microscopy 68.6%, culture 47.14%, histopathology 55.7%. Isolates obtained were Rhizopus arrhizus (42.4%), Apophysomyces variabilis (3.03%), and Aspergillus spp (69.7%) while mixed infection was seen in 42.4%. The MIC50 and MIC90 of amphotericin B for R. arrhizus strains were 0.25 and 4 μg/ml; and MIC50 and MIC90 results for itraconazole, posaconazole, and isavuconazole were 8 and 8, 2 and 2, and 2 and 8 μg/ml respectively. Aspergillus spp was susceptible to amphotericin B (38.8%), itraconazole (50%), voriconazole (50%), posaconazole (11.1%), and isavuconazole (44.4%). Overall treatment included intravenous amphotericin B along with functional endoscopic sinus surgery (FESS)/paranasal sinus (PNS) debridement in 68.2%, orbital exenteration in 4.2%, orbital decompression in 11.4% patients and partial maxillectomy in 22.8% cases. Intraorbital injection of amphotericin B was administered in 15.7%. At final follow-up, mortality was 19.7%. In vitro MICs showed that amphotericin B was the most active compound against most species.ConclusionHigh index of suspicion, early diagnosis, and appropriate management of mucormycosis can improve survival. Rational use of steroids and strict glycemic control in diabetic patients can prevent occurrence of mucormycosis. Use of standard methods for antifungal susceptibility testing to guide antifungal treatment may be clinically useful in cases of treatment failure.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P086
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P087 A clinicomycological study of dermatophyte infection including
           antifungal susceptibility testing in patients attending a tertiary care
           hospital in north-western state of rajasthan

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTreatment-resistant ermatophytosis caused by Trichophyton rubrum (T. rubrum) or Trichophyton mentagrophytes (T. mentagrophytes)/Trichophyton indotineae have recently emerged as a global public health issue. This phenomenon is spreading, and is particularly important in endemic areas such as India. However, due to lack of focused studies on dermatophyte prevalence, there is paucity of such data from Rajasthan. Hence, for better understanding of the prevalence, antifungal susceptibility, and resistance pattern to enable best empiric treatment the present study was done.Materials & MethodsA total of 100 patients attending Dermatology and Venereology outpatient department during the period of December 2019-October 2020 were enrolled under this prospective study. Samples were subjected to KOH, culture examination, and identified by standard techniques at the mycology section of department of microbiology. Antifungal susceptibility testing was performed by Microbroth dilution as per CLSI guidelines (M38-A2) with the following drug concentration ranges—amphotericin B 0.0313-16 μg/ml; flucytosine 0.125-64 μg/ml, ketoconazole 0.0313-16 μg/ml. Itraconazole and voriconazole 0.0078-4 μg/ml, fluconazole 0.0625-32 μg/ml, caspofungin 0.0313-16 μg/ml and terbinafine 0.0156-8 μg/ml.ResultsAmong 100 clinical samples tested, culture positivity was found to be 63%, including dermatophytes (76.1%), non-dermatophytes molds (19.04%), and yeasts (∼ 4%). Among dermatophytes, T. mentagrophyte was the predominant isolate (33.3%) followed by T. rubrum (29.1%). Most common clinical type was tinea cruris (53%) followed by tinea corporis (23%). Itraconazole and voriconazole were found to be most effective at MIC range of 0.0078-4 μg/ml for T. mentagrophyte and at 0.0078-1 μg/ml for T. rubrum, mostly corroborating with clinical outcome. Itraconazole resistance was highest (57%) in T. rubrum, whereas terbinafine resistance (>0.2 μg/ml) was seen in ∼ 31-37% of these two major species.ConclusionIt is important for clinicians to emphasize upon microbiological diagnosis of dermatophytosis as these infections have many mimics, highlighting the need of confirmation by culture. High prevalence of terbinafine resistance in both T. mentagrophyte and T. rubrum and itraconazole resistance in T. rubrum is of concern and highlights the need to routinely perform antifungal drug susceptibility testing as a necessary adjunct to treatment and for surveillance.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P087
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P088 Molecular identification and antifungal susceptibility of pathogenic
           yeasts from the China Antifungal Resistance Surveillance Trial
           (CARST-fungi) Study

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesInvasive fungal diseases (IFDs) caused by yeast species have considerable morbidity and mortality, especially in immunocompromised hosts, and those with antifungal resistance represent a major clinical challenge. In order to have a comprehensive understanding of the characteristics of epidemiology and antifungal susceptibilities in clinical yeasts, the China Antifungal Resistance Surveillance Trial (CARST-fungi) study, a prospective national surveillance program for IFDs in mainland China, was conducted.MethodsThe CARST-fungi study encompassed nine ‘rank-A tertiary’ hospitals distributed throughout different cities in China in the year 2019-2020. All yeast isolates recovered from various clinical samples were subcultured and identified by sequencing of the internal transcribed spacer (ITS), 28S ribosomal subunit (D1/D2), and the intergenic spacer (IGS, for Trichosporon spp. and Cryptococcus spp.). Antifungal susceptibilities of fluconazole (FLC), itraconazole (ITC), voriconazole (VRC), posaconazole (POS), caspofungin (CAS), anidulafungin (ANF), micafungin (MCF), and amphotericin B (AMB) against the yeast isolates were performed according to the Clinical and Laboratory Standards Institute (CLSI) M27-A4 broth microdilution method.ResultsA total of 269 nonduplicate yeast isolates from 261 patients were collected. About half of the yeast isolates (127, 47.9%) were recovered from blood, followed by ascetic fluid (46, 17.4%). C. albicans remained the most prevalent (120, 44.6%), followed by C. parapsilosis complex (50, 18.5%), C. tropicalis (40, 14.9%), and C. glabrata (36, 13.4%). Among C. albicans, 5 (4.2%), 11 (9.2%), 6 (5%), 10 (8.4%) isolates were resistant/non-wide-type (NWT) to FLC, ITC, VRC, and POS, respectively, and 9 (7.5%) isolates were cross-resistant to triazoles. As for C. parapsilosis complex, only 1 (2.4%) isolate of C. parapsilosis sensu stricto was cross-resistant to FLC and POS, while all the 9 C. metapsilosis isolates were wide-type (WT) to triazoles. However, only 45% (18/40) C. tropicalis were susceptible/WT to triazoles, and 12 (30%), 3 (7.5%), 8 (20%), 19 (47.5%) isolates were resistant/NWT to FLC, ITC, VRC, and POS, respectively, and 8 (20%) isolates were cross-resistant to triazoles. Among C. glabrata, 2 (5.6%) isolates were resistant to FLC and the remaining 34 isolates were susceptible-dose dependent (SDD), 20 (55.6%), and 8 (22.2%) isolates were resistant/NWT to VRC and POS, respectively, and 4 (10.3%) isolates were cross-resistant to triazoles. One isolate of Meyerozyma guilliermondii was NWT to POS. Except for 3 isolates of C. tropicalis exhibiting intermediate to CAS and ANF, and 2 isolates of C. glabrata were cross-resistant to CAS, MCF, ANF, which were also NWT to POS and defined as multidrug-resistant, other isolates of common Candida species were all susceptible to echinocandins. All yeast isolates tested in this study were WT to AMB (MICs ≤ 2 μg/ml). For less common species, 1 isolate of Rhodotorula mucilaginosa exhibited high MICs to echinocandins and FLC, and 1 isolate of Trichosporon asahii showed high MICs to all the antifungals tested except AMB.ConclusionAmong 269 yeast isolates from the CARST-fungi study, C. albicans remain the most predominant, followed by C. parapsilosis complex, C. tropicalis, and C. glabrata. Triazole-resistance is notable among C. tropicalis and C. glabrata. Multidrug-resistant isolates of C. glabrata and less common yeast have been emerging.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P088
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P089 Candidemia: prevalence, species characterization ,and the antibiotic
           susceptibility profile from a tertiary care hospital in north india

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThe aim of this study was to characterize the Candida spp. isolated from blood cultures and determine the antifungal susceptibility pattern of the Candida species prevalent in a tertiary care hospital in North India.MethodsThis retrospective study was conducted in Department of Microbiology of a tertiary care hospital in North India from April 2020 to March 2022. All blood cultures received in the department during this period were included in the study. Candida species isolated were identified and antifungal susceptibility testing was performed by VITEK as per standard protocol, The susceptibility pattern of 50 isolates was also performed by the broth microdilution method as per Clinical and Laboratory Standards Institute guidelines (CLSI) and the results were compared with VITEK results.ResultsOut of 21 804 blood cultures received during this period, 177 grew Candida species. Therefore, the overall prevalence of Candida species was 0.81% in our study. The incidence of bloodstream infection caused by non-albicans Candida species (80%) was higher than C. albicans (20%). Among NAC species, C. tropicalis (45%) was the most common, followed by C. pelliculosa (15%).Candidemia was predominantly observed in ICU patients. Resistance was seen in 14.1% isolates to voriconazole and fluconazole, 4.2% to flucytosine and 3.9% to caspofungin and amphotericin-B. No resistance was seen to micafungin. A total of 15% of the isolates were resistant to more than one drug.ConclusionThere was a predominance of non-albicans Candida over C. albicans. Maximum resistance was seen to voriconazole followed by fluconazole. Continuous surveillance is necessary to follow trends and monitor changes in epidemiological and resistance patterns in different geographical regions, especially in critically ill patients.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P089
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P139 Candida : An important partner in polymicrobial colonization on
           indwelling medical devices

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIndwelling medical devices are of routine use in hospitals for patient care but they lead to the colonization of microbes on their surface making the patient vulnerable to device-related infections (DRI). Biofilms formed due to the growth of microbes are the most common cause of device-related infections.ObjectivesTo isolate, identify and study the microbial colonization of indwelling medical devices (urinary catheters and central venous catheters).To quantify the biofilm formed by the isolates.MethodIn the present study, microflora was isolated from urinary catheters (n = 28) and central venous catheters (n = 25) that were catheterized in ICU patients. Quantification of biofilm was done by Crystal violet assay.ResultsAmong 28 urinary catheters, 14 catheters had polymicrobial colonisation (n = 10 mixed bacterial and fungal colonization, n = 3 polybacterial, and n = 1 polyfungal), 10 catheters were observed to have mono-species colonization (n = 6 fungal, n = 4 bacterial), while 4 catheters did not show any colonization. Whereas among 25 central venous catheters, only 3 catheters showed mono-bacterial colonization and 2 catheters showed mono-fungal growth and 20 catheters did not show any colonization. A total of 46 isolates were obtained from all urinary and central venous catheters, out of which Candida spp. was found to be highest in number with n = 13 and 30% of total isolates obtained (the Fig. 1 shows the distribution of microflora obtained). The interesting observation in the study is that Candida spp. is found to have multi-species colonization with bacterial isolates (Pseudomonas aeuroginosa, Klebsiella pneumoniae, Staphylococcus haemolyticus, Enterococcus faecium, and Stenotrophomonas maltophilia) as well as fungal isolates (Trichosporon asahii). Quantification of biofilm formed by these isolates was carried out by crystal violet assay and it was observed that 35.6% isolates formed strong biofilm of which Candida spp. was a major contributor. It was also observed that Candida spp. was always the stronger biofilm forming partner in mixed species biofilms.ConclusionIt was concluded that majority of colonization on indwelling medical devices are polymicrobial and Candida spp. appears as an important partner in polymicrobial colonization. Among all obtained isolates maximum were strong biofilm forming of which Candida spp. were the major contributors.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P139
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P140 Saksenaea vasiformis infection: case report of extensive abdominal
           wall necrotizing fasciitis with systematic review and analysis of 64 cases
           

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionSaksenaea vasiformis is a rarely reported Mucorales causing mucormycosis in both immunocompromised and immunocompetent individuals. Due to few reported cases, the clinical characteristics and optimal management strategy for this rare agent are not clearly described. Therefore, we conducted a combined analysis of a case of extensive abdominal wall necrotizing fasciitis from our center with individual patient data extracted from other reports in world literature to give an overview of clinical and demographic profiles as well as factors affecting outcomes in this rare infection.MethodsWe systematically reviewed Medline, Embase, and CINHAL for studies on S. vasiformis infections reported till January 1, 2022, and 57 studies (63 patients) were retrieved. We also describe clinical and demographic characteristics and outcomes of a case of extensive abdominal wall necrotizing fasciitis managed at our institution.ResultsOf the 64 included cases, the majority were reported from India (26.6%). The most common risk factors for infection were accidental trauma (31.3%), health-care-related wounds (14.1%), and animal/insect bites (12.5%). Subcutaneous infection was the most common clinical presentation (60.9%) followed by rhino-orbito-cerebral mucormycosis (ROCM) (14%), necrotizing fasciitis (10%), and disseminated infection (9.3%), pulmonary (3.2%) and osteomyelitis (1.6%). Mortality was observed in 24 (37.5%) patients and healthcare-related injuries were significantly associated with higher mortality (P .001). The use of posaconazole (P .019) and surgical intervention (P: .032) was associated with significantly better survival.See Figures 1 and 2 below.DiscussionIn this study, we describe the largest compendium of mucormycosis due to S. vasiformis and can be useful in increasing awareness regarding this rare Mucorales in addition to guiding patient management.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P140
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P141 Study of prevalence, antifungal profile and predictors of mortality
           in chronic pulmonary Aspergillosis in a cohort of liver disease patient

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesChronic pulmonary aspergillosis (CPA) is a neglected cause of respiratory disease even in high-TB burden countries like India. It is a term that includes simple aspergilloma, chronic cavitary pulmonary aspergillosis which is the most common variant that presents with formation of lung cavities with or without an aspergilloma or nodules, and chronic fibrosing pulmonary aspergillosis. CPA is a chronic progressive infection that destroys lung tissue in non-immunocompromised patients. So, we studied the prevalence of CPA in liver disease patients with respect to spectrum of infections, fungus isolated, and outcome.MethodsA cohort of 2250 liver disease patients with isolation of Aspergillus in respiratory samples, was analyzed retrospectively for the diagnosis of CPA, from June 2018 to June 2020. The demographic characteristics, clinical, radiological, and laboratory objective and subjective variables including age, sex, previous pulmonary conditions, dyspnea score, quality of life, serum albumin, ESR, etc were assessed using Kaplan-Meier curves, log-rank tests, and Cox proportional hazards modeling. In samples of patients, retrospective review of time from likely onset of CPA to referral and cause of death were also investigated.ResultsCPA was diagnosed in 16% of the patients. Survival was 72%, at 1 year. Increased mortality was associated with chronic obstructive pulmonary disease (hazard ratio 2.57; P = .029), nontuberculous mycobacterial infection (2.04; P <.001), increasing age (1.03, P <.001), lower albumin (0.92, per g/L), underlying chronic liver disease (2.07; P <.001) were significantly associated with CPA. The Aspergillus species isolated were A. flavus (66%), A. fumigatus (31%), Aspergillus nidulans (1%), A. terreus (1%), and other Aspergillus species (1%). All the isolates were sensitive to echinocandins and amphotericin B. Azole-resistance was detected in 3% isolates. Multiple pulmonary lesions were more common (73%) than single cavitary lesion. Mortality was seen in 64% of cases.ConclusionCPA pulmonary aspergillosis is a common complication and cause of mortality in post-cavitary pulmonary disease. Several factors impact on mortality of CPA, and can be evaluated as tools to assess CPA prognosis. Underlying liver disease is an important predictor of mortality. As there is a rise in azole-resistance, appropriate diagnosis, and antifungal sensitivity testing should be done in all suspected cases. Early diagnosis and treatment can prevent mortality in CPA patients.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P141
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P142 Lodderomyces elongisporus: A n emerging cause of fung emia

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackgroundLodderomyces elongisporus, earlier considered as a sexual state of Candida parapsilosis, was described as a distinct species based on ribosomal RNA gene sequencing. Few cases of human infections by this yeast have been described from Mexico, China, Malaysia, Kuwait, Australia, and the USA. We describe here eight cases of fungemia by L. elongisporus from a tertiary care hospital in North India.MethodsClinical characteristics and risk factors associated with L. elongisporus fungaemia were evaluated. Yeast isolated from blood culture (BD BACTEC™ 9240, New Jersey, USA) was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectroscopy (MALDI-TOF MS, Bruker Daltonik GmbH, Bremen, Germany) and sequencing of D1/D2 region of a large subunit of ribosomal DNA. We performed antifungal susceptibility testing for amphotericin B, fluconazole, itraconazole, voriconazole, posaconazole, caspofungin, anidulafungin, and micafungin by the microbroth dilution method recommended by the Clinical and Laboratory Standards Institute (CLSI).ResultsWe report eight cases of fungemia caused by L. elongisporus at our tertiary care center. Of these, three were infants (males) and five were adults (3 males and 2 females). The mean age of adults was 43.4 years. Among the pediatric cases, underlying diseases included congenital heart disease/atrophic kidney (neonate), tracheoesophageal fistula (4 months), and late-onset neonatal sepsis (LONS). Among the adults, underlying illnesses included acute kidney injury (n = 2), superior mesenteric artery thrombosis with bowel gangrene (n = 1), diabetes (n = 1), and central nervous system (CNS) lymphoma (n = 1). The iatrogenic factors included the history of surgery (n = 3), admission to ICU (n = 3), presence of urinary catheter (n = 4), and presence of central venous catheter (n = 1). Seven patients were on broad-spectrum antibiotics. The mean stay in the hospital was 20.38 days. Three of the patients were managed with fluconazole. Six patients improved while one left against medical advice (LAMA) and one expired. The range of minimum inhibitory concentration (MIC) of all the isolates against antifungals was as follows: amphotericin B (0.03-0.25 μg/ml), fluconazole (0.125 μg/ml), voriconazole (0.03 μg/ml), itraconazole (0.03-0.06 μg/ml), posaconazole (0.03-0.25 μg/ml), caspofungin (0.03-0.06 μg/ml), micafungin (0.03-0.06 μg/ml), and anidulafungin (0.03 μg/ml).ConclusionLodderomyces elongisporus is an emerging pathogenic yeast causing fungemia in patients with comorbidities and undergoing surgery or invasive interventions. Though no antifungal breakpoints exist for this yeast, all the isolates exhibited low MICs to all the tested antifungals.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P142
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P216 Rare isolates from subcutaneous mycotic lesions; A study from
           tertiary care center in Chhattisgarh, India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMAims and ObjectiveTo identify the causative agents of suspected subcutaneous mycosis patients attending to a tertiary care hospital, Chhattisgarh, India.IntroductionSubcutaneous mycoses are a group of fungal infections of dermis and subcutaneous tissue caused by both melanized and hyaline molds. It often affects patients with immunosuppressive conditions. It consists of Sporotrichosis, Chromoblastomycosis, Phaeohyphomycosis, Hyalohyphomycosis, Mycetoma, subcutaneous zygomycosis, Rhinosporidiosis, Lobomycosis, and disseminated Penicilliosis. There are proven pathogenic agents causing subcutaneous mycosis though are not regularly isolated and reported. Few of them are commonly come across in the laboratory. Herewith, emphasized on the unusual clinical isolates from the patients having subcutaneous mycotic lesions with their clinical details.MethodIt is a retrospective descriptive analysis of data of subcutaneous mycosis cases of duration January 2019 to March 2022.Total 52 clinical specimens from the suspected subcutaneous mycotic lesion were studied. Male dominance was observed amongst the patients. Amongst 52, 31% were detected positive for fungal elements by direct microscopy in 20% KOH mount, 55.7%, 25% positivity was observed in Culture and by both KOH wet mount and culture. Samples were processed and identified by using standard protocol.The significant unusual isolates identified were Conidiobolus coronatus from subcutaneous cyst from buttocks, Medicopsis romerai from fine needle aspiration from the nodule of left thumb, Rhytidhysteron rufulum from right lateral malleolus, Aquastroma magniostiolata species from subcutaneous cyst on lateral aspect of left lower leg above lateral malleolus, Aspergillus tamorii, Aspergillus glaucus, Chetomium species, Aspergillus montevidensis, Cladosporium sphaerospermum. Phenotypically unidentified isolates were sent to NCCPF PGI, Chandigarh for final identification.ConclusionThere is diversity in the etiological agents of subcutaneous mycoses. Every case is different and rare. With the help of molecular techniques, it became possible to identify unusual fungal isolates from subcutaneous infection. Awareness and extensive studies are required to evidence the pathogenicity and associated complication due to these fungal infections. It will also help to regulate the therapeutic management and to know the geographical distribution of unusual fungal agents.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P216
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P217 Pelvic mycoses— an unusual presentation of Rhizopus arrhizus in an
           ommunocompetent patient

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionThe rare but increasingly identified infections caused by Mucorales are always detrimental to the patient due to rapid vascular invasion and the need for thorough surgical debridement and definitive antifungal therapy for its cure. Among the Mucorales, maximum cases have been reported among Mucor spp. and Rhizopus spp.Case: Here we present a case of a 9-year-old immunocompetent child presenting with abdominal pain and distension of 1-month duration followed by swelling of bilateral lower limbs, which was gradual in onset. Ultrasonography of the abdomen and pelvis was done which revealed a pelvic mass on the left side. The child developed acute urinary retention during the hospital stay, which was evaluated to reveal a fistulous connection between urethra and rectum for which transverse colostomy was done. The USG-guided biopsy of the left pelvic mass showed broad aseptate hyphae in Hematoxylin and Eosine staining whereas the KOH mount and culture were negative. The follow-up imaging with CT showed circumferential thickening of the recto-sigmoid region and involvement of the posterior bladder wall. Considering the rapidity of the spread of the infection, injection liposomal Amphotericin B at the dose of 5 mg/kg/d, i.v. was started and given for one week with minimal improvement. However, with this clinical picture and patient profile the diagnosis was strongly suspected to be of Basidiobolomycosis of rectosigmoid region. Treatment also was revised to injection of voriconazole at a dose 8 mg/kg/d, i.v. after loading dose which was later shifted to oral dose after 7 days. A repeat USG-guided biopsy was planned for gene sequencing, which identified the organism as Rhizopus arrhizus. On follow-up, patient showed no clinico-radiological improvement and in view of the mycological evidence, the anti-fungal was changed from voriconazole after 2 weeks to oral isavuconazole at the dose of 200 mg/d following the loading after which significant improvement was achieved and patient was discharged.ConclusionMold infection in the form of spreading rectosigmoid mass in an immunocompetent child usually suggests the picture of Basidiobolomycosis. Treating patients only on clinical grounds without mycological confirmation may lead to overlooking of Mucormycosis and may result in adverse outcomes. The diagnosis of Mucormycosis should always be considered as a differential for a fungal infection in the form of mass lesion in abdomen.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P217
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P219 Fungal keratitis caused by Pseudallescheria boydii: Clinical and
           mycological characteristics

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesPseudallescheria boydii keratitis is rare but important type of fungal keratitis because of the inherently resistance of the organism to many existing antifungal agents. We present the clinical characteristics, risk factors, treatment, and prognosis of patients with P. boydii keratitis, and also present the antifungal sensitivities of the isolated strain.MethodsSlit-lamp and confocal microscopy were used for clinical examinations. Fungal isolates were identified based on morphological characteristics and DNA sequence of the internal transcribed spacer region (ITS). In vitro antifungal susceptibility testing for fungal isolates was performed according to the Clinical and Laboratory Standards Institute (CLSI).ResultsPseudallescheria boydii was identified in four patients. All patients had a history of ocular trauma. In clinical examination hypopyon was seen in three patients. The main antifungal medications were oral and topical voriconazole. After treatment the visual activity of all patients improved in 2-3 weeks.ConclusionThese patients bold the importance of determining causative organism of fungal keratitis and their antibiotic susceptibility. Culture findings are limited in identifying organisms. Sequencing of polymerase chain reaction-amplified DNA is good for accurate and rapid identification of species that can be helpful for optimizing treatment.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P219
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P221 Deep dermatophytosis presented as multiple exophytic masses caused by
           Trichophyton rubrum in immunocompromised patient with rheumatoid
           arthritis; a case report

    • Abstract: AbstractPoster session 2, September 22, 2022, 12:30 PM - 1:30 PMDermatophyte invades the stratum corneum and infects the skin, nails, and hair, mostly resulting in superficial infection. Deep dermatophytosis involving dermis and subcutaneous layer was rarely reported in immunocompromised state. Herein, we report a case with deep dermatophytosis caused by Trichophyton (T.) rubrum. A 71-year-old woman presented with multiple erythematous exophytic and subcutaneous nodules located on both lower legs. She was taking immunosuppressive agents for rheumatoid arthritis and had taken antifungal agents for tinea pedis and onychomycosis, which was improperly ceased. Histopathologic examination revealed pseudoepitheliomatous epidermal hyperplasia with microabscess formation in epidermis and diffuse granulomatous inflammation consisting of multinucleated giant cells, lymphocytes, neutrophils, and histiocytes in dermis. Imuunohistochemical staining with periodic acid-schiff (PAS) and Gomori methenamine silver (GMS) showed septate and branched fungal hyphae in dermis. Trichophyton rubrum was identified in fungal culture with tissue and confirmed through phylogenetic analysis of internal transcribed spacer (ITS) and large subunit regions (LSU) in ribosomal RNA. Prior to identification of causative organism, her condition deteriorated into septic shock. Amphotericin B was administered empirically for 6 days in order to prevent hematogenous dissemination and skin lesions were simultaneously resolved. Since deep dermatophytosis appears in various clinical manifestations, it is easy to be mistaken for another disease. If treatment is delayed, immunocompetent patients can progress to severe disease courses like hematogenous dissemination, so clinicians should differentiate this disease and conduct treatment at an appropriate time.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P221
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P259 Rare presentations of Cryptococcosis: a case series

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesCryptococcus spp. is usually opportunistic pathogens affecting immunocompromised individuals causing meningitis primarily. Non-CNS presentations are a rare entity and we hereby present a series of 3 cases in the past 1 year (2021-2022).MethodsCase records of the three patients were studied. Detailed history, demographic details, investigations, treatment were noted.ResultsPatient-1 was a 14-year-old girl who came with complaints of fever, pain, swelling, and restricted movements of the right wrist, elbow, and ankle joints with multiple subcutaneous swellings initially on the thigh followed by elbows, arms, and forearms. The swellings became hemorrhagic bullae bursting to form ulcers. She had a history of being treated 4 times for tuberculous lymphadenopathy. KOH-Calcofluor white mount of biopsy and pus aspirate samples showed circular yeast cells which were confirmed by cryptococcal antigen detection. All the samples had grown Cryptococcus neoformans on culture except blood, BAL, and CSF. She responded to Liposomal amphotericin-B drastically. Retesting of pus swabs from the ulcers after a week of antifungal therapy were negative for C. neoformans. Subcutaneous nodules and joint swellings decreased but she developed reactions to amphotericin B and was changed to fluconazole. She is on regular follow-up with no recurrence.Patient-2 was a 22-year-old male, a known case of Hodgkin Lymphoma stage 4 who underwent Autologous stem cell transplantation (ASCT) and was on immunosuppressants. He presented with fever, dyspnea, and cough which got worsened along with multiple cervical, hilar and abdominal lymphadenopathy. KOH-Calcofluor white mount of biopsy samples demonstrated circular yeast cells which were confirmed by cryptococcal antigen detection test of biopsy and BAL samples. Cryptococcus neoformans was grown on culture from all the samples. He succumbed to ARDS and cardiorespiratory arrest before any treatment could be initiated.Patient-3 was a 38-year-old female, known case of SLE with lupus nephritis, presented with intermittent fever, dyspnea, chest pain, decreased urinary output, and gradual swelling of the body starting from the face and progressing to the whole body. She further developed synpneumonic effusion, multiple erythematous tender papules over the right thigh, and cellulitis of the right lower limb. She was started on voriconazole in view of HRCT findings suggestive of fungal pneumonia. As galactomannan antigen test was negative, voriconazole was stopped. Pleural tap fluid flagged positive in Bactec and C. neoformans grown on subculture. Her condition worsened with septic shock and succumbed to the disease before any treatment could be initiated.ConclusionSubcutaneous, joint, and pulmonary involvement is rare, without a primary focus on the central nervous system. Culture and antigen detection can aid in early detection and hence early initiation of therapy.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P259
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P260 Sporotrichosis hyperendemic in Southern Brazil: twelve years of
           challenges

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMFeline and zoonotic sporotrichosis has been described since the 1990s in the Rio Grande do Sul state (RS), southern Brazil. In reported cases, this region has the second-highest number of cases proven due to Sporothrix brasiliensis in the country.Objective: We update the current situation of sporotrichosis in Southern Brazil and report measures taken to face the epidemiological threat of zoonotic sporotrichosis over 12 years.MethodsActivities developed by the Laboratory of Mycology of the Universidade Federal do Rio Grande (LabMyco/FURG) and their results are described. Database from the LabMyco/FURG was consulted and all cases of proven sporotrichosis (required fungal isolation in culture) from humans and animals (cats and dogs) diagnosed between January 2010 and March 2022 were included.ResultsDuring the 12 years of the study, four educational events to discuss the regional emergence of sporotrichosis were promoted (in the years 2011, 2013, 2017, and 2018). Before these meetings, health professionals were interviewed, and approximately half were unfamiliar with the regional hyperendemicity, etiological agent, source of infection, and/or the main clinical presentation of sporotrichosis. With these events, a total of 144 health professionals were instructed to diagnose and treat the disease. Additionally, in 2017, along with the municipal health system, we implemented a public specialized reference service (SRS) at the University Hospital (UH) of FURG/Empresa brasileira de serviços hospitalares (EBSERH) to treat human sporotrichosis cases. The diagnosis of sporotrichosis was confirmed in 47 patients referred to UH-FURG/EBSERH. All were clinically evaluated by periodic follow-up until clinical cure and received free antifungal treatment by the Brazilian System of Health. A positive impact of the SRS was demonstrated by the decrease of 235% in the interval between the beginning of the lesions and diagnosis (before SRS, mean of 206 days versus after SRS implementation, 79.5 days). Since the start of sporotrichosis diagnosis by LAbMyco/FURG, January 2010-March 2022, 914 cases of proven sporotrichosis were diagnosed by fungal culture: 721 in cats, 135 in humans, and 58 in dogs.ConclusionIn a region with >500 000 inhabitants, 914 cases of sporotrichosis were diagnosed in the last 12 years. Since all of these cases are from just a single laboratory service, we believe this number is underestimated, and the threat even greater. Although some improvements regarding the diagnosis and treatment of this mycosis in our region could be achieved by the educational activities and the implementation of SRS, the numbers are still alarming and there are several obstacles that urgently need attention. Our region has the second most important port of the country, thus, more efforts, with public health politics directed to the treatment of cats with sporotrichosis, are urgently needed to control the spread and fungal dissemination not just to local and regional populations, but also to other countries.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P260
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P261 Candida species in the bloodstream of patients from a tertiary
           hospital in southern Brazil

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMCandidemia in hospitalized patients, especially those admitted to intensive care units (ICUs), is responsible for prolonged periods of hospitalization and antifungal therapy, resulting in higher hospital costs and in high mortality rates. The knowledge of the local prevalence of Candida species in the bloodstream and its susceptibility profile is necessary for appropriate therapeutic and surveillance interventions.ObjectivesThis study aims to evaluate the prevalence of candidemia in a tertiary hospital in southern Brazil over a period of around one and a half years, its etiology, and the susceptibility profile of the isolates to antifungal drugs.MethodsA retrospective study was carried out at the University Hospital of Rio Grande (HU-FURG/EBSERH), which has 218 beds. All cases of candidemia, diagnosed by the isolation of yeasts in blood cultures (automated culture system—Bactec®) between January 2021 and April 2022, were included. Databases were analyzed to collect data regarding the total of blood cultures examined in the same period, as well as the etiology and its susceptibility profile to fluconazole (FLU) and amphotericin B desoxicolate (AMB) (microdilution assay according to M27-A3, CLSI).ResultsDuring the sixteen months of the study, 368 patients were examined by blood cultures in our hospital, being 216 from ICUs (n = 101 adult; n = 115 neonatal/pediatric). A total of 21 were diagnosed with candidemia, resulting in a prevalence rate of 5.7%. The majority of the candidemia cases (66.6% - 14/21) occurred in ICUs, including pediatric/neonatal ICU (6/115; 5.2%) and adult ICU (8/101; 7.9%). C. albicans was associated with 52.3% of the cases (n = 11). Among the non-albicans species (n = 10), four were identified through MALDI-TOF (C. parapsilosis: n = 3; C. krusei: n = 1). Antifungal susceptibility showed that 62.5% of the non-albicans isolates tested (6/8) were resistant to FLU or AMB.Conclusions: Candida species are important pathogens associated with sepsis in our hospital, corresponding to around 5% of the bloodstream infections in patients hospitalized, independently of their unit of origin. These data raise awareness of the need for early diagnosis, surveillance of resistance and prevention of this bloodstream infection to optimize the treatment, and promote a better prognosis for critical patients.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P261
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P262 Clinico- microbiological profile of post-COVID pulmonary fungal
           infections encountered during the second wave of COVID-19 pandemic at a
           tertiary care teaching hospital in the Himalayas

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveThe study aims to generate preliminary data about post-COVID pulmonary fungal infections in the Himalayas and analyze patients’ micro-radio-clinical profiles and outcomes.MethodologyWe conducted a retrospective study at a tertiary care teaching hospital in the Himalayas to generate preliminary post-COVID pulmonary fungal infection data. Sputum, Endotracheal Tube (ET), and Bronchoalveolar lavage (BAL) samples of patients sent to the Mycology laboratory were subjected to KOH mount and aerobic inoculation on Sabouraud dextrose agar plates at 37°C. The patients’ symptoms, diagnosis, clinical-radiological profile, and outcome were collected from the hospital database.ResultsAmong n = 16 cases of post-COVID pulmonary fungal infections aged 53 +/- 13.38 years, n = 7 (43.75%) had Pulmonary Aspergillosis (n = 5 A. fumigatus, n = 1 A. flavus, n = 1 A. niger), n = 5 (31.25%) had Pulmonary Mucormycosis (Rhizopus arrhizus), and n = 4 (25%) had mixed infection. In 2 of 4 mixed infection patients, R. arrhizus was identified on KOH microscopy and A. fumigatus on SDA Agar. Both A. fumigatus and R. arrhizus were identified on KOH Microscopy of the third patient, while only A. fumigatus was cultivated on his SDA Agar. Aspergillus flavus and R. arrhizus were isolated simultaneously from the sample of the last patient, but only R. arrhizus was identified on KOH Microscopy.Clinical symptoms were similar among Pulmonary Aspergillosis and Mucormycosis patients, but hemoptysis was reported only among Pulmonary Aspergillosis patients. Pre-existing co-morbid end-organ damage, AKI, CKD, CLD, COPD, and CAD was more common among Pulmonary Mucormycosis patients and rare among Pulmonary Aspergillosis patients. Treatment requirements and clinical outcomes of patients infected with either mold were similar. The clinical profile of mixed infection patients was notably different from the others. All the patients were males, none complained of chest pain or expectoration, and none had a history of PTB, AKI, CKD, CLD, COPD, or CAD. Only 2 (50%) mixed infection patients needed supplemental high flow oxygen, unlike all (100%) patients diagnosed with single mold infection. None of the mixed infection patients required steroids. Moreover, none of the mixed infection patients died, unlike 60% mortality in cases of single-species infections.On radiological investigation, n = 6 had typical thick-walled cavitary lesions with air-fluid levels and multiple centrilobular nodules giving a tree in bud appearance, of which n = 4 had bilateral lung involvement, and n = 2 had only one lung involved. n = 1 patient had a well-circumscribed lung abscess.ConclusionCOVID patients from the Himalayas had a higher prevalence of invasive pulmonary fungal infections, probably due to the dense surrounding vegetation. The immuno-compromised state following COVID-19 infection/treatment might be responsible for the progression of regular exposure to invasive pulmonary infection.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P262
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P263 Invasive Pulmonary Aspergillosis (IPA) Among Non-Intubated COVID-19
           Patients—a New Age Fungal Storm

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionCOVID-19 patients are at higher risk for the development of secondary infections, especially fungal due to multiple risk factors associated with COVID illness and its management. COVID-associated pulmonary aspergillosis (CAPA) is a new clinical entity that is contributing to high morbidity and mortality among immunocompetent COVID-19 patients. Lack of adequate published literature, absence of typical host factors, and lack of specific diagnostic criteria and management algorithms add to the difficulty in early diagnosis and treatment initiation. The scant available data is on CAPA among intubated patients, however, there are no data on CAPA in non-intubated COVID-19 patients.ObjectiveThe aim of our study was to assess the occurrence of IPA among non-intubated COVID-19 patients and its correlation with their demographic profile, risk factors, morbidity, and outcome.MethodsThis observational study included 24 non-intubated CAPA patients and 72 controls (1:3 randomly selected age and sex matched) at our hospital between April-June 2021. CAPA cases were defined as per modified-AspICU criteria. Demographic characteristics, risk factors, treatment, factors contributing to morbidity, and outcomes were evaluated. Descriptive statistics were reported as mean ± SD, median, number, and percentages. The proportion of CAPA was reported as frequencies and percentages. Clinical characteristics were compared between CAPA and control using Chi-squared, independent t-test and Mann-Whitney U test as appropriate. Association of CAPA with mortality was performed using Fisher's exact test. Logistic regression was performed to assess the factors associated with CAPA. P-value ˂5% was considered statistically significant. All analyses were performed using SPSS 25.0.ResultsA total of 4058 COVID patients were admitted during the study period. Respiratory samples of 26 patients yielded Aspergillus species. Two patients were excluded as colonizers based on modified AspICU criteria. In all, 24 CAPA cases 72 controls were studied for all the variables. CAPA occurrence was 0.59% among non-intubated COVID-19 patients (24/4058).Both the groups had a male preponderance (75% CAPA, 80% control), the median age was 52.8 ± 14.3. Demographic data and risk factors were comparable. There were no significant differences in lab parameters between the groups. Association of COVID severity and development of CAPA was not statistically significant (mod:OR 2.25, 95% CI, P-value .48; severe:OR 6.65, 95% CI, P-value .08). Significant associations between the cases and controls included, treatment with a higher dose and longer duration of steroids with development of CAPA (dose:OR 1.009, 95% CI, P-value .002; duration:OR 1.09, 95% CI, P-value .006), longer hospital stay (median of 18.4±10days (P-value .008). All-cause mortality was 16.7% in CAPA group (P-value <.0001).Between CAPA non-survivors and survivors, Serum galactomannan levels (P-value .03), duration of hospital stay (P-value .042), dose and duration of systemic corticosteroid (P-value .001), and duration of oxygen requirement (P-value .05) were found to be statistically significant.ConclusionCAPA is an emerging complication with high morbidity and mortality among immunocompetent COVID-19 patients that requires a high index of clinical suspicion. A standard diagnostic criteria and management protocol for early identification and treatment initiation is the need of the hour. Role of steroids in the development of CAPA and the role of galactomannan in diagnosis and prognosis of CAPA needs to be further investigated.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P263
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P264 Brain phaeohyphomycosis secondary to immunosuppressant therapy due to
           Rhinocladiella mackenziei

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMTwo cases of Rhinocladiella mackenziei have been noted in our institute, the first case in 2015 (post-renal transplant) and the second case in 2021 (post-COVID infection). Both the patients had received immunosuppressants for varying duration. Both the cases presented to the hospital with neurological deficit secondary to brain abscess. On initial assessment, the melanized fungus was noted which was later identified as Rhinocladiella on culture and further confirmed with molecular methods. Both the cases were treated with injection of L AmB, voriconazole and 5FC for a prolonged duration and later discharged when the condition improved. The renal transplant patient was advised lifelong voriconazole since he would continue to be on immunosuppressants. To our knowledge, the second patient diagnosed post-COVID could be the first case report of invasive dematiaceous fungal infection in an apparently immunocompetent individual. Both cases also highlight the challenges in management such as designing an appropriate regimen, deciding the optimum duration of antifungal therapy, and managing the toxicities associated with long-term antifungal use. R. mackenziei is a frequently fatal melanized neurotropic fungus known to carry almost 100% mortality despite the combination of antifungal agents and surgery. Central nervous system infections due to R. mackenziei have been exclusively reported from the Middle East, except for cases recently reported from India.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P264
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P265 Phaeohyphomycosis caused by Rhinocladiella similis mimicking
           Sporotrichosis

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjective: A case of phaeophyphomycosis caused by Rhinocladiella similis with a clinical picture simulating sporotrichosis is described.MethodsA 34-year-old male patient, employed in a textile factory presented with multiple subcutaneous nodules on the lateral aspect of the dorsum of the left hand and left forearm. There was a history of mechanical trauma 1 year back. On examination, three to four verrucous ulcerative nodules clustered on the dorsum of the left hand were observed. A preliminary diagnosis of sporotrichosis was made and a punch biopsy was performed from the lesion and subjected to KOH examination, fungal culture, and histopathological examination. ITS sequencing was done to confirm the identity of the isolate.ResultsThe skin punch biopsy from the lesion on the dorsum of the hand showed marked hyperkeratosis, papillomatosis, parakeratosis, acanthosis, and irregular elongation of rete ridges. No fungal structures and neutrophils were seen. On examination with 40% Potassium hydroxide round yeast-like cells were seen. An initial diagnosis of sporotrichosis was established. After 5 days, white to grayish colonies with aerial hyphae were observed on Sabouraud's dextrose agar which eventually turned greenish black on further incubation. Lactophenol cotton blue (LPCB) mount of the slide culture showed thin, hyaline, septate hyphae with oval conidia arranged in a bottle brush pattern around erect conidiophores and also directly arising from the hyphae. The pathogen was confirmed by ITS sequencing as R. similis. Patient was started on itraconazole 200 mg twice daily for 12 weeks. The patient is on regular follow-up and has shown gradual regression of the lesions indicating response to therapy.ConclusionRhinocladiella similis infections have been reported chiefly from Brazil causing chromoblastomycosis. There have been no reports of infections due to this pathogen from the Indian subcontinent. This report presents the first case of R. similis as an agent of phaeohyphomycosis and calls for the need of a thorough evaluation of these cases so as to manage cases appropriately. It also underlines the need to study and redefine the ecological niche of this pathogen as well as its clinical spectrum.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P265
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P266 A case of mixed fungal infection causing invasive fungal
           Rhinosinusitis in a post-COVID patient

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo identify the fungal etiology of invasive nasal sinusitis in a patient of post-COVID.MethodsA 34-year-old non-diabetic man, who had mild coronavirus disease (COVID) infection 2 months back presented with left-sided nasal obstruction, headache accompanied by malodorous, thick, mucopurulent discharge for the last 2 weeks.A CT scan of sinuses revealed opacification of left posterior ethmoid and sphenoid sinus without bony erosion or calcification.The patient underwent unilateral functional endoscopic sinus surgery (FESS) and debridement of tissue from the affected sinuses.ResultsA KOH preparation of the debrided tissue showed thin septate hyphae. Gram-stained smear of the debrided material showed thin septate fungal hyphae with clamp-like connections (Fig. 1). Histopathological examination revealed features of the inflammatory polyp. In Sabouraud dextrose agar the fungal colony grew fast and its aerial mycelium is white and cotton-like. The fungus was phenotypically identified as Schizophyllum communae (identification was confirmed at the National Reference Centre).He continued to do well but about 2 months later he started experiencing headaches and pain behind the eyes. He also complained of nasal stuffiness (left greater than right) and yellowish nasal discharge. At this point, a CT scan revealed soft tissue density with interspersed hyperdensity in sphenoid sinus bilateral ethmoid, and bilateral maxillary sinuses with associated bony erosion and possible extension into the right cavernous sinus and extrachonal compartment of right orbit suggestive of invasive fungal sinusitis (Fig. 2).Bilateral FESS was done. Extensive fungal material was observed in the sphenoid sinus and thorough debridement was performed.Mycological studies of the debrided tissue showed thin septate hyphae. Schizophyllum communae was again isolated in culture.Histopathological section showed inflammatory cells and several slender, branching septate fungal hyphae.The invasive nature of the infection prompted reexamination of the histopathology slides and cultures for the presence of other fungi particularly of the Mucorales group but no other fungus could be identified.The patient was started on liposomal amphotericin B and the tissue blocks were sent for fungal identification to the National Reference Centre through sequencing following DNA extraction from the paraffin blocks. Amplification of the 18 S rDNA region (coding for the 18 S RNA) using ZM primers followed by sequencing revealed the presence of R. arrhizus.The patient was continued on amphotericin B. The patient was discharged after 2 weeks with oral isuvuconazole. At six months follow up he is doing well with no evidence of active infectionConclusionAs the novel COVID‐19 continues to rampage, an abrupt increase in the number of opportunistic fungal infections has been observed.Invasive and often fatal rhino-cerebral Mucormycosis is now been increasingly reported in patients who have had COVID-19 infection in the recent past. In this case, there was a dual fungal infection causing rhino-sinusitis which was established through conventional culture and PCR assays from paraffinized tissue sections. Increased awareness of the existence of dual mold infections in at-risk patients is necessary for optimum management. PCR methods in tissue sections increase the diagnosis of dual mold infections.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P266
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P406 Rise in HIV negative Cryptococcal infection in liver disease patient:
           epidemiology, risk factor, antifungal susceptibility profile from tertiary
           care hepatobiliary center

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: Cryptococcus neoformans is an encapsulated yeast found ubiquitously in the environment, considered important in immunocompromised individuals with HIV. Non-HIV susceptible groups include malignancies, long-term use of corticosteroids, solid organ transplantation, sarcoidosis, immunosuppressive therapy, and cirrhosis. Cryptococcal infections are rising in HIV-negative cirrhotic patients, accounting for 6-21% of the systemic infections. Chronic liver disease (CLD) is a neglected risk factor for fungal infections. To analyze epidemiology, risk factors, and antifungal susceptibility profile of HIV-negative liver disease patients.Material Methods: The retrospective study was conducted in tertiary care hepatobiliary center in New Delhi, India from January 2017 to March 2022 after ethical approval. Demographic data, laboratory data, and clinical history of the patients admitted with liver disease and suspected cryptococcal infections were obtained from Hospital records for epidemiology and risk factor analysis. Blood, CSF, serum, urine, and body fluid (Ascitic fluid, peritoneal fluid, pleural fluid, MiniBAL) samples were processed for fungal culture on SDA and SDA with cyclohexamide. Blood and body fluid were also inoculated in an automated blood culture system (BacT/ALERT 3D bioMérieux). Samples were processed for gram stain, India ink, and Cryptococcal antigen. Identification was done by an automated identification system (VITEK 2 compact bioMérieux). The micro-broth dilution method (Sensititre YeastOne colorimetric plate, Thermo Fisher Scientific, MA, United States) was used to determine the susceptibility of all Cryptococcus strains to the six antifungal drugs, fluconazole, 5-fluorocytosine, amphotericin B, itraconazole, posaconazole, and voriconazole. The results were reported as wild-type (WT) or non-wild-type (non-WT) in accordance with the epidemiological cutoff value (ECV) set for Cryptococcus spp. (Espinel-Ingroff et al., 2012a, b; CLSI, 2018).ResultsWe analyzed 30 patients of suspected cryptococcal infection and obtained 40 C. neoformans isolates from different samples from these patients. Out of 40 samples, C neoformans was isolated from blood (25,62.5%), urine (6,15%), ascitic fluid (4,10%), mini-BAL (2,5%), bone marrow (1,2.5%), CSF (1,2.5%), pleural fluid (1,2.5%). All samples were positive for Cryptococcal antigen. India ink positivity was observed in 56%. Alcoholic liver disease was the most common risk predictive factor seen in 30% of patients. Hepatitis B and C-associated with CLD was seen in 20%. Other risk predictive factors were AKI (70%), diabetes mellitus (20%), TB (10%), autoimmune hepatitis (6.6%), autoimmune disease (autoimmune hemolytic anemia, Sjogren syndrome) (6.6%), Sarcoidosis (3.3%), Hepatocellular carcinoma (3.3%), HIV (3.3%). Hepatic encephalopathy was seen in 70% of patients which mimics the symptoms of C. meningitis.7.5% (3/40), 5% (2/40), 2.5% (1/40), 7.5% (3/40), and 2.5% (1/40) of C. neoformans strains were non-WT to fluconazole, 5-fluorocytosine, amphotericin B, posaconazole, and itraconazole, respectively, but all strains were WT to voriconazole. Overall mortality was 66.6%.ConclusionAbove study shows that liver diseases are an important risk factor for cryptococcal infection owing to immunosuppressed state, use of steroids, and associated comorbidities like DM, TB, AKI, autoimmune disease, Sarcoidosis, hepatocellular carcinoma. Therefore, it is necessary to investigate and be vigilant about the isolation of Cryptococcus. The use of appropriate antifungals can improve clinical outcomes. As there is increasing resistance to amphotericin B, 5-fluorocytosine, azoles; antifungal susceptibility testing should be done. Cryptococcal antigen detection can be useful in non-CSF samples as well.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P406
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P407 Standardization of PCR for the diagnosis of invasive aspergillosis
           and invasive mucormycosis from blood samples

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectives(1) Standardization of PCR-based diagnosis of invasive aspergillosis and invasive mucormycosis in spiked blood samples. (2) Standardization of PCR-based diagnosis of invasive aspergillosis and invasive mucormycosis in proven cases. (3) Validation of the above-standardized protocol in patients with proven/probable invasive aspergillosis or mucormycosis.Materials and Methods: Blood samples were collected from healthy volunteers and patients with proven mucormycosis, proven invasive aspergillosis, and suspected invasive fungal infection. Standard strains of Mucorales and Aspergillus spp. were collected from the National Culture Collection of Pathogenic Fungi, PGIMER and DNA was extracted using a modified protocol of the fungal DNA extraction method by Lee and Taylor (1990). Mucor-specific primer (ZM13), described by Bialek R et al. (2005) was used for mucormycosis samples. Aspergillus specific primer pair was designed from mitochondrial DNA of A. fumigatus using Primer3 software. Genomic DNA was used to determine the optimum annealing temperature and concentration for ZM13 assay. DNA extracted from whole blood samples of healthy volunteers after spiking with a known quantity of A. fumigatus DNA and only genomic DNA was used separately to optimize annealing temperature and concentration of Aspergillus-specific primers. Similarly, whole blood, plasma, and serum samples from healthy volunteers were spiked with various concentrations of Rhizopus arrhizus and A. fumigatus DNA. DNA extracted from spiked samples was used to determine the analytical sensitivity of PCR assays. DNA extracted from blood samples of ten proven mucormycosis and five invasive aspergillosis patients were used to determine the optimum sample dilution factor and template volume for the assay. The final standardized protocols were validated using 28 proven/probable cases of invasive aspergillosis and invasive mucormycosis and thirty cases of suspected invasive fungal infection.ResultsThe optimum annealing temperature and primer concentrations for the assay were 54.3°C and 0.4μm respectively for ZM13 assay and 53°C and 0.45μm respectively for Aspergillus assay. The limit of detection was 0.06fg/μl for ZM13 assay and 0.08fg/μL for Aspergillus specific assay. For mucormycosis assay, the slope of the standard curve was −3.2687 and the percentage efficiency of the assay was 104% with 0.9936 as the coefficient of determination (R2). Likewise, the slope of the standard curve was −3.2695, the percentage efficiency of the assay 102%, and the coefficient of determination (R2) 0.9858 for aspergillosis assay. The best combination of template volume and sample dilution factor was 2.5 μl and 1000x in whole blood samples and, 2.5 μl and 100x in serum samples for mucormycosis assay. It was 1.0 μl and 10x in serum samples for Aspergillus specific assay. The sensitivity, specificity, positive predictive value, and negative predictive value of mucormycosis qPCR using serum samples were 79.3%, 86.4%, 65.7%, and 92.7% respectively. The assay had a positive likelihood ratio of 5.92 and a negative likelihood ratio of 0.24.ConclusionThe real-time PCR protocols standardized for the diagnosis of mucormycosis and invasive aspergillosis from blood samples showed promising results. However, the assay needs further validation in a larger study population.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P407
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P408 Evaluation of fungal serum biomarkers in the diagnosis and for
           monitoring patients with post tuberculosis chronic pulmonary aspergillosis
           

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesThe evaluation of serum β-D-glucan, galactomannan, and Aspergillus fumigatus specific IgG in the diagnosis and clinical management of patients with chronic pulmonary aspergillosis.MethodsConsecutive patients with a past history of pulmonary tuberculosis (PTB) with clinical suspicion of chronic pulmonary aspergillosis (CPA) attending the outpatient services of PGIMER, Chandigarh were included from August 2019 to August 2021, and CPA was defined as described by Denning et al. including both radiological and mycological evidence. Age and sex-matched post-PTB individuals selected from a population attending the chest clinic were enrolled as controls. Serum samples were obtained from all participants and testing for serum β-D-glucan (Fungitell, CapeCod), galactomannan (Platelia, BioRad) and Aspergillus fumigatus specific IgG (ImmunoCAP, Phadia) was performed as per manufacturer's instructions.ResultsA total of 105 post-TB patients with CPA and 11 controls were enrolled. Aspergillus fumigatus (n = 8) was the most commonly isolated species, followed by A. flavus (n = 4), and A. niger (n = 2). The mean A. fumigatus specific IgG levels, serum galactomannan index and BDG levels were higher among CPA cases vs. controls at 101.4 mgA/l vs. 11.8 mgA/l, P-value: .0001; 0.73 vs. 0.35, P-value: .3134; and 133.7 pg/ml vs. 32.37 pg/ml, P-value: .012, respectively (Figs. 1a, b, c). The serum BDG had an area under curve 0.834 ± 0.044 (95% CI: 0.748-0.920) on the ROC curve with a sensitivity of 57.1% and specificity of 100% at the kit cut-off of 80 pg/ml (Fig. 2a). Comparison between CPA patients with multiple (n = 38) versus single lobe (n = 67) involvement showed comparable A. fumigatus specific IgG levels (112.3 vs. 93.8; P-value: .133 respectively) while galactomannan index and BDG levels were higher in cases with multiple vs. single lobe involvement (0.94 vs. 0.57, P-value: .117), and (174.3 vs. 105.3, P-value: .0071), respectively (Fig. 1d, e, f). There was a significant association of BDG value with the severity of dyspnea (P-value: .002) and a trend of higher A. fumigatus specific IgG was also seen to correlate with the severity of dyspnea (Fig. 2b and 2c).ConclusionBDG assay can serve as an adjunct in the diagnosis of patients with CPA. An association of higher levels of BDG with multiple lobe involvement and severe dyspnea could be due to more extensive tissue damage associated with a greater release of antigen in circulation during progressive disease. More studies with a larger number of control samples, preferably with multi-center coordination can further improve our understanding of this test's applicability in routine practice.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P408
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P409 Study of epidemiology, risk factors and antifungal sensitivity
           pattern of fungal pneumonia in critically ill cirrhotics

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesLiver cirrhosis causes immune dysregulation and increased susceptibility to fungal infections. We studied the epidemiology and risk factors, and compared the rapid diagnostic methods and biomarkers for fungal pneumonia in critically ill cirrhotics.MethodsSingle-center, prospective cohort study of 100 critically ill cirrhotics with fungal pneumonia between January to September 2021. Comparative analysis was done for culture, realtime PCR and biomarkers, bronchoalveolar lavage and serum Galactomannan, and serum procalcitonin measured on days 1, 3, and 7. The final outcome considered was mortality within 1 month after diagnosis or discharge.ResultsAspergillus flavus was the most common species (70/100,70%). Risk factors were, neutropenia (P .03), steroids prior to ICU admission (P .02), prolonged hospitalizations ˃21 days (P .05), and culture positivity was 80%. The culture was not inferior to realtime PCR for the diagnosis of fungal pneumonia. BAL Galactomannan was an early prognostic marker with a median rise above ˃ 3.5 index value. The Median PCT level was higher from day 1in the fungal pneumonia non-survivor group (3.29 vs. 0.8 ng/ml) with higher 30-day mortality (72%). Higher PCT was associated with bacterial co-infection (48%), antibiotic (74%), antifungal therapy, and renal failure and mortality.ConclusionFungal pneumonia complicates cirrhotics with neutropenia, prolonged hospitalization, and steroids as risk factors. Aspergillus flavus predominate in consensus with Asian epidemiology. Culture methods are reliable and a combination of molecular tests with BAL Galactomannan is useful for rapid diagnosis. Serum PCT is raised in patients with fungal pneumonia and is associated with higher mortality. In our study the baseline PCT at admission to ICU was higher in the non-survivor group, and levels on D3 and D7 were persistently higher. High serum procalcitonin level is an independent prognostic biomarker of mortality risk in fungal pneumonia.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P409
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P410 Aspergillus fumigatus sensitization among the patients with chronic
           obstructive pulmonary disease (COPD)— a cross sectional study

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesAllergic bronchopulmonary aspergillosis (ABPA) caused by hypersensitivity to A. fumigatus complicates the course of asthma. Fungal sensitization due to A. fumigatus among asthmatic patients and their progression to ABPA is well studied. Similar data on Aspergillus sensitization among patients with COPD and their progression are still not well established. The objective of this study was to evaluate the Total serum IgE (TIgE) and A. fumigatus specific IgE (Af sp IgE) levels among patients with COPD.Method: A total of 100 stable patients with COPD above 40 years of age from the Department of Pulmonary Medicine were included. TIgE and Af sp IgE levels were detected using VIDAS total IgE assay and M3 ImmunoCap with Phadia 100 respectively. The subjects were grouped into three (TIgE <500 IU/l, 500-1000 IU/l, and >1000 IU/l) based on the TIgE values. They were also categorized based on Af sp IgE levels as sensitization likely (AS ≥0.35 kUA/l), sensitization indeterminate (AI 0.1-0.35 kUA/l), and sensitization unlikely (AU ≤0.1 kUA/l). This categorization was based on the kit manufacturer's guidelines that sensitization is unlikely with specific IgE <0.1 kUA/l and the proposed ISHAM ABPA working group criteria of >0.35 kUA/l for diagnosis of sensitization. A comparison of Asf sp IgE with TIgE was done using the Fischer exact test.Result: Among 100 patients, the prevalence of elevated TIgE [>150 IU/l (kit cutoff)] and Aspergillus sensitization [Af Sp IgE >0.35kUA/l (ISHAM cutoff)] was 47% and 6%, respectively. A total of 5% of subjects satisfied the criteria for serological ABPA. The results of the comparison of Asf sp IgE with total IgE using the Fischer exact test are given in Table 1.AS category: TIgE was >1000 IU/l in 5 (83.3%) of the 6 subjects. One (16.7%) had between 500-1000 IU/l. None of them had TIgE <500IU/l. Aspergillus sensitization was higher in 3/5 subjects with TIgE >1000 IU/ml (Asf sp IgE values of 2.55KUA/l, 12KUA/l, 14KUA/l, 0.38KUA/l, and 0.45KUA/l) compared with the one subject with TIgE <1000IU/l (Asf sp IgE of 0.73KUA/l). The clinical characteristics of subjects in the AS category is given in Table 2.AI category: A total of 7 (50%) of the 14 subjects had the TIgE value >1000 IU/l, 5 (35.7%) had the TIgE between 500-1000 IU/l, and 2 subjects had the TIgE <500 IU/l.AU category: In all, 1 (1.25%) had the TIgE value >1000 IU/l, 5 (6.25%) had the TIgE between 500-1000 IU/l. TIgE was <500 IU/l in 74 (92.5%) subjects.ConclusionThe study results suggest the co-existence of COPD and Aspergillus sensitization/ABPA. Patients in the AI group (Af sp IgE level 0.1-0.35 kUA/l) must be evaluated and monitored to prevent the progression of the disease. Studies involving a larger patient population are warranted.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P410
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P411 Genus specific real-time PCR-a promising technique for rapid
           diagnosis of fungal keratitis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: Comparison of different existing molecular methods for diagnosis of fungal keratitis (FK) and to develop and validate genus-specific PCR for identification of most predominant FK causative agents.Method: A prospective multicentric study was performed between November 2019 to August 2021 from four centers across India. Corneal tissue/scraping samples were collected from patients with suspected keratitis for preliminary microbiological workup at respective centers and molecular diagnosis at the Postgraduate Institute of Medical Education and Research (PGIMER), Chandigarh. A total of 87 corneal button samples were used for standardization. All samples were subjected to DNA extraction followed by molecular diagnosis using pan-fungal primers by conventional PCR, semi-nested PCR, and real-time PCR targeting the internal transcribed spacer (ITS) region of rDNA. The genus-specific primers for the most common causative agents of FK (Aspergillus sp., Fusarium sp., Alternaria sp., and Curvularia sp.) were designed in ITS2 region and standardized for real-time PCR. The best performing protocol was validated in 145 corneal samples.Result: A total of 68 patients out of 87 were diagnosed with FK of which 91.17% (n = 62/68) were microscopy positive and 82.3% (n = 56/68) were culture positive. Among the culture positive, the most common isolate was Aspergillus sp. (26, 46.42%) followed by Fusarium sp. (21, 37.5%) while the remaining samples grew dematiaceous fungi. Real-time PCR targeting ITS2 region proved to be most sensitive (52.94%) and specific (84.21%) compared with conventional PCR and semi-nested PCR. Genus-specific real-time PCR for Aspergillus sp. and Fusarium sp. showed improved sensitivity and specificity of 82.76%, 87.18%, and 90.91%, 93.48% respectively compared with all other diagnostic methods used in the study. The positive (PPV) and negative predictive value (NPV) for Aspergillus sp. specific PCR were 82.76% and 87.18% while Fusarium sp. specific PCR showed PPV of 86.96% and NPV of 95.56%. Genus-specific real-time PCRs did not show any amplification of 19 FK negative samples while faint amplification was observed in conventional PCR which on sequencing proved to be non-specific. No cross-reactivity was observed in clinical sample standardization. Due to the lack of Alternaria sp. and Curvularia sp. positive clinical samples, both PCRs were standardized using respective culture DNA which showed a positive result. Aspergillus sp. and Fusarium sp. genus-specific PCRs were further validated in 145 corneal samples, of which 91 were FK positive and showed similar results as that of standardization data. Genus-specific PCRs also reduced the turnaround time (˂24 h) by decreasing the need for the identification of causative agents.ConclusionReal-time PCR targeting ITS 2-region, particularly the genus-specific PCRs proved to be the most efficient for molecular diagnosis of FK. The genus-specific PCRs reduce the turnaround time by avoiding the need for sequencing and thus facilitating in rapid diagnosis of FK.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P411
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P412 QuicGM Aspergillus Galactomannan Ag lateral flow assay as a practical
           aid to diagnose invasive Aspergillosis in high-risk hematology patients

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground: Early diagnosis of invasive aspergillosis (IA) is an important factor to improve survival, but it remains challenging. QuicGM Aspergillus Galactomannan Ag Lateral Flow Assay (LFA) is based on a fluorescence immunochromatography test using a monoclonal antibody to identify Aspergillus galactomannan antigen in serum and bronchoalveolar lavage fluid.MethodsIn this study, we analyzed the diagnostic performance of QuicGM in 120 serum samples of high-risk hematology patients [41 cases of proven (n = 4) and probable (n = 37) IA and 79 equally high-risk controls] and compared it to performance of the galactomannan (GM) [Platelia Aspergillus enzyme immunoassay (ELISA) (Bio-Rad, Marnes-la-Coquette, France)]. Probable cases defined by a positive Biorad GM in serum were also included in the cohort.ResultsUsing the same cut-off of 0.5, QuicGM was positive in 22 cases versus GM in 21 cases. However, QuicGM was false positive in 11 controls with GM only in 1 control. These false positive samples remained positive upon repeated testing with the QuicGM. The test results of QuicGM and GM correlated well with a Spearman's correlation coefficient of 0.80 (P <.001). McNemar test showed no significant difference between both tests (P = 1) and Cohen's kappa coefficient was 0.65 (CI 0.49-0.81), suggesting a substantial strength of agreement.QuicGM sensitivity (using 0.5 cutoff) was 54% versus 51% for GM. Specificity was 86% for QuicGM versus 99% for GM. Positive predictive value (PPV) was only 67% for QuicGM versus 95% for GM. Combining GM and QuicGM in serum increased sensitivity to 59%. Youden index of QuicGM in the cohort was 0.39. Using this cutoff, sensitivity was 66% and specificity was 80%. When using a higher cutoff of 0.6 for the QuicGM, specificity increased to 94% and PPV to 78%, at the cost of a decrease in sensitivity to 44%.Discussion: Including probable cases defined by a positive Biorad GM in serum could have led to a bias in favor of the GM.With the cutoff suggested by the company, there was a notable decrease in specificity and PPV for the QuicGM. The need to adjust this cut-off must be questioned. With the implementation of LFAs in the EORTC-MSGERG criteria, one usually strives for the same cutoff of 0.5, to assure a practical approach. However, we must remain thoughtful about slight differences in these tests. They all have their own IgG and IgM built. Caution is needed more in the setting of diagnosis than in screening.More knowledge must be obtained regarding how different hospital laboratories have implemented the LFAs.ConclusionDiagnostic performances of QuicGM and Biorad GM correlate well.Further research is necessary regarding the optimal cutoff index.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P412
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P413 Screening and diagnosis of Candidemia in adult hematological
           malignancies of northern India

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMCandidemia is caused by Candida species which has become a common cause of fungal infection in the bloodstream infection throughout the world. In hematological malignancies, patients have a high rate of morbidity and mortality due to Candidemia.Aim: To identify Candidemia in immunocompromised patients with the help of various conventional methods as well as automated methods for early detection and treatment.Material and Methods: This study was conducted from 2018 to 2021. In this study, we enrolled immunocompromised patients with hematological malignancies. For early diagnosis of Candidemia we did conventional method as well as PCR. Compare the conventional, automated, and PCR methods for diagnosis of Candidemia and was performed antifungal susceptibility testing for treatment in hematological patients.ResultsTotal 187 patients were enrolled on the basis of febrile neutropenia. A total of 125/187 males (66.8%) and 62/187 females (33.2%) participated in the present study followed by age range from 10 to 77 years (mean = 33.16, standard deviation = 16.29). A total of 5 patients (2.6%) were positive from blood culture, and 9 patients (4.8%) were positive from PCR. In 4 patients of AML C. tropicalis was (3; 1.60%) and C. auris (1; 0.5%) followed by 1 patient with pancytopenia C. tropicalis (1; 0.5%). The sensitivity was done according to the Clinical Laboratory Standards Institute (CLSI) guideline M27-A3 reference document for C. tropicalis (4), and C. auris (1). A total of 4 isolates of C. tropicalis were sensitive to drug VRC (MIC range 0.125 μg/ml), AMP (MIC range 1 μg/ml), FLU (MIC range 1 μg/ml), CAS (MIC range 0.25 μg/ml) and 1 resistant pattern toward FLU (MIC range 4 μg/ml). Candida auris was resistant toward AMP (MIC range 2 μg/ml), FLU (MIC range 64 μg/ml), and sensitive toward CAS (MIC range 0.5 μg/mL). A total of 4 isolates of C. tropicalis was sensitive for drug VRC (80%), AMP (80%), FLU (60%), CAS (80%), and resistant pattern for FLU (20%). Candida auris was resistant toward AMP (20%), FLU (20%), and sensitive toward CAS (20%). In all, 9/187 patients’ blood was positive for fungal infection, primer NL-1 and NL-4 were able to amplify the D1/D2 region of 28S r-DNA of large ribosomal subunit which target rDNA yielding Product of PCR give 600 bp related to all fungus. Primer P4501 and P4502 identify the P-450 lanosterol 14α-demethylase gene which is target Candida species genes single band of around 350 bp. Mannan antigen of Candida was performed by ELISA method for diagnosis of candidemia in hematological patients.ConclusionThis present observational study recognizes the main association of Candidemia with hematological malignancies. We try to develop PCR and automated methods in routine mycology laboratory to diagnose Candidemia in an early stage in hematological malignancies along with other immunocompromised patients for better treatment to cure the disease.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P413
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P059 The overexpression of efflux pump gene cdr1B resulting in
           voriconazole- and isavuconazole- resistance in Aspergillus fumigatus
           recovered from a patient with chronic pulmonary aspergillosis in China

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTriazole resistance in the pathogenic Aspergillus fumigatus has been increasing worldwide, posing a growing therapeutic challenge. To date, triazole resistance in clinical isolates of A. fumigatus causing pulmonary aspergillosis has been mainly attributed to the mutations in the cyp51A gene or its promoter, followed by mutations in cyp51B and hmg1 gene encoding 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase. From chronic pulmonary aspergillosis (CPA) patient, we isolated a strain of A. fumigatus (BMU10672) with resistance to voriconazole (VRC) and isavuconazole (ISZ), which was caused by overexpression of efflux pump Cdr1B.MethodsAntifungal susceptibility testing of the isolate of A. fumigatus BMU10672 was performed using the broth microdilution method (CLSI M38-A3), E-test and disk diffusion method. The promoter region and open reading frame of the cyp51A, cyp51B, and hmg1 gene were amplified and sequenced. Then, the expression levels of cyp51A, cyp51B, and efflux pump gene cdr1B with or without being exposed to VRC or ISZ were quantified using real-time PCR, compared with triazole-susceptible A. fumigatus Af293. And the function of efflux pump Cdr1B was tested by efflux pump substrate (Nile red) accumulation assay and efflux pump inhibitor (FK520) assay.ResultsThe minimum inhibitory concentration (MIC) of itraconazole (ITC), VRC, posaconazole (POS), ISZ and amphotericin B (AMB), and the minimal effective concentration (MEC) of caspofungin (CAS) against A. fumigatus BMU10672 was 1 μg/ml, 2 μg/mL, 0.5 μg/mL, 2 μg/mL, 1 μg/mL and 0.125 μg/mL, respectively. The results of E-test and disk diffusion assay were consistent with those of the broth microdilution method (Figs. 1a and b). Together, these results indicate that A. fumigatus BMU10672 is resistant to VRC and ISZ, while being susceptible to ITC, POS, AMB, and CAS. Sequencing of the cyp51A, cyp51B and hmg1 gene of A. fumigatus BMU10672 were all intact. The basal and VRC- or ISZ- induced expression levels of efflux pumps gene cdr1B in A. fumigatus BMU10672 were all higher (> 4-fold) than those in triazole-susceptible A. fumigatus Af293. However, no differences in basal and VRC- or ISZ- induced expression levels of cyp51A gene and cyp51B gene were observed between A. fumigatus BMU10672 and Af293. The efflux pump substrate Nile red accumulation assay showed the A. fumigatus BMU10672 accumulated less Nile red than Af293, confirming that Cdr1B was active at exporting Nile red, while efflux pumps inhibitor FK520 can increase the accumulation of the Nile red in A. fumigatus BMU10672 (Fig. 1c). Inhibition of efflux pumps activity by inhibitor FK520 resulted in a MIC reduction of 4-fold in VRC and ISZ MICs, and 2-fold in ITC and POS, against A. fumigatus BMU10672 (Figs. 1a and b).ConclusionOverexpression of efflux pumps gene cdr1B resulting in VRC- and ISZ- resistance in the clinical isolate of A. fumigatus BMU10672.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P059
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P269 Managing prosthetic valve endocarditis due to Sarocladium kiliense:
           Finding a way through uncertainties

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjective: To discuss the challenges in a case of recurrent/refractory prosthetic valve endocarditis due to Sarocladium kiliense.Methods and Results: Timeline of events (Fig. 1).AUC/MIC is associated with efficacy. Recent clinical studies have incorporated the MIC into targets for TDM, wherein Trough/MIC target of 2-5 may be usedR.In this caseVoriconazole trough—3.1/MIC-0.25 = 12.5Usual posaconazole trough—1.2/MIC 0.5 = 2.4, which is at the lower limit of the PKPD indexHence voriconazole was used.Drug interactions of voriconazole with acenocoumarol, clopidogrel were considered.Beta D-Glucan was used to assess infection of the newly implanted valve as well as improvement and need for continuing treatment.Since it is difficult to be certain of a cure, the patient was advised voriconazole as lifelong chronic suppressive therapy with periodic follow-up.R: reference available.Conclusions: The patient's status of the third mitral prosthetic valve necessitated all efforts to avoid further surgery. Therefore, the most efficacious agent had to be selected based on PK PD considerations and the likelihood of major long-term adverse effects.Careful management of DDI was needed.BDG may help to assess recurrence and response to treatment.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P269
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P270 Otomycosis: Main challenging microbial agent causing otitis externa
           in northern Iran

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesOtitis externa is one of the most common ear diseases, caused by bacterial and fungal agents. Accumulation of epithelial cells, cellular detritus, waxy substances, and microorganisms in the ear canal provide a proper environment for fungal growth, leading to annoying congestion. In this study, we aimed to identify the fungal causative agents and determine their susceptibility to the antifungal drugs were examined.MethodsAll patients with suspected otitis externa, referred to Amir-al Momenin Referral Centre from October 2020 to November 2021 entered to study. A total of 200 patients’ ear discharge and debris collected samples were examined by direct examination and cultured on SDA supplemented with chloramphenicol. Definitive identification of grown fungi was made by PCR-RFLP and sequencing of ribosomal DNA. In vitro susceptibility testing of the fungal isolates against eleven different antifungal agents was analyzed using the CLSI broth microdilution methods.ResultsA total of 101 (50.5%) cases were confirmed with otomycosis. Most patients were in their fifth decade of life (n = 35, 34.6%), female (n = 57, 56.4%), and had unilateral ear involvement (n = 78, 77.2%). The most common symptoms were earache (56.4%) and itching (51.4%). Most underlying predisposing factors are overaggressive using cotton swabs (65.3%) and history of topical antibiotics (48.5%). Among the 117 fungal isolates, Aspergillus section Nigri was the most common agent 58 (49.57%), followed by Aspergillus section Flavi 19 (16.23%), C. parapsilosis 14(11.96%), Aspergillus section Fumigati 12 (10.25%), C. orthopsilosis 6 (5.12%), C. albicans complex 5 (4.27%), Mucor spp. 2 (1.71%), and Syncephalastrum spp. 1 (0.85%). Mainly, all tested antifungals were active against the most isolates of Aspergillus, aside from tioconazole, nystatin, and terbinafine, which showed low in vitro effects. Also, nystatin and itraconazole showed higher GM MICs in against all Candida species isolates. Conversely, amphotericin B (GM = 0.07129) in Aspergillus and voriconazole (GM = 0.03686) in Candida showed the highest antifungal activity. Regarding ECV values represented by ECOFFs, one of each A. niger (MIC 8 μg/mL), A. flavus (MIC 2 μg/ml), and A. fumigatus (MIC 2 μg/ml) isolates were resistant to itraconazole.ConclusionIn this study, inconsistent with previous ones, fungal agents have overcome bacterial ones as the etiology of otitis externa. This result may relate to misuse or improper use of topical steroids, antibiotics, and inappropriate control of infection. In addition, our sample collection site was an ENT referral center and many patients have been admitted to this center due to treatment failure and suffered from recurrence. Aspergillus section Nigri isolation domination was seen, in agreement with other results. The MICs distribution of Aspergillus species isolates against triazole antifungals are close to ECVs defined by the CLSI and likely outrun it over time. We recommend that physicians request drug susceptibility testing before antibiotic therapy, to prevent the development of resistance.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P270
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P309 Clonal outbreak of Trichophyton tonsurans causing tinea capitis among
           wrestlers in Beijing, China

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTrichophyton tonsurans, an anthropophilic dermatophyte, mostly causes tinea capitis and tinea corporis and is often associated with outbreaks among athletes involved in combat sports, such as wrestlers and judo athletes. Here, we report an outbreak of tinea capitis caused by Trichophyton tonsurans among five juvenile athletes aged ten to fourteen in a wrestling team in Beijing, China.MethodsA total of 5 wrestlers aged 10-14 years presented with alopecia, erythema, scales, and pustule on the scalp (Fig. 1a). Scrapings from the lesions were performed by direct microscopic examination using 10% potassium hydroxide (KOH) with calcofluor white and fungal culture. The fungal pathogens were identified by morphology and sequencing of the internal transcribed spacer (ITS) regions. Multilocus genotyping analysis was performed by sequencing of the five gene loci including the ITS and non-transcribed spacer (NTS) of the ribosomal RNA (rRNA) locus, alkalineprotease-1 (ALP1), metalloprotease-5 (MEP5), carboxypeptidases Y (CarbY), which show intraspecies diversity and can be applied to epidemiological investigations and determining the route of infection transmission. Antifungal susceptibility of terbinafine (TBF), itraconazole (ITC), fluconazole (FLC), ketoconazole (KTC), and amphotericin B (AMB) against the causative fungal isolates was determined by broth microdilution method according to the Clinical and Laboratory Standards Institute (CLSI) M38-A3 document.ResultsThe five patients were diagnosed with tinea capitis because of the scalp lesions, spores, and hyphae observed by direct microscopic examination (Fig. 1b), and positive fungal culture. The causative isolates were all identified as T. tonsurans by macroscopic and microscopic characteristics (Fig. 2) and sequencing of ITS regions. The sequences of ITS, NTS, ALP1, MEP5, and CarbY were identical among the five isolates, revealing a single genotype. The abovementioned sequences have been deposited to Genbank. The minimum inhibitory concentrations (MICs) of TBF, ITC, FLC, KTC, and AMB against five T. tonsurans isolates were 0.015 μg/ml, 0.015 μg/ml, 8 μg/ml, 0.06 μg/ml, and 0.5 μg/ml, respectively.ConclusionWe report an outbreak of tinea capitis caused by T. tonsurans among wrestlers in Beijing, China. Multilocus genotyping analysis revealed that all isolates consisted of a single genotype, suggesting the outbreak may be caused by a single strain of T. tonsurans. The isolates were all susceptible to the common antifungal drugs treating tinea capitis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P309
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P311 First reported case of Cladosporium liver abscess in
           immunocompromised host

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackground: Cladosporium species are ubiquitous, saprobic, dematiaceous fungi that are infrequently associated with human opportunistic infections. They are usually associated with allergic rhinitis, asthma, localized superficial, and deep cutaneous and subcutaneous lesions, but rarely cause disseminated infection, known as phaeohyphomycoses.Case Description: We report a case of Cladosporium liver abscess in an immunocompromised host. A 39-year-old male with a history of multiple sexual partners was newly diagnosed with human immunodeficiency virus and was antiretroviral therapy naïve. He presented with epigastric and right hypochondriac pain, associated with abdominal distension for 3 months. On examination, he was jaundiced with hepatomegaly. Full blood count showed leukocytosis with neutrophilia (TWC 14.3 × 109/l with ANC 11.2 × 109/l). The liver function test shows hyperbilirubinemia with obstructive features. (Total bilirubin 101.9 μmol/l, direct bilirubin 78.8 μmol/l, ALT 87 U/l, AST 168 U/l, ALP 383 U/l, INR: 1.37). Baseline CD4 was 41 cells/ul, and HIV viral load was >10 000 000 copies/mL.CECT 4-phase liver shows enlarged liver with smooth lobulated margin, measured 22.5 cm. Multiple large round hypodense masses of varying sizes were seen scattered in both liver lobes. The largest mass is in segment VII measuring 5.8 × 7.7 × 8.8 cm. Liver biopsy showed evidence of diffuse large B cell lymphoma while tissue fungal culture grew Cladosporium sp. Antifungal susceptibility testing showed a low MIC range for posaconazole, voriconazole, and itraconazole while terbinafine was not tested. Patient received tablet voriconazole 200 mg BD for 3 months. He was also initiated on chemotherapy antiretroviral therapy at the same time with the regime of T. Tenofovir disoproxil fumarate/emtricitabine 1 tablet once daily and tablet dolutegravir 50 mg once daily. A repeated PET-CT done 3 months later during chemotherapy shows residual hypodense liver lesions.Discussion: A wide range of fungi can be found on various human mucosal surfaces, such as lungs, vaginal tract, urinary tract, oral cavity, intestines, and skin. The community of commensal fungi interacts with commensal bacteria and the host. Changes in the commensal fungi have a significant impact on host health and are associated with pathological conditions. Cladosporium was reported as one of the commensal fungi. Reports of invasive Cladosporium infection are extremely rare with variable presentation. There were previous case reports of Cladosporium infection of the central nervous system, lung, and skin but no liver abscess has been reported yet. Fungal hepatic abscesses are not uncommon among immunocompromised hematological malignancy patients, especially those with leukemia and prolonged neutropenia. Azoles, particularly itraconazole, and posaconazole have good activity against Cladosporium species, although voriconazole displayed variable activity. This is consistent with our case whereby itraconazole and posaconazole demonstrate the lowest MIC as compared to voriconazole. However, voriconazole was chosen instead of itraconazole for coverage against the possibility of Aspergillus appearing later. In our case, the patient showed a good response to voriconazole.ConclusionThe choice of antifungal will depend on susceptibility testing, organ involvement, tissue bioavailability, drug-drug interaction, and patients’ clinical risk factors; whereas the duration of treatment is guided by radiological resolution and control of risk factors.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P311
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P025 A study on candiduria in neonates and infants from a tertiary care
           center, North India.

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectiveCandida albicans is the major cause of fungal UTI in neonates and infants but nowadays incidence of other species of Candida is also increasing, and these are mostly multidrug resistant. It is, therefore, important to determine the causative Candida species in fungal UTI for appropriate management. This study was undertaken to determine the Candida species distribution in UTI along with susceptibility patterns and outcomes in infants and neonates admitted to various wards and intensive care units (ICUs) of our hospital. The incidence rate of candiduria in ICUs was also assessed.MethodUrine samples were collected from infants and neonates presented in pediatric and neonatal ICUs and clinical wards with a clinical suspicion of candiduria. Infants at risk of invasive candidiasis were also included in the study. Identification of Candida species was done by Gram's staining, germ tube test, chlamydospore formation on corn meal agar, color of colonies on CHROMagar, and confirmed by Matrix Assisted Laser Desorption-Time of Flight (MALDI-TOF). Antifungal susceptibility was performed by using the Broth microdilution method as per the latest CLSI guidelines (M27-A3/M27-S4).ResultUrine samples were received from 219 infants, and Candida was isolated from samples from 52 infants (isolation rate 23.75%), of which 30 were admitted to pediatric or neonatal ICU and 22 in the wards. The incidence rate of candiduria in ICU was 3.25%. Candida albicans was the most frequently isolated species from the samples of infants in the wards (13/22 ie, 59%), while Candida tropicalis was most frequently isolated from samples of infants in the ICUs (13/30 ie, 43.34%). Candida glabrata was the least commonly isolated species and was only encountered in the ICU. The species distribution of isolates is given in Table 1. There was no discrepancy between the results of conventional methods of identification and MALDI-TOF.Antifungal susceptibility was performed for 18 randomly selected isolates. All were found to be susceptible to caspofungin, micafungin, itraconazole, voriconazole, fluconazole, and amphotericin B. MIC distribution for various isolates is given in Table 2.ConclusionHigh index of suspicion of candiduria is necessary for early diagnosis of fungal UTI and initiation of antifungal treatment, especially in critically ill infants requiring intensive care. Species other than C. albicans are also encountered more frequently nowadays and these species often have higher MICs for commonly used antifungal drugs, which may lead to delayed or failed response to routine antifungal therapy and necessitate prolonged use and or higher doses of antifungals. Identification of Candida isolates at species level along with analysis of the susceptibility patterns is therefore important for successful outcomes in candiduria in neonates and infants.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P025
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P071 Isolate profiling and antifungal susceptibility determination for
           terbinafine and itraconazole among dermatophytes in a tertiary care
           hospital of western rajasthan

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectiveTo determine the species distribution of causative agents causing dermatophytosis, and their antifungal susceptibility pattern for terbinafine and itraconazole in trichophyton spp among samples collected in patients with dermatophytosis clinical suspicion during the period of December 1, 2020 to January 31, 2022.Materials and MethodsThis is a prospective study conducted in the Department of Microbiology of a tertiary care super specialty and referral Centre of western Rajasthan from December 1, 2020 to January 31, 2022.Skin scraping, nail clipping, and hair pluckings were collected in mycology lab from clinically suspected cases of dermatophytosis presenting to the department of dermatology for conventional identification, and antifungal susceptibility testing.The specimens were subjected to direct KOH and calcofluor white microscopy and conventional fungal culture on SDA at 25 ͦ C and 37 ͦ C.The cultures positive for dermatophytes were speciated by microslide culture lactophenol cotton blue mount, hair perforation test, and urease test.The isolates identified as Trichophyton spp were taken up for antifungal susceptibility testing against terbinafine and itraconazole by microbroth dilution according to CLSI-M38 A2 guidelines. Further terbinafine resistance gene evaluation for detection of C1191A and T1189C single nucleotide polymorphism in Squalene epoxide by Amplified Refractory Mutation System-Polymerase chain Reaction (ARMS-PCR) is undergoing for trichophyton spp.ResultsOver the 14-month study period, the laboratory processed total of 174 specimens: 134 skin scraping, 36 nail clipping, and 4 hair pluckings. Of them, 106 (61.62%) specimens were microscopy positive and 111 (63.79%) were culture positive. Out of the 111 culture-positive agents isolated, 94 (84.68%) were found to be dermatophytes. On isolate profiling of 94 dermatophytes T. mentagrophyte was found to be most common 45 (48%) followed by T. rubrum 27 (29%), T. tonsurans 20 (21%), T. verrucosum 1 (1.1%), and Microsporum spp 1(1.1%). Antifungal susceptibility of 93 Trichophyton spp against terbinafine showed resistance among 58.06% isolates with 83.33% isolates among terbinafine resistant cases showing ≥4 μg/ml minimum inhibitory concentration. There was no resistance detected for itraconazole with microbroth dilution.ConclusionA total of (54.02%) skin, hair, nail infections were found to be caused by dermatophytes.On isolate profiling, T. mentagrophyte, T. rubrum, and T. tonsurans were found to be predominant species among our isolates showing altered trend of local isolates from T. tonsurans being second most common spp isolated in past.On antifungal susceptibility >55% isolates showed resistance for Terbinafine with >80% having higher MIC of ≥4 μg/ml on the contrary there was no observed resistance for itraconazole.There is a need for encouraging dermatologists for prescribing routine fungal microscopy, culture, and AFST for dermatophytes in Western Rajasthan, to reduce the indiscriminate use of antifungals.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P071
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P075 Initial results of an international effort in screening new agents
           against Candida auris

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMCandida auris is an emergent fungal pathogen. A global concern regarding this yeast is its resistance to many currently available antifungal drugs, virulence factors, capacity to spread in hospital environments, and its misidentification, resulting in high rates of morbidity, and mortality.ObjectiveIn response to this challenge, new effective options of antifungals against C. auris are urgent. Therefore, our consortium evaluated the in vitro activity of two agents with novel mechanisms of action, and negligible toxicity in studies to date: diphenyl diselenide (PhSe)2 and nikkomycin Z (NikZ), alone and in association with conventional antifungals (azoles, echinocandins, polyenes) against C. auris.MethodsA total of 11 isolates of C. auris were included in this in vitro study, 10 from South Asian clade I and 1 from South Africa clade III. In vitro tests (dilution and interaction assays) were performed according to the CLSI M27-Ed4 protocol. Interactions between (PhSe)2 or nikkomycin Z, and amphotericin B (AmB), fluconazole (FCZ), micafungin (MYC), or caspofungin (CSP) were evaluated by checkerboard assays, resulting in Fractional Inhibitory Concentration Indexes (FICi). Tests were read after incubation for 48 h at 35°C. The minimal inhibitory concentration (MIC) was defined as the lowest concentration able to inhibit 100% (PhSe)2, AmB and NikZ, or 50% (FCZ, MYC, and CSP) of the fungal growth. Interaction between the drugs was classified as strong synergism when FICi <0.5, weak synergism when 0.5 <FICi <1, additive when 1 <FICi <2, indifferent when FICi = 2, or antagonistic when FICi >2.Results(PhSe)2 and NikZ alone were unable to inhibit C. auris even by the higher concentrations tested (32 μg/ml and 64–128 μg/ml, respectively). An additive effect of (PhSe)2 was detected with MYC against 30% of the isolates, however, its combination with AmB was antagonistic against all of the isolates, as well as against one isolate with FCZ. All of the other interactions with (PhSe)2 were indifferent. In contrast, NikZ showed strong or weak synergism in association with CSP, AmB, FLU and MYC against 100%, 90%, 30% and 14% of the C. auris isolates tested, respectively. An additive interaction of NikZ was also detected with MYC against 86% of the isolates. No antagonistic effect was detected in the combination of NikZ with the antifungals tested.ConclusionAlthough (PhSe)2 seems to not have potential as a future anti-C. auris drug, NikZ showed a productive avenue for further studies, mainly in combined therapy against this pathogen.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P075
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P098 Human protothecosis: Acase report in Northeastern Brazil

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMIntroductionProtothecosis is an emergent disease caused by members of the genus Prototheca. Most such infections probably occurred by traumática inoculation into subcutaneous tissues.ObjectivesIt is to report a case of human cutaneous protothecosis identified in the state of Maranhão, northeast Brazil. Case report: 75-year-old patient, Merchant, from the municipality of São Luís Island, Northeastern Brazil. He sought care referring to an erythematous and painful lesion on the left arm that started 6 months before the treatment. On examination, he presented an infiltrative, hyperemic lesion with burning pain throughout the upper limb (Fig. 1). The patient reported that a week before the onset of the condition, he suffered trauma on the arm, with a laceration in the skin, while cleaning a sewage system with clay pipes. During the healing process, he noticed a hyperemic, slightly pruritic lesion measuring 2 cm which did not improve. He sought medical assistance at the dermatological service, who suspected dermatophytosis, initiating treatment with terbinafine (250 mg, once a day), evolving with worsening of the lesion. A lesion biopsy was indicated, to histopathological examination, which showed circular, moniliform structures, diagnosed as protothecosis (Fig. 2). Treatment with itraconazole (200 mg/day) was started, with no therapeutic response and the lesion spread throughout the patient's left upper limb. Submitted to a new investigation with biopsy for direct research and culture for fungi, being identified Prototheca Wicherhamii, by Maldi-Tof®, with sensitivity to itraconazole and ampfotericin B. PCR amplification of the genetic material obtained in the clinical isolate was performed with purification of its product, and sequencing showed genetic similarity of 97,46% with Prototheca Wickerhamii. The sequence obtained was deposited in Genbank under number MZ409514. In the absence of therapeutic response to itraconazole (400 mg/day), and significant worsening of the lesion, with presentation of a secondary infection caused by Staphylococcus haemoliticus, treatment with Clindamycin (900 mg/day for 10 days) and Liposomal Amphotericin B (4 mg/kg/day for 45 days) were performed. After suspension of Liposomal Amphotericin B, the lesions recurred in 15 days, and voriconazole (200 mg 12/12 h) was prescribed for 6 months, with complete regression of the lesions. Currently, he is free of injuries, having been followed up every 6 months.ConclusionRare disease caused by chlorophyllous algae may be surprising due to the severity and lack of response to antifungals that show sensitivity in vitro.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P098
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P099 Molecular identification of dermatophyte species from Eastern Assam,
           Northeast India

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesDermatophyte infections occur worldwide both in developing as well as developed countries. However, species of dermatophytes may vary based on geographical region. Studies on dermatophytes from northeast India are rare. This study was done to know the various species of dermatophytes that are commonly associated with infection in this part of the country.MethodsThis study was done from 2020-2021. A total of 49 consecutive isolates of dermatophytes isolated from clinically suspected cases attending Assam Medical College and Hospital, a tertiary care hospital were subjected to molecular identification by using PCR and sequencing of the ITS region of the ribosomal RNA gene as well as using MALDI-TOF (VITEK MS). Samples from active margin of lesions from skin, nail, and hair were collected and primary identification was done by culture and microscopy as well as conventional phenotypic tests. Culture was done in Sabouraud Dextrose agar, Sabouraud Dextrose agar with chloramphenicol and cycloheximide, and dermatophyte test medium which was followed by genotypic confirmation by PCR of the ITS region and sequencing of PCR amplicons using already published protocols.ResultsThe species isolated were T. rubrum (36.7%), T. interdigitale (32.6%), T. mentagrophytes complex (14.2%), T. tonsurans (8%), M. gypseum (6%), T. violaceum (2%). The cases were clinically found to be T. corporis (44.89%), T. manuum (12.24%), T. pedis (12.24%), T. cruris (10.20%), T. faciei (8.16%), T. capitis (8.16%), and T. unguium (4.08%).ConclusionT. rubrum, T. interdigitale, T. mentagrophytes, and T. tonsurans complex were the predominant species isolated.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P099
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P149 Short tandem repeat genotyping of South American Candida tropicalis
           isolates

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMCandida tropicalis is a clinically relevant yeast that causes candidemia in humans with a high mortality rate. The yeast primarily infects immunocompromised patients and causes outbreaks in health care facilities. A short tandem repeat (STR) typing scheme for C. tropicalis was applied to a collection of 217 clinical and environmental isolates from South America, predominantly from Brazil, and included nine fluconazole-resistant isolates. Application of the STR typing resulted in the identification of 153 genotypes. Typing demonstrated 11 clusters containing more than two isolates. In one cluster of six, we found three fluconazole-resistant isolates, while there were another five closely related fluconazole-resistant isolates. ERG11 mutation screening was performed on all 9 resistant isolates. The closely related resistant isolates all contained Y132F in combination with the novel Y257H/N mutation. The remaining resistant isolate did not exhibit mutations in ERG11 suggesting a different resistance mechanism. Altogether, we applied a novel STR genotyping for C. tropicalis and showed several in-hospital clusters suggesting cross-transmission.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P149
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P150 Profile of Candidemia in a national level HAI Surveillance Network of
           India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackgroundCandida is responsible for roughly 96% of all opportunistic mycoses and is a major cause of bloodstream infections (BSIs). The potential for nosocomial spread of Candidemia infections is a new concern concurrent with the rapid expansion of intensive care facilities for COVID-19 patients. With the pandemic of COVID-19 now moving into 2022, it is understood that critically ill COVID-infected patients in the ICUs are commonly infected with highly resistant bacterial and fungal infections.ObjectiveTo estimate the incidence rates and compare the epidemiology of candidemia in COVID infected and non-infected patients requiring ICU care.MethodologyIn this 2-year retrospective multicentric study, we present the findings on candidemia from the Healthcare-Associated Infections (HAI) surveillance network which includes 40 hospitals across India and with special emphasis on differences in the epidemiology of Candidemia in COVID infected and non-infected patients in the pre-COVID (April 2019 to April 2020) and COVID times (April 2020 to April 2021) across this network. We compared the incidence of candidemia between COVID infected and non-infected patients using Poisson regression analysis. Chi-squared (χ2) test was used to test for differences in variables such as gender and 14-day mortality between the patients and Wilcoxon rank-sum (Mann-Whitney) test was used to compare median between the patients.ResultsA total of 628 patients with candidemia were screened from HAI Surveillance Database where 68 patients are COVID infected and 560 non-infected patients from both pre-COVID and COVID periods. Incidence of Candida-associated BSI increased significantly from 1.47 (95% CI, 1.35-1.60) to 3.08 (95% CI, 2.38-3.92) in non-infected and COVID-infected patients respectively, while in CLABSI the rates increased from 2.62 (95% CI, 2.34-2.92) in non-infected to 5.99 (95% CI, 4.30-8.12) in COVID-infected patients. COVID infected patients in the age group (>60 years) were significantly more prone to candidemia compared to non-infected patients. During the COVID period, the maximum time for candidemia to develop (from the time of ICU admission) in COVID-infected patients was shorter (<65 days) than in non-infected patients (>90 days).ConclusionWe observed an increased incidence of candidemia in hospitalized patients during the COVID period compared with the same during the pre-COVID period.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P150
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P151 Molecular epidemiology of environmental strains of Cryptococcus
           isolated from Varanasi, Uttar Pradesh, India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesCryptococcosis affects more than one million people per year worldwide. Despite the worldwide emergence of this ubiquitous infection, little is known about the global molecular epidemiology of this fungal pathogen. The ecological niche of the etiological agents of C. neoformans and C. gattii are not well established yet in various parts of India.MethodologyThe present study was performed on the C. neoformans isolated from the Eucalyptus terreticornis at Varanasi, India. A total of 265 samples including flowers, leaves, bark, and nearby soil of E. terreticornis. The fungal pathogens were identified by both the conventional and molecular methods. The isolates were also grown in Staib's and tobacco agar medium. In addition, all isolates were identified on the basis of different biochemical tests such as urease test and canavanine-glycine-bromothymol blue (CGB). Further, molecular characterization was carried out by using PCR and DNA sequence analyses.ResultsOf all the 265 samples, 11 were positive for C. neoformans.8% (4/50) for E. tereticornis bark, 5% (3/60) for nearby soil, 6.66% (2/30) for debris, and 3.07% (2/65) for decayed wood from tree hollows.C. neoformans was not recovered from the leaves and flowers of E. tereticornis.The presence of brown colonies on Staib's and tobacco agar media confirmed that the isolated pathogen is Cryptococcus.Further the isolates of Cryptococcus were tested for urease production using Christensen urea citrate agar medium in which all isolates were found to hydrolyze urea rapidly and reddish pink color was obtained confirming it to be C. neoformans.All isolated yeast were negative for Canavanine glycinebromothymol blue (CGB) as they fail to produce a color change in the medium.Five strains were identified as C. neoformans var. grubii and one of the isolates was identified as C. neoformans var. neoformans.Molecular typing grouped the isolates into two major genotypes. Five were molecular type VNI (serotype A, var. grubii), one of the isolates was molecular type VNIV (serotype D, var. neoformans).Figure 3 shows the Gel electrophoresis image of ITS1- ITS4 amplicons.The nucleotide sequences were submitted in NCBI GenBank with accession numbers MZ824412, MZ848145, MZ823611, MZ882370, MZ882372, and MZ817986.ConclusionIn spite of a major Eucalyptus growing region of India, there is no report of C. neoformans/C. gattii-Eucalyptus association from Eastern Uttar Pradesh. Therefore, the current study would certainly be helpful in the establishment of molecular epidemiology of Cryptococcus in this area.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P151
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P152 African Woman With a Knee Knocked by a Rare Dematiaceous Fungi

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectives/IntroductionIncidence of fungal peri-prosthetic joint infection (PJI) is rare (1%-3%) and the majority are caused by Candida and Aspergillus. We report a peri-prosthetic knee joint infection caused by a rare dematiaceous fungi—pleurostomophora richardsiae, probably the first case in the world.Methods/Case DetailsA 78-year-old East African female from Malawi, housewife, with no known medical comorbidities presented with a chronic history of left knee pain and pus discharge. She had left knee pain since 2008 and was given several intra-articular injections between 2008 and 2010 for pain relief suspecting osteoarthritis. She denied a history of splinter injuries, trauma, systemic, or constitutional symptoms.In 2010 she underwent left total knee replacement (TKR) in the USA, but the pain persisted post-operatively associated with intermittent swelling of both knees. She was evaluated again in 2015 and revision left TKR done with single stage exchange.She was asymptomatic for a few years but symptoms worsened again and drainage of pus from her left knee started in December 2019. She was treated in Malawi with multiple courses of parenteral and oral antibiotics but did not improve.She presented to our hospital in January 2022 with swelling in left knee and restriction of movements. On examination, a discharging sinus was noted over the medial aspect of left knee. She was anemic with a normal leucocyte count, HIV negative, ESR of 85 mm/h, and CRP of 23 mg/L. Her renal and liver function tests were normal. CT left leg with sinogram showed features of chronic osteomyelitis of left distal femur and proximal tibia with active sinus tract in left tibia.Sinus tract excision with removal of prosthesis, debridement, and antibiotic cement spacer insertion was done. Bone and peri-prosthetic tissue were sent for histopathology and microbiological analysis including fungal and mycobacterial cultures. Xpert MTb was negative.Histopathology showed granulomatous synovitis with fungal hyphae and spores. Cultures grew a slender septate dark pigmented fungus, Pleurostomophora richardsiae which was confirmed by fungal PCR sequencing of internal transcribed spacer (ITS) region.Results/TreatmentShe was treated with Liposomal amphotericin B 5 mg/kg IV OD for 2 weeks followed by oral Itraconazole. She had persistent raised inflammatory markers at 4 weeks which settled after changing to posaconazole for 2 weeks. Conservative management will continue for 3-6 months with second stage revision arthroplasty/arthrodesis later.ConclusionDematiaceous fungi usually cause skin and soft tissue infections and they are extremely rare in causing prosthetic joint infection. Case reports of P. richardsiae causing osteomyelitis of foot and endocarditis are available but we couldn't find a published case of prosthetic joint infection caused by it. Identifying the causative organism in PJI is the most important step because the management depends mainly on it.Two-stage exchange in combination with antifungal administration between stages and post-revision should be the procedure of choice for fungal PJI. Incorporation of antifungal agents into cement spacers appears to be effective in eradicating local infections and reducing the duration of antifungal treatment and should be strongly considered.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P152
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P203 Chronic pulmonary aspergillosis (CPA) in post tuberculosis sequele—
           aclinical experience from tertiary care

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionChronic pulmonary aspergillosis (CPA) is a spectrum of illnesses clinically presenting as a persistent cough, dyspnea, hemoptysis, fatigue, and weight loss and radiologically can range from single aspergilloma, Aspergillus nodule, or chronic cavitary pulmonary aspergillosis (CCPA) which can progress to chronic fibrosing pulmonary aspergillosis if left untreated.1 CPA has high morbidity, burden in India estimated to be in a 5-year prevalence of 24/100 000.2 The commonly used criteria for diagnosing CPA include cough or hemoptysis for 1 month, raised Aspergillus-specific IgG, absence of positive GeneXpert test for Mycobacterium tuberculosis and either paracavitary fibrosis or a fungal ball on imaging of the thorax or progressive cavitation (either new cavitation or deterioration of pre-existing cavitation) on serial chest radiographs. Pulmonary tuberculosis (PTB) is the important predisposing risk factor for CPA,3 India being an endemic country, incidence of CPA may be underestimated or it may be misdiagnosed as smear-negative tuberculosis. Microbiologically, diagnosis by direct confirmation of Aspergillus spp infection (microscopy or culture from respiratory samples) may not be always positive, in such a scenario the immune response to Aspergillus spp. by measuring Aspergillus specific Immunoglobulin Ig G in clinically suspected cases may be used for diagnosis of CPA.MethodThis is a cross-sectional conducted in a tertiary care hospital, New Delhi, India. The patients with previous history of pulmonary tuberculosis who presented with symptoms of cough, hemoptysis, fever, shortness of breath, chest pain, and weight loss of ˃12-week duration were enrolled in the study. Relevant investigations including blood tests, chest imaging, sputum examination for bacterial infections, fungal (KOH mount), and tuberculosis (AFB smear, CBNAAT, mycobacterial cultures) were done. Microbiological evidence included a positive Aspergillus-specific IgG (cut off >8 units/ml) or positive serum galactomannan index (GMI) (cut off >1 according to EORTC/MSG guidelines) or KOH mount on sputum showing branching hyaline septate hyphae morphologically suggestive of Aspergillus spp. Patients who were diagnosed with CPA according to criteria were treated and followed up.ResultsA total of 15 patients were screened in the study, 4 patients who had concurrently detected pulmonary tuberculosis detected by Genexpert, were excluded from the study. Majority of patients presented with complaints of recurrent episodes of cough and hemoptysis. Imaging features included cavitation, bronchiectasis, pleural thickening, and fungal ball. Sputum microscopy for fungal elements was positive only in 10 patients. The serum Aspergillus Ig G (values ranged from 19.8-200 u/mL) was raised in all patients while serum GMI above cut-off was present in only 5 patients. All confirmed CPA patients were managed with voriconazole for 4 months. Following 4 months of treatment, all patients had favorable outcomes in terms of radiological improvement and clinical cure.ConclusionCPA is an underestimated post-PTB sequel and should be considered as differentials in patients with respiratory symptoms in post TB patients. Aspergillus Ig G and chest imaging are recommended as initial diagnostic tools for diagnosing CPA.Sources:Denning DW, Cadranel J, Beigelman-Aubry C et al. European Society for Clinical Microbiology and Infectious Diseases and European Respiratory Society. Chronic pulmonary aspergillosis: rationale and clinical guidelines for diagnosis and management. Eur Respir J. 2016; 47(1): 45-68.Agarwal R, Denning DW, Chakrabarti A. Estimation of the burden of chronic and allergic pulmonary aspergillosis in India. PLoS One. 2014; 9(12): e114745.Page ID, Byanyima R, Hosmane S et al. Chronic pulmonary aspergillosis commonly complicates treated pulmonary tuberculosis with residual cavitation. Eur Respir J. 2019; 53: 1801184
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P203
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P204 Secondary organizing pneumonia caused by Aspergillus flavus in
           immunocompromised patients

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionFungal pneumonia is a known complication in immunocompromised patients. However fungal infection leading to organizing pneumonia (OP) is a rare entity. Here we present two cases of co-occurrence of OP with Aspergillus lung infectionCase 1: A 33-year-old male with a history of recurrent oral-genital ulcerations and low-grade fever for the last 3 months presented with shortness of breath and high-grade fever for 10 days. On presentation he was hypotensive, tachycardic, and tachypneic, examination revealed bilateral crackles. His initial investigations were hemoglobin (Hb) 8.8, total leucocyte counts (TLC) 13 000, platelet 190 000, liver function test (LFT), and kidney function test (KFT) were normal. High-resolution commuted tomography (HRCT) revealed multifocal areas of interlobular septal thickening with ground glass opacity and patchy areas of consolidation seen in bilateral lung fields (Fig. 1). He was initially managed with broad-spectrum antibiotics and oxygen support by a high flow nasal cannula (HFNC); as the condition deteriorated, he was mechanically ventilated. Fibreoptic bronchoscopy with bronchoalveolar lavage (BAL) was performed. Investigations for tuberculosis, nocardia, pneumocystis carinii, and bacterial infection in BAL was negative. Galactomannan index (GMI) in BAL was 3.15 and grew Aspergillus flavus. Transbronchial biopsy revealed features consistent with organizing pneumonia. He was started on voriconazole and steroids. He was diagnosed with undifferentiated connective tissue disorder. As the patient's condition improved in due course of time, he was extubated and discharged in stable condition on voriconazole and steroids and is currently doing fine.Case 2: A 56-year-old male known case of mantle cell lymphoma on consolidation therapy, presented with 15 days history of shortness of breath and high-grade fever. Chest examination revealed decreased breath sounds bilaterally in the lower lung zones with lower zone crackles. Initial investigations showed Hb 10.9, TLC 3.90, platelet 150000, KFT and LFT were normal. HRCT scan revealed multilobular areas of consolidation showing air bronchogram with ground glass opacities in bilateral lung (Fig. 1). Bronchoalveolar lavage fluid (BALF) revealed the growth of Aspergillus flavus and was GMI 1.97. Investigations for tuberculosis, nocardia, pneumocystis carinii and bacterial infection was negative. Transbronchial biopsy revealed features consistent with organizing pneumonia. He was started on combination therapy with voriconazole and micafungin along with steroids. Initially, he was managed with oxygen support but his oxygenation gradually worsened, he was mechanically ventilated, and received multiple pruning sessions. Patient had refractory organizing pneumonia, did not show any improvement even after 1 month, and left against medical advice.ConclusionBacterial and viral infections are the common causes of secondary OP. Fungal infections implicated in secondary OP are rarely described, of which there are reports of Pneumocystis jiroveci (PJP) and Penicillium infection leading to secondary OP. Aspergillus flavus is a ubiquitous fungal agent and is considered as pathogenic in immunocompromised settings can lead to secondary organizing pneumonia. High index of suspicious for OP is always to be kept in mind while treating Aspergillus flavus pneumonia.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P204
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P342 Lactobacillus rhamnosus protection against Candida-induced vaginal
           epithelial cell damage is Candida albicans strain-dependent

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMMicrobial dysbiosis can lead to vulvovaginal candidiasis (VVC) which is characterized by a pathogenicity-induced inflammatory response progressing to neutrophil-driven immunopathology. Probiotic treatment has varied success rates and some women still experience VVC despite being colonized by lactobacilli. It is, therefore, imperative to identify factors that influence the success of probiotic treatment for VVC.We aimed to evaluate how Candida albicans strain differences contribute to the varying degrees to which probiotics such as Lactobacillus rhamnosus protect against Candida-induced epithelial tissue damage. We screened the commonly used highly virulent C. albicans laboratory strain SC5314, 24 C. albicans strains from different clades, and several vaginal C. albicans isolates. L. rhamnosus was used to colonize vaginal epithelial cells prior to C. albicans infection and vaginal epithelial cell damage was measured.Compared to SC5314, most C. albicans strains induced relatively low or no epithelial cell damage. Even increased multiplicities of infection did not increase epithelial damage to the level of SC5314. Three groups were identified based on the effect of L. rhamnosus on Candida-induced epithelial cell damage. Bacterial colonization decreased, did not affect, or even increased tissue damage during infection.The different C. albicans clades showed no correlation with the protective phenotypes. However, increased epithelial tissue damage in the presence of lactobacilli was generally observed with strains that alone were unable to damage the epithelium. Some strains had an enhanced potential to grow at low pH, yet growth at low pH alone was not able to distinguish the three groups.The protective potential of L. rhamnosus is highly C. albicans strain-dependent. Our data hint toward a potential multifactorial effect involving stress-resistance and metabolic interplay. Elucidating the processes that lead to epithelial protection or enhanced damage will be crucial to predict whether probiotic lactobacilli may be beneficial or detrimental for a patient and may help to design generally protective probiotics.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P342
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P343 Novel hydrophobic binding surface proteins are instrumental for
           phagocytosis of Lichtheimia corymbifera by macrophages

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectives:Perform proteomic analysis of the spore surface alongside secretome analysis of two strains of Lichtheimia corymbifera.Evaluate interaction, recognition, and phagocytosis of Lichtheimia spores by murine alveolar macrophages.MethodsTwo strains of L. corymbifera (JMRC: FSU: 09682 and JMRC: FSU: 10164) were used in this study. For phagocytosis assay, the spores were labeled with 0.1 mg/ml Fluorescein isothiocyanate (FITC) (Sigma Aldrich Chemie) in 0.1 M Na2CO3 for 30 min 146 at 30°C. Murine alveolar macrophages MH-S (ATCC:CRL-2019) were cultivated in RPMI-1640 (Sigma, 30-2001) supplemented.Identification of the surface proteins of L. corymbifera was carried out as described before with minor modification.1 The supernatants were stored at −80°C for liquid chromatography-mass spectrometry (LC-MS/MS) analysis. Secreted proteins of L. corymbifera were determined as described in a previous study with minor modification2.The raw files generated by the LC-MS/MS were further processed by the software Proteome Discoverer v1.4.0.288 (Thermo). Tandem mass spectra were searched against the NCBI L. corymbifera protein database.3 Approximately 10 000 MH-S cells were cultivated onto 96-well microplates (NUNC 163320) in 100 μL RPMI-1640 medium (Sigma, 30-2001). Images were acquired by the Zeiss Axio Observer 7 Spinning Disk Confocal Microscope (ZEISS, Jena, Germany) and processed with ZEN 2.1 Software (ZEISS) by 63x objective lens.ResultsAbundant surface proteins were found which serve as Candidates for secretome analysis. A total of 113 proteins were identified. Thirty proteins were confirmed to be on the spore surface based on the presence of signal peptides3. The following proteins were predominantly identified: Spore coat protein (CotH), hydrophobic surface binding protein A (HsbA), aconitase, ricin-like lectin, two transition elongation factors, multi-copper oxidase, heat shock protein 70 family (Hsp70), malate synthase, putative allergen Candidates, etc.These proteins were heterologsly overexpressed in yeast. Successful overexpression was confirmed by LC-MS/MS. The yeast mutants were subjected to phagocytosis assays (Fig. 1). The role of surface proteins in macrophages is discussed.ConclusionThe surface proteins are instrumental for recognition of L. corymbifera by macrophages and for intracellular survival in macrophages. The role of surface proteins is discussed in the light of evolution from environmental to human pathogenic fungus.Sources:Voltersen V, Blango MG, Herrmann S, et al. Proteome Analysis Reveals the Conidial Surface Protein CcpA Essential for Virulence of the Pathogenic Fungus Aspergillus fumigatus. mBio. 2018;9(5). doi:10.1128/MBIO.01557-18Thürich J, Meichsner D, Furch ACU, et al. Arabidopsis thaliana responds to colonisation of Piriformospora indica by secretion of symbiosis-specific proteins. PLOS ONE. 2018;13(12):e0209658. doi:10.1371/JOURNAL. PONE.0209658.Schwartze VU, Winter S, Shelest E, et al. Gene Expansion Shapes Genome Architecture in the Human Pathogen Lichtheimia corymbifera: An Evolutionary Genomics Analysis in the Ancient Terrestrial Mucorales (Mucoromycotina). PLOS Genetics. 2014;10(8):e1004496. doi:10.1371/JOURNAL.PGEN.1004496.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P343
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P344 Automatic detection of pneumocystis jirovecii in microscope images:
           adeep learning-based approach

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: Pneumocystis jirovecii Pneumonia is one of the diseases that most affect immunocompromised patients today, and under certain circumstances, it can be fatal. One of the most widely used techniques in diagnostic laboratories for the detection of its etiological agent is optical microscopy. However, some of the disadvantages of this technique are its low sensitivity, low accuracy, and high dependence on an expert to make the diagnosis. Then, this work aims to develop a computational tool based on a deep learning approach to automatically detect the presence of P. jirovecii Pneumonia fungus from optical images, and to increase the accuracy of this conventional technique.MethodsThe study involved 29 randomized patients, from whom respiratory samples (bronchial lavage, and bronchoalveolar lavage) were collected. Methenamine silver staining was then used to prepare the samples. Subsequently, the slides of the analyzed patients were observed using the Leica DM500 microscope using a Leica ICC50 HD camera, and the optical images were taken in at least four random positions on the specimen holder. Thus, an image dataset of 29 different patients was created to detect whether a patient is positive or negative for P. jirovecii Pneumonia. Finally, a deep learning approach based on convolutional neuronal networks (CNN) was proposed and evaluated to improve the accuracy of the microscopy technique. The proposed CNN method incorporates global and local features for pixel-wise segmentation.ResultsFirst, the dataset image was processed and segmented using the connected components methodology. Likewise, the segmented images were labeled with the help of an expert to train the algorithm. To validate the response of the proposed deep learning approach the obtained results were compared with the obtained conventional image classification techniques like co-occurrence matrix and K-NN. The obtained results reveal that the proposed methodology allows to increase in the accuracy in the P. jirovecii Pneumonia identification up to 98%, while the co-occurrence matrix and K-NN only achieve accuracies of 89% and 85% respectively.ConclusionIt is possible to demonstrate that techniques based on digital image processing are a useful tool to support the processes of analysis and diagnosis of samples in medical patients with P. jirovecii Pneumonia. In addition, the obtained results demonstrate that methods based on deep learning allow us to develop more precise and accurate analysis methodologies for the analysis of patient samples with P. jirovecii Pneumonia. Our model can be improved by adding new layers, but this would introduce even more hyperparameters that should be adjusted. We intend to extend our model architecture in other areas of medical imaging with the usage of deep learning and computer vision techniques.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P344
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P345 The relationship between virulence of Candida albicans and
           environmental oxygen concentration

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCandida species are known to colonize human skins and mucous membranes, and cause candidemia under various immunosuppressive conditions. Among these Candida species, C. albicans is reported to be the most frequently isolated species, and could colonize on skins, vaginas, gastrointestinal tracts, and medical devices. Environmental factors including oxygen concentration is thought to affect the capability of colonization and virulence of Candida species; however, most previous research was performed under aerobic condition, and few research focused on hypoxic conditions imitating inside the human bodies. Given these backgrounds, we performed murine experiments by culturing C. albicans under various oxygen conditions to evaluate the effect of environmental oxygen concentration on virulence. Through our studies, we aimed to clarify the actual behavior of C. albicans in the human body.MethodsIn this study, female C57BL/6 mice, 7-8 weeks old, were used and injected via lateral tail vein to cause C. albicans dissemination. Mice were divided into 4 groups according to the pre-culture conditions: aerobic, microaerobic (5% oxygen concentration), microaerobic (1% oxygen concentration), and anaerobic. Under each oxygen condition, C. albicans was grown at 37°C for 2 days on yeast extract peptone dextrose (YPD) agar and then incubated in YPD broth for 16-24 h. After incubation, C. albicans was collected, washed, resuspended in sterile PBS, and injected into each mouse at ∼2.5 × 105 colony-forming units. In this study, one reference strain (SC5314) and one clinically isolated strain (from bloodstream infection) were used. These infected mice were euthanatized 2 or 4 days after injection, and organ (kidneys and brain) fungal burdens were evaluated.ResultsThe kidneys’ fungal burdens were significantly higher in the microaerobic groups than those in the aerobic or anaerobic groups 2 and 4 days after injection. There were no significant differences between 5% oxygen concentration pre-cultured group and 1% oxygen concentration pre-cultured group. On gross examination, disseminated lesion formations were visible in the kidneys of the microaerobic groups. Similarly, the fungal burdens of brain were significantly higher in the microaerobically pre-cultured groups than in the aerobically or anaerobically pre-cultured groups. This tendency was similar for both the reference and clinically isolated strain.ConclusionOur results indicated that C. albicans could become more virulent under hypoxia, especially under microaerobic conditions. We assumed that some virulence factors of C. albicans were elevated under microaerobic conditions. These results implicated that C. albicans could become more virulent under hypoxic conditions in human bodies. In the future, we will continue to evaluate factors related to this change in virulence and pathological analysis of infected organs.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P345
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P346 Pulmonary fungal infection in Sudan, a retrospective study from the
           Mycology Reference Laboratory

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesPulmonary fungal infections are life-threatening diseases, if not diagnosed and properly treated can lead to serious complications. In chronic cases, the condition might mimic tuberculosis and may be misdiagnosed. The aim of this retrospective study is to determine the frequency of fungi among the respiratory samples received at the mycology reference laboratory over 5 years period and to provide a view of the burden of pulmonary fungal diseases in the country.MethodsA total of 713 sputum samples received at the Mycology Reference Laboratory, Khartoum, Sudan, between 2015-2019 were analyzed. These samples were collected from different health care centers in Khartoum state. For every sample, direct microscopy using 20% KOH and methylene blue stain was performed. In addition, cultures were made by inoculating every sample in three tubes of Sabouraud dextrose gar (SDA) containing chloramphenicol. Tubes were incubated at 37°C for 2 and up to 7 days. Isolated fungi were identified phenotypically using the Atlas of Clinical Fungi guidelines.ResultsOut of the 713 samples, 235 (33%) were positive for fungi; both in the direct microscopy and culture. Cultures were identified as Aspergillus species 38 (16%), while 197 (84%) were found to represent Candida species.ConclusionOur study showed a high number of fungi is associated with pulmonary conditions in Sudan. Risk factors might include post tuberculosis, Asthma, HIV, and COPD.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P346
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P348 tRNA modifications in Candida virulence

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMCandida albicans is a normal commensal of the gastrointestinal tract, but also an important opportunistic pathogen that can cause life-threatening infections. An important pathogenicity factor of C. albicans is its ability to form hyphae, which are associated with the expression of many different virulence factors. The regulation of hypha formation has been analyzed extensively on the transcriptional and also post-translational level in the past.Candida albicans has a closely related sister species, C. dubliniensis, which has a lower propensity to form hyphae and only very rarely causes more than superficial infections. We investigated the differences in the genetic setup of these two species and found a gene whose Saccharomyces cerevisiae homolog is involved in tRNA modifications.We here show that this gene, Hma1, acts as a tRNA-threonyl carbamoyl adenosine dehydratase in C. albicans, and that its activity differs between C. albicans and C. dubliniensis. A deletion mutant shows specific defects in hyphae formation, invasion of host cells, and in virulence in C. albicans. Furthermore, we find that the loss of this tRNA-modifying enzyme leads to changes in ribosome occupancy at 37°C, the temperature encountered in the host.With these data we link tRNA modifications to host-induced processes of one of the most important fungal pathogens of humans. We thereby add another layer of regulation, between transcription and post-translational modifications, to the virulence program of Candida yeasts.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P348
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P349 Relationship between genotypes and in vitro pathogenic behavior of
           Uruguayan strains of Cryptococcus spp.

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: Contribute to the knowledge of the relationship between genetic and pathogenic characteristics of meningeal cryptococcosis-producing strains from Uruguay.MethodsWe have included a total of 21 isolates of Cryptococcus spp from human cases of meningoencephalitis. We start from the general strain collection of the mycology laboratory of the department of parasitology and mycology, medical school, University of the Republic. The strain was sectioned taking into account the phenotypic diversity and genetic diversity through a previous analysis by PCR fingerprinting, for study by MLST.MLST was performed according to the protocol available at: http://mlst.mycologylab.org/defaultinfo.aspx'Page= CryptoHome.Infection, intracellular survival, and cell proliferation assays were performed. The murine macrophage cell line J774 (ATCC TIB 67) was used.ResultsOf the 21 strains studied, in 13 we obtained an ST that had been previously reported (9 C. neoformans complex and 4 C. gattii complex). For the remaining 8 strains, we obtained new allelic combinations to which new STs were assigned, which were deposited in the MLST database for Cryptococcus spp. (http://mlst.mycologylab.org) (Table 1).All strains were phagocytosed and all were able to persist within macrophages at 24 h post-infection, although there was great variability between strains (Table 1). In most of the strains, the control of macrophages prevailed through cell lysis mechanisms over Cryptococcus spp, with one proliferation index (PI) ˂1.0. In the proliferation assay, only 4 strains managed to proliferate within the macrophages, 3 of them correspond to C. gattii complex, genotypes VGI and VGII. The 4th strain that achieved proliferation was corresponding to the VNI genotype.ConclusionWe obtained a clear differentiation of in vitro behavior between the strains corresponding to C. neoformans complex and C. gattii complex. The strains belonging to C. gattii complex presented less phagocytosis and greater persistence and intracellular proliferation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P349
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P466 Isolation of Cryptococcus neoformans and other yeast from pigeon
           droppings in Khartoum state, Sudan

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesThe aim of this study was to investigate the presence of Cryptococcus neoformans and other yeast species in pigeon droppings in Khartoum state, Sudan.MethodsSample collection A total of 120 samples were collected from pigeon droppings from Khartoum state. Pigeon droppings were collected using sterile wooden spatulas and placed directly in clean plastic bags.Processing of sampleApproximately 2 g of pigeon droppings were added to 10 ml of sterile saline. The samples were allowed to stand for 20 min with frequent vortex.Isolation and Identification of yeast isolatesA loopful of supernatant fluid from prepared samples was taken and streaked onto Sabouraud's dextrose agar media supplemented with 0.05 mg/ml chloramphenicol incubated at 37°C for 1-2 days. All yeast isolates were identified by direct microscopic examination using the lacto-phenol-cotton-blue stain India ink stain and Gram's stain. Further confirmatory tests were conducted using Corn Meal Agar (CMA) with tween 80, germ tube production test using horse serum, and urease test. Confirmation of identification was done using API 20C AUX and API ID 32C AUX (bioMérieux®, Madrid, Spain).ResultsCryptococcus neoformans is the most common species isolated from pigeon droppings as shown in Table 1. Different Candida species have been isolated Figure 1.Isolated yeastNumberCryptococcus neoformans42Candida spp34Cryptococcus albidus5Stephanoscus ciferrii4Rhodotorula glutinis4Rhodotorula mucilaginosa3Geotrichum capitatum2Zygosaccharomyces spp1ConclusionThe present study concluded that there is a potential role of pigeons as a reservoir for C. neoformans and other zoonotic yeasts in the environment that can affect humans and animals.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P466
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P467 Aspergillosis in Humboldt penguins — susceptibility patterns of
           clinical and environmental isolates from a Belgian zoo, 2018-2022

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesAvian aspergillosis causes a heavy burden on birds in captivity, such as Humboldt penguins. In recent years the colony of a Belgian zoo has experienced very high mortality rates and the zoo has already taken several measures to lower the burden. This study was set up to see if the penguins acquire A. fumigatus via the environment and if so, if additional measures can be taken to limit the incidence.MethodsA total of 29 clinical strains collected from 2018 to 2022 were included in the study. From April 2021 until January 2022, four samplings have been performed, accounting for every season. A combination of sand, water, nest swabs, and air was analyzed for the presence of (azole-resistant) A. fumigatus. In brief, air samples were collected at fixed locations in the penguin enclosure by impacting 1000 L on an agar plate [malt + chloramphenicol (MC) and MC + tebuconazole (MC + T)]. A total of 100 mL water was collected and 50 mL water was filtered through a 0.22 μm filter and placed on an MC plate, and repeated with the other 50 ml on MC + T. A total of 9 ml 0.1% Tween 20 + 0.85% NaCl was added to 1 g of sand and vortexed for 1 min. Both MC and MC + T plates were incubated with 100 μL of this suspension. All plates were incubated at 48°C ± 1°C for 48 h. The phenotypical resistance pattern of all clinical isolates was determined using the EUCAST method.ResultsThe phenotypical resistance pattern showed resistance in 7 isolates (24%) with 5 of them showing resistance to posaconazole, one was resistant against voriconazole, isavuconazole, and posaconazole, and 1 showing pan-resistance. No A. fumigatus colonies could be detected from water samples, nor from the sand. One A. fumigatus isolate was retrieved from the nest swabs. In total 64 A. fumigatus colonies were isolated from air samples collected on MC + T medium. All have been subjected to EUCAST microbroth dilution determination and 4 resistant isolates could be detected (all had a MIC value for posaconazole of 0.5 μg/ml and one strain showed additional resistance against isavuconazole with a MIC of 4 μg/ml. Cyp51a sequencing of all resistant strains is ongoing and will give more insight in the molecular mechanisms involved to investigate the potential link with the environment.ConclusionThis study showed high resistance rates in the clinical isolates. Four resistant isolates were found in environmental air samples. Sequencing of the cyp51A gene will give more information on a possible relation between the resistance mechanisms found in the clinical and the environmental isolates. More research should be done to investigate the origin of the resistant isolates in the environment.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P467
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P468 Aspergillosis in a colony of Humboldt penguins (Spheniscus humboldti)
           under managed care: a clinical and environmental investigation in a French
           zoological park

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesAspergillosis is an opportunistic fungal infection due to Aspergillus spp., and primarily A. fumigatus. The disease is pervasive in avian populations, especially those under managed care. The incidence and the management of avian aspergillosis can be critically impacted by exposure to high levels of spores via environmental contamination and by strains resistant to azole drugs. The present study aimed at assessing the impact of environmental contamination on the clinical incidence of aspergillosis in penguins managed under human care. ZooParc de Beauval was chosen for the investigations, because this zoological facility hosts a large colony of Humboldt penguin (Spheniscus humboldti) and it is geographically located in the rural countryside of the Loir-et-Cher district, France, surrounded by numerous large crop fieldsMaterial and methods: The fungal contamination in the environment was assessed through three serial sessions of surface sampling in bird nests: all isolates were counted, identified by DNA sequencing, and then systematically screened for resistance mutations and MICs (minimal inhibitory concentrations) elevation for the A. fumigatus strains. In addition, the clinical incidence of aspergillosis was evaluated in the penguin population over a 3-year period. A microsatellite-based analysis tracked A. fumigatus isolates circulation.ResultsEnvironmental investigations highlighted a substantial increase in the fungal load during the Autumn season (>12-fold vs. the other timepoints) and a large overrepresentation of species belonging to the Aspergillus section Fumigati (ranging from 22.7 to 94.6%) (Fig. 1). Only one cryptic species (A. nishimurae) and one isolate exhibiting resistance mutation (G138S in the cyp51A gene; MIC itraconazole >4 μg/ml) were detected. The overall incidence of aspergillosis was measured at ∼3.4% case-years and was observed mostly in juvenile penguins (Fig. 1). The analysis of microsatellite polymorphism revealed a high level of genetic diversity among A. fumigatus isolates, except for one strain that was largely over-represented during the Autumn sampling session. A limited number of isolate genotypes was collected from clinical cases and from the environment.Conclusions: Fungal environmental contamination and incidence of aspergillosis in penguins appeared variable depending on seasons, but the rural location of the penguin habitat did not seem to influence the emergence of resistant strains.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P468
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P469 Feline aspergillosis caused by Aspergillus candidus: A case report

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMAspergillosis is an emerging mycosis that can occur in apparently healthy animals under environmental stress or immune-compromised condition. In cats, the clinical forms described are sinonasal, synoorbital, and, less frequently, invasive and disseminated forms.Feline aspergillosis is caused mainly by cryptic species of Aspergillus closely related to Aspergillus fumigatus. It is rare to recover species such as A. candidus, an endophytic fungus, opportunistic pathogen, and contaminant of cereals, nuts, and flour. It is described to cause allergic alveolitis or asthma, mycotoxicosis, and other related diseases. Mycelial fragments, inhaled spores, and substances such as terpenoids, flavones, and indoles in the lungs could be involved in the underlying pathogenesis.This presentation aims to describe a clinical case of feline pneumonia caused by A. candidus.Clinical case: We present the clinical case of a common European breed feline of ∼ 7 years of age. The cat was rescued from the streets of an urban area in Buenos Aires and examined in April 2021. The feline suffered from mild hyperthermia, 39.4°C, had pale to slightly purple mucous membranes, cachexia, dehydration, dyspnea (abdominal respiration), tachycardia, and a large number of parasites. There were no nasal discharge, cough, or skin lesions. A hemogram with a blood biochemistry profile showed no significant alterations. Chest X-rays showed a pattern compatible with severe miliary pneumonia. A bronchoalveolar lavage (BAL) was performed for cytology and microbiological culture; direct examination showed nucleated superficial epithelial cells without atypia, few macrophages, no leukocytes, and gram-positive cocci, while ZN and mycological direct examination were negative. Treatment with doxycycline 10 mg/k every 12 h and dexamethasone was indicated. Flea treatment and control were conducted every 72 h. During the following consultations, the cat continued tachypnoeic and showed increased vesicular murmur with rales and cough. Corticosteroids (Fluticasone propionate 125 mg) were given every 12 h intranasal. Oral parasitization was performed due to the presence of Dipylidium caninum in feces. After 7 days of incubation, white cottony colonies phenotypically identified as Aspergillus grew on Sabouraud dextrose agar. Even though serum galactomannan GM (Platelia Aspergillus EIA BIORAD®) is useful as a biomarker in humans with OD >0.5 positive for invasive aspergillosis, it was used in this case and the result was OD 0.75. Antifungal treatment was started with itraconazole orally at 5 mg/kg/d. A mycobacterial culture was negative.The isolate was identified by partial sequencing of the calmodulin gene CaM as A. candidus.The feline showed a remarkable recovery. After 35 days from the start of the treatment, the final consultation showed a decrease in the pattern of military pneumonia through radiological images and an absence of any evident respiratory symptoms.ConclusionWe describe a fungal infection in a cat caused by an unusual species of Aspergillus. Moreover, this clinical case was proved to be pneumonia. Given this, it is important to consider this species as an emerging pathogen in cats.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P469
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P470 Determination of the virulence potential of yeast fungi isolated from
           cattle milk

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMIt is reported about the activity of proteolytic enzymes and phospholipases of yeast fungi of the genus Candida isolated from raw milk of clinically healthy cattle in some regions of Russia. The most common species were C. kefyr (16%), C. membranifaciens (15%), C. catenulata (13%), C. rugosa (9%), C. lambica (8%), C. pararugosa (7%), C. krusei (7%), and Candida albicans (6%). Candida albicans isolates had the highest enzyme activity, C. membranifaciens had the lowest.ObjectivesProteolytic enzymes and phospholipases are known to be pathogenic factors in yeast fungi of the genus Candida. We examined raw milk taken from clinically healthy cows to determine the diversity of yeast fungi of the genus Candida that are found in milk, and also determined the activity of proteolytic enzymes and phospholipases of isolated isolates.MethodsRaw milk samples (50 ml) were taken after the treatment of the udder with antiseptic agents, manually into sterile plastic tubes of the Falcon type, immediately before the planned milking. Then the samples were cooled to + 4°C and transported to the laboratory in this form.Isolation of yeast fungi: 1 ml of milk was mixed with 20 ml of melted and cooled to 45°C Sabouraud medium with the addition of an antibiotic (M063 + FL033, HiMedia), poured into Petri dishes, and cultivated for 48 h. The isolated yeast fungi were inoculated onto a tube-slant wort-agar medium (M129, HiMedia).Identification: Yeasts were identified using MALDI-TOF MS according to the standard procedure.Determination of enzyme activity: filter paper discs (diameter 5.0 mm) were impregnated with 10 μL of pure culture with a density of 0.5 McF and laid out on the surface of the nutrient medium, cultivated at + 37°C for 7 days.Enzyme activity was determined as the ratio of the diameter of the substrate hydrolysis zone to the disk diameter.The composition of the nutrient medium for determining the activity of proteolytic enzymes: YCB (HiMedia) 11.7 g, Yeast extract 1.0 g, bacteriological agar 15.0 g, 1.0 g BSA after autoclaving. To assess the zone of hydrolysis, the surface of the nutrient medium was stained after cultivation with a 0.1% solution of Amido Black.The composition of the nutrient medium for determining the activity of phospholipases: glucose 30.0 g, bacteriological peptone 10 g, 1 M NaCl, 5 mM CaCl2, bacteriological agar 15.0 g, 80 ml egg yolk emulsion after autoclaving.ResultsAs a result of the research, 257 isolates of yeast fungi of the genus Candida were segregated. The most common were tested for proteinase and phospholipase activity, the results are presented in Table 1.ConclusionYeast fungi known to be pathogenic for animals, such as C. albicans and C. krusei, have been isolated from the milk of healthy cows. Isolates of C. catenulata, C. rugosa, and C. pararugosa have a high activity of proteinases and phospholipases. Based on the results obtained, it was concluded that these types of yeast fungi have the potential to infect the host.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P470
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P471 Feline sporotrichosis outcome and its impact in public health in
           Southern Brazil

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMSporotrichosis due to Sporothrix brasiliensis is an emerging and neglected disease in Brazil. Domestic cats are susceptible to a severe presentation of this mycosis, carrying a high fungal load in their lesions. They frequently infect other animals and even humans by scratches and/or bites. Thus, the correct management and treatment of feline sporotrichosis are crucial aspects of the control of the disease in a population.Objective: We aimed to evaluate the management and outcome of feline sporotrichosis cases in a hyperendemic city in southern Brazil (Rio Grande do Sul state).MethodsDatabase from the Mycology Laboratory (LabMyco) of the Federal University of Rio Grande (FaMed–FURG) was consulted to gather data from all proven feline sporotrichosis cases (confirmed by mycological culture), between January 2019 and December 2021. It was included in this study in all cases in which the phone number of the cat owners was available. All of them were contacted and invited for an interview by quick and short questions regarding the management and the outcome of their cats with sporotrichosis. Disagreement to participate, and change/incorrect phone number contacted were used as exclusion criteria.ResultsDuring the 3-year period studied a total of 62 owners, from 165 felines diagnosed with sporotrichosis in the LabMyco, had a phone number available. A total of 35 owners were excluded, totalizing 27 participants in this study. More than half (51.8%; n = 14) reported returning only once to the veterinarian to clinical accomplishment, 48.1% (n = 13) of them do not use personal protective equipment to handle the infected animal, 44.4% (n = 12) highlighted the difficulty in daily administering drugs to the cat and only 18.5% (n = 5) affirmed to had isolated the infected animal during the treatment. Two animals (7.4%) with advanced signs of disseminate sporotrichosis died before starting treatment, and the others received itraconazole and/or potassium iodide as the drug of choice. Clinical cure was achieved in 40% of the cats treated (10/25), 28% (7/25) evolved to death, 16% (4/25) are still in treatment due to new lesions (recidive), and the other four animals were abandoned in the streets. In addition, zoonotic transmission occurred in three (11.1%) owners, which developed lymphocutaneous sporotrichosis after a scratch or bite by the infected cat.ConclusionSporotrichosis in Southern Brazil is a public health threat, in view of this, our study shows the urgent necessity of government strategies and interventions that promote health education and implement a service to attend, and provide treatment accomplishment to feline sporotrichosis in view of control the current hyperendemic of this mycosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P471
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P472 The mechanism of action of antifungal activity of Zanthoxylum armatum
           fruit's oil against Candida cells does not involve ROS generation

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjective: To explore the antifungal activity of Zanthoxylum armatum fruit's oil against different Candida species and its mechanism of action.MethodsThe Z. armatum fruit's oil activity was assessed against C. albicans, C. krusei, C. glabrata, C. parapsilosis, C. tropicalis, and C. guilliermondii through different drug susceptibility assays including, MIC, agar diffusion and spot assay. The mechanism of action was explored through sterol analysis, germ tube inhibition, epithelial cells adherence, and ROS generation.ResultsThe oil from the fruits of Z. armatum was subjected to GC-MS analysis, and linalool (72%) was found as the major component. The drug susceptibility measured through different methods, including minimum inhibitory concentration (MIC), where end-point was 3% v/v for different species tested, and the same pattern was observed in agar diffusion and spot assay. The antifungal activity was found to be fungicidal in nature and the major reason appeared to be the reduction in ergosterol levels inside cells. It resulted in lowered germ tube formation, an important indicator in virulence of C. albicans. The oil reduced adherence of Candida cells to buccal epithelium significantly, which is the first step in invasion, biofilm formation, and damage to oral epithelial cells. Interestingly, unlike most antifungals, where reactive oxygen species generation mediated killing is involved, was not found significant in the present study.Conclusions: The Z. armatum fruits oil exerts its antifungal activity by inhibiting ergosterol formation and reduced germ tube formation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P472
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P473 Genomic epidemiology of antifungal-resistant Candida auris in
           Colombia

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMIntroduction: Candida auris is a public health threat. Five major clades of C. auris have been identified (Clades I–V). In Colombia, C. auris infections were first reported in 2016 with ongoing transmission reported from multiple cities. Here, we describe C. auris genomic epidemiology in Colombia detailing cases from 2016–2021.MethodsA total of 99 isolates from C. auris cases were collected between June 2016 to January 2021 in Colombia, representing 11 geographic locations. Species confirmation, antifungal susceptibility testing, and whole-genome sequencing (WGS) were performed. In all, 37 genomic sequences generated previously from isolates from C. auris cases in Colombia, Venezuela, Panama, Israel, and United States were also analyzed MycoSNP workflow was used to assess sequence quality, map reads to the reference, and identify single-nucleotide polymorphisms (SNPs). Pairwise distances and a neighbor-joining tree were generated. IQtree was used to generate a maximum-likelihood tree with bootstrap values.ResultsPhylogenetic analysis identified 1 493 SNP positions. Isolates from Colombia clustered to Clade IV and predominately grouped by country except for 16 fluconazole-resistant isolates from Bogota, Colombia that grouped with five isolates from Venezuela. In this cluster, 20 (95%) were resistant to fluconazole and 5 (24%) were resistant to fluconazole and the echinocandin micafungin. Remaining isolates from Bogota did not group in this cluster and were susceptible to fluconazole and micafungin.A total of 98 isolates from Colombia clustered together. Within this Colombian cluster, there were two subgroups that had bootstrap support of 100% and were separated by 13 SNPs. The first subgroup was a cluster that contained 18 isolates from the north coast; 17 (94%) isolates were resistant to amphotericin B. A second subgroup consisted of 26 isolates from Cesar and Norte de Santander, and 22 (84%) isolates were resistant to fluconazole.Conclusions: Based on the phylogenetic reconstruction, C. auris in Colombia continues to be of Clade IV. Amphotericin B-resistant isolates were predominately from the north coast, fluconazole-resistant isolates were from a wider geographic area in Colombia, and echinocandin-resistant isolates were from Bogota. Within the Colombian cluster comprising two subgroups, we observed high genetic relatedness between isolates from different geographic locations suggesting transmission among cities.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P473
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.1a Fusariosis: MICs, mono versus combination therapy and fosmanogepix

    • Abstract: Abstract S4.1 Treatment of rare mold infections in 2021: the role of new and old antifungals, September 22, 2022, 10:30 AM - 12:00 PMFusarium is one of the most clinically prevalent rare molds causing superficial infections such as keratitis in immunocompetent hosts and severe disseminated infections frequently presenting as fungemia in the immunocompromised. These fungi are ubiquitous in nature and are found in soil and air. Only a few of the ˃ 70 Fusarium spp. are opportunistic pathogens in humans. F. solani and F. oxysporum species complexes are specifically important, causing ˃50% and about 20% of severe fusariosis cases, respectively. Although galactomannan and also beta D glucan may result positive in fusariosis, fungal culture from either blood, BAL, or skin biopsy remains the most frequently utilized test for diagnosing fusariosis. Susceptibility testing of isolates recovered in culture should be used for epidemiologic purposes in defining the range of minimal inhibitory concentrations (MIC) distribution of Fusarium spp., however, studies that prove that susceptibility testing results should be utilized to inform antifungal drug choice are lacking. Although there are no interpretive breakpoints for antifungal agents against Fusarium spp., compounds with MICs that are off-scale, such as >16 μg/ml, at the highest range of concentrations are unlikely to be active in vivo or in patients. Initial combination therapy with a lipid formulation of amphotericin B plus voriconazole, deescalated to monotherapy once MICs come back, is, therefore, a frequently chosen management pathway.A number of drugs in the antifungal pipeline will present additional treatment options for Fusarium, including Fosmanogepix and Olorofim.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.1a
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.1d In vitro activity of eight antifungals against 3343 filamentous
           pathogenic fungi collected during 18 years at the French National
           Reference Center for invasive mycosis and antifungals

    • Abstract: Abstract S4.1 Treatment of rare mold infections in 2021: the role of new and old antifungals, September 22, 2022, 10:30 AM - 12:00 PMBackground & Objectives: The NRCMA oversees the surveillance of invasive fungal diseases in France. As part of our expertise, we perform antifungal susceptibility testing based on European Committee on Antimicrobial Susceptibility Testing (EUCAST) methodology on all isolates. The antifungal profiles help us monitor the emergence of resistant isolates, determine the susceptibility pattern of wild-type strains to new antifungals, and in specific cases, determine the relationship between clinical failure and selection/emergence of a less susceptible isolate.We review the Minimum inhibitory concentrations (MIC) distribution of eight antifungals on clinical isolates of filamentous fungi identified at the NRCMA from 2003 to 2021.MethodsSpecies identification was performed by a combination of morphological features and multilocus sequencing. Only strains that produced enough conidia or spores were tested. In vitro susceptibility testing was performed according to the EUCAST procedure. Eight antifungal agents were used: triazoles [itraconazole, voriconazole, posaconazole, isavuconazole (since 2015)], echinocandins (caspofungin, micafungin), amphothericin B, and terbinafine. The concentrations inhibiting 50% (MIC50) and 90% (MIC90) of the isolates were determined for species with at least 5 and 10 isolates, respectively. For Aspergillus fumigatus isolates exhibiting high azole MICs, we sequenced the cyp51A gene for mutation screening.ResultsMICs were obtained for 3343 pathogenic strains. We identified Aspergillus spp. including cryptic species (32%), Fusarium spp. (21%), Mucorales (18%), phaeohyphomycetes (10%), i.e., Alternaria spp., Curvularia spp., Fonsecaea, Exophiala, Phaeoacremonium, rare hyphomycetes (9%), i.e., Rasamsonia, Paecilomyces, Trichoderma, Scopulariopsis. Scedosporium spp. (7%) and emergent pathogens such as Nannizziopsis obscura (1%), dimorphic fungi (1%), or to a less extent basidiomycetous molds. Examples of MIC results are presented in Table 1.For the nine genera of the order Mucorales, amphotericin B (AmB) exhibited low MICs except for Cunninghamella species and Saksenaea vasiformis. Posaconazole had variable activity depending on the species (high MIC values were observed for Mucor species) while voriconazole and echinocandins had none.In section Fumigati, amphotericin B MIC values were high due to the intrinsic resistance of cryptic species Aspergillus lentulus and A. udagawae. Other cryptic species were identified such as A. hiratsukae isolates which exhibited low MICs to all antifungals.Members of Aspergillus section Nidulantes such as A. nidulans and A. quadrilineatus showed variable MICs to caspofungin and amphotericin B.Among melanized fungi, Alternaria infectoria and A. alternata species group displayed low MICs of all azoles with the exception of voriconazole.Four Exophiala species were analyzed and had similar azole MICs, E. spinifera being the species with the lowest values.Multi-drug resistant profiles were observed especially in species belonging to Microascales such as Lomentospora prolificans, Microascus cirrosus, and Scopulariopsis brevicaulis. Members of Fusarium species complexes had predictably high MIC values to all antifungals including isavuconazole. Only Fusarium dimerum species complex had low MICs to amphotericin B.Further distribution analysis is ongoing. These large datasets provide a baseline for monitoring the emergence of antifungal resistance in our country and supports the fact that MIC determination should be performed for rare/emergent species and also in case of infections due to cryptic species, which would benefit patient management.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.1d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.2d Efficacy of LD Bio Aspergillus ICT lateral flow assay for
           serodiagnosis of chronic pulmonary aspergillosis

    • Abstract: Abstract S4.2 Advances in diagnosis of invasive fungal infection, September 22, 2022, 10:30 AM – 12:00 PMBackground: The diagnosis of chronic pulmonary aspergillosis (CPA) relies on the detection of IgG Aspergillus antibody which is not freely available, especially in resource-poor settings. Point-of-care tests like LDBio, evaluated in only a few studies, have shown promising results for the diagnosis of CPA. However, no study has compared the diagnostic performances of LDBio in the setting of tuberculosis endemic countries and has compared it with that of IgG Aspergillus.ObjectivesThis study aimed to evaluate the diagnostic performances of LDBio in CPA and compare it with the existing diagnostic algorithm utilizing ImmunoCAP IgG Aspergillus.MethodsSerial patients presenting with respiratory symptoms (cough, hemoptysis, fever, etc) for >4 weeks were screened for eligibility. Relevant investigations including respiratory secretions stain/culture, IgG Aspergillus, chest imaging, etc were done according to the existing algorithm. Serum of all patients was tested by LDBio and IgG Aspergillus (ImmunoCAP) and their diagnostic performances were compared.ResultsA total of 218 patients were screened and 174 patients were included in the study with ∼ 66.7% of patients having a past history of tuberculosis. A diagnosis of CPA was made in 74 (42.5%) patients. The estimated sensitivity and specificity of LDBio was 67.6% [95% confidence interval (CI), 55.7%-78%] and 81% (95% CI, 71.9%-81%) respectively which increased to 73.3% (95% CI, 60.3%-83.9%), and 83.9% (95% CI, 71.7%-92.4%) respectively in patients with past history of tuberculosis. The sensitivity and specificity of IgG Aspergillus was 82.4% (95% CI, 71.8%-90.3%) and 82% (95% CI, 73.1-89%); 86.7% (95% CI, 75.4%-94.1%), and 80.4% (95% CI, 67.6%-89.8%) in the whole group and those with past history of tuberculosis respectively. The baseline characteristics and diagnostic accuracies are listed in Tables 1 and 2 respectively.Conclusions: LDBio is a point-of-care test with reasonable sensitivity and specificity. However, further tests may have to be done to rule-in or rule-out the diagnosis of CPA in the appropriate setting.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.2d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.3b Candida glabrata-host interactions

    • Abstract: AbstractS4.3 Emergent species of the Candida genus, September 22, 2022, 10:30 AM - 12:00 PMCandida glabrata is among the most common pathogenic yeasts of humans. Yet, this fungus is phylogenetically, genetically, and phenotypically very different from other clinically relevant Candida species. This includes an unusual high level of intrinsic resistance to antifungals such as azoles. Furthermore, in contrast to the rather aggressive pathogenicity mechanisms of the dominant Candida species, C. albicans, C. glabrata seems to have evolved strategies that are based on stealth, evasion and persistence, without causing severe host cell damage during infection. For example, C. glabrata is unable to invade epithelial cells in vitro and causes only low levels of damage in standard in vitro infection models. However, the addition of a single common host protein, albumin, strongly enhances the damage potential to vaginal epithelial cells.Similar to other Candida species, the potential of C. glabrata to survive in human blood is low. However, C. glabrata can survive within macrophages for long periods without causing host cell damage and responses. This intracellular stage requires the acquisition of nutrients, such as biotin, facilitated by defined biotin up-take systems. Survival in macrophages is further supported by transient mitochondria dysfunction: C. glabrata is able to switch into a petite phenotype upon interaction with human phagocytes. The petite phenotype significantly differs from non-petite cells in its growth behavior, its interactions with the immune system, and even its resistance to antifungal drugs. Effectively, the interaction with phagocytes can render C. glabrata mostly resistant to commonly used azole drugs, and vice versa (‘cross resistance’), providing a principle mechanism by which intrinsic antifungal resistance may have evolved.Sources: Seider et al. (2011) The facultative intracellular pathogen Candida glabrata subverts macrophage cytokine production and phagolysosome maturation. J Immunol. 187(6):3072-86.Brunke and Hube. (2013) Two unlike cousins: Candida albicans and C. glabrata infection strategies. Cell Microbiol. 15(5):701-8.Kämmer et al. (2020) Survival strategies of pathogenic Candida species in human blood show independent and specific adaptations. mBio 11(5):e02435-20.Sprenger et al. (2020) Fungal biotin homeostasis is essential for immune evasion after macrophage phagocytosis and virulence. Cell Microbiol. 22(7):e13197.Pekmezovic et al. (2021) Candida pathogens induce protective mitochondria-associated type I interferon signalling and a damage-driven response in vaginal epithelial cells. Nat Microbiol. 6(5):643-657.Pekmezovic et al. (2021) Human albumin enhances the pathogenic potential of Candida glabrata on vaginal epithelial cells. PLoS Pathog. 17(10):e1010037.Siscar-Lewin et al. (2021) Transient mitochondria dysfunction confers fungal cross-resistance against phagocytic killing and fluconazole. mBio 12(3):e0112821.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.3b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.3d Mechanism of fluconazole resistance in Candida vulturna, a member of
           the Candida haemulonii complex of multidrug - resistant yeasts

    • Abstract: Abstract Emergent species of the Candida genus, September 22, 2022, 10:30 AM - 12:00 PMObjetives: Candida vulturna is an emerging yeast firstly isolated in 2016 from flowers and from a blood sample in Malaysia. It is a member of the Candida haemulonii species complex. This complex has 9 species within which C. haemulonii (including the vulnera variety), C. pseudohemulonii, C. duobushaemulonii, C. auris, and now C. vulturna are considered human pathogens. Like the other members of the haemulonii complex, the identification of C. vulturna is difficult. Due to the scarcity of strains to study, the susceptibility pattern of this species is unknown. The objectives of this work were to study C. vulturna strains isolated from clinical samples from different cities of Colombia, to study their susceptibility patterns, and to establish their mechanisms of azole resistance.MethodsFive C. vulturna strains isolated from urine (n = 1) and blood (n = 4) in three different cities in Colombia were studied. Strains were identified as C. duobushaemulonii (n = 4) and C. haemulonii (n = 1) by means of VITEK2 (software version 9.02) and as C. pseudohaemulonii (n = 5) by using Bruker's MALDI-TOF in Colombia. Upon arrival in Argentina, isolates were molecularly identified by sequencing the ITS regions (rDNA). Antifungal susceptibility testing was performed following the CLSI´s M27 4th ed document. Amphotericin B, anidulafungin, caspofungin, 5-flucytosine, fluconazole, isavuconazole, itraconazole, posaconazole, and voriconazole were tested. In addition, ERG11 genes of the five strains were amplified and sequenced.ResultsThe sequences of the ITS regions were analyzed and the 5 strains were identified as C. vulturna (100% homology). All the strains presented low echinocandins MICs (0.06-0.12 μg/ml), 5-flucytosine (0.06-0.12 μg/ml) and triazoles with the exception of fluconazole (isavuconazole: <0.015 -0.12 μg/ml, itraconazole: 0.06-0.50 μg/ml, posaconazole: <0.015-0.015 μg/ml and voriconazole: 0.03-0.50 μg/ml). In the case of amphotericin B and fluconazole, 4 of the 5 strains presented high MICs for both antifungals (>8 μg/ml and >64 μg/ml), while the remaining one presented MIC values = 1 μg/ml for the polyene and for the azole (cross amphotericin B and fluconazole high MICs). The strain with low fluconazole and amphotericina B MICs was the one isolated from urine. ERG11 sequences analysis showed that the 4 strains with high fluconazole MICs (blood isolates) harbor five amino acid substitutions: S119A, P135S, D180E, K266S, N326K (using C. albicans numbering). Only the P135 residue is highly conserved among ERG11 from different species (Fig. 1, box shows the substitution). In addition, this substitution is present in the Erg11p of fluconazole-resistant Debaryomyces hansenii and the P135 residue is located near the Erg11p´s Heme group where azole drugs bind (Fig. 2: Saccharomyces cereviciae Erg11p complexed with voriconazole 3D structure. In yellow the region between Y131 and P135 residues. In grey voriconazole binding the Heme group).ConclusionThis emerging multi-resistant pathogen may be underdiagnosed by the methods commonly used in clinical laboratories. The only method capable of identifying this species is DNA sequencing. The strains studied presented very high MIC values for amphotericin B and fluconazole. The P135S substitution could be responsible for the high fluconazole MIC values observed in 4 of the 5 strains of C. vulturna.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.3d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.5a A randomized, double blind phase II proof-of-concept superiority
           trial of fosravuconazole 200 mg or 300 mg weekly dose versus
           itraconazole 400 mg daily, all three arms in combination with surgery, in
           patients with eumycetoma in Sudan—top line results

    • Abstract: AbstractObjectivesTo determine whether, in addition to surgery, fosravuconazole (Fos) monotherapy of either 200 mg or 300 mg weekly was more effective [defined as complete cure at the End of Treatment (EOT; 52-week) visit] than the standard-of-care 12-month regimen of itraconazole (Itra) monotherapy, in patients with small to moderate eumycetoma lesions caused by Madurella mycetomatis.MethodsThis was a single-center (Mycetoma Research Center, Khartoum, Sudan), comparative, randomized, double-blind, parallel-group, active-controlled, clinical superiority trial in participants with eumycetoma requiring surgery. Participants were randomized in a 1:1:1 ratio. In Arm 1 participants took a loading dose of Fos 300 mg on Day 1, Day 2, and Day 3, followed by a weekly dose of 300 mg for a total duration of 12 months. In Arm 2 participants took Fos 200 mg on Day 1, Day 2, and Day 3, followed by a weekly dose of 200 mg for a total duration of 12 months. In Arm 3 participants took Itra 400 mg daily for 12 months. All patients underwent surgery after 6 months of treatment in which the remaining lesion was removed. Mycetoma lesions were between 2 to ≤16 cm in diameter. The age cut-off was ≥15 years. The diagnosis of M. mycetomatis was confirmed by PCR. Safety monitoring included, among other, severe, and serious treatment-related events.ResultsA total of 122 participants were screened and 104 participants were enrolled (34 in Fos 300 mg, 34 in Fos 200 mg weekly, and 36 in Itra 400 mg). Complete cure after 12 months (EOT) of treatment was demonstrated in terms of an absence of eumycetoma mass, sinuses, and discharge; normal ultrasound of the lesion site or normal MRI; and a negative fungal culture from a surgical biopsy if a mycetoma mass was present. The complete cure rate was assessed in the mITT population. Secondary efficacy analyses were performed in the Per Protocol population. In addition, the influence of age, changes in clinical symptoms and signs, size, and duration of the lesion on outcome was examined. Safety was satisfactory and compliance was good.ConclusionThis is the first randomized controlled trial in eumycetoma, comparing two azoles, fosravuconazole (two dosage regimens) and itraconazole, in combination with surgery. Detailed efficacy and safety results will be communicated and discussed in the oral presentation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.5a
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.5b A randomized, double blind phase II proof-of-concept superiority
           trial of fosravuconazole 200 mg or 300 mg weekly dose versus
           itraconazole 400 mg daily, all three arms in combination with surgery, in
           patients with eumycetoma in Sudan—pharmacokinetic results

    • Abstract: Abstract S4.5 Mycetoma Clinical Trial on fosravuconazole treatment in eumycetoma– Top Line Results, September 22, 2022, 10:30 AM - 12:00 PMObjective: To evaluate the pharmacokinetics (PK) of fosravuconazole (measured as ravuconazole) and itraconazole in patients with mild to moderate eumycetoma caused by Madurella mycetomatis using a non-compartmental PK analysis.MethodsParticipants received either 200 mg or 300 mg ravuconazole once weekly or 400 mg itraconazole daily for a total duration of 12 months. Plasma concentrations of ravuconazole and itraconazole were measured on day 1 of week 1, and on weeks 2, 3, 4, and months 2, 3, 6, and 12 (at end of treatment) for analysis of population PK. The exact time of dosing on the days of sample collection, and the exact time of sample collection within the collection time window, were recorded. Plasma concentrations were quantified using Ultraperformance Liquid Chromatography with fluorescence detection (UPLC-UV). Ravuconazole and itraconazole plasma concentration-time data was performed using a standard two stage approach with non-compartmental analysis. Derived exposure parameters of ravuconazole and itraconazole, including, but not limited to, Cmax and AUC at steady state (AUCs), were calculated. The effect of covariates, such as baseline characteristics/demographics, on PK were explored. AUCs were determined when at least three subsequent samples within one dosing interval were available.ResultsA total of 766 samples of ravuconazole in 68 participants and 226 samples of itraconazole in 36 participants were analyzed. The average concentration of ravuconazole (range) was 3.1 mg/l (0.01-12.33 mg/l), and for itraconazole was 1.59 mg/l (0.01-5.53 mg/l).Detailed Pharmacokinetic results will be communicated and discussed in the oral presentation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.5b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S4.5c Using serum beta-glucan measurements and sequencing of the Madurella
           mycetomatis azole target gene to predict therapeutic outcome during azole
           treatment in human mycetoma

    • Abstract: Abstract S4.5 Mycetoma Clinical Trial on fosravuconazole treatment in eumycetoma– Top Line Results, September 22, 2022, 10:30 AM - 12:00 PMObjectivesEumycetoma is a neglected tropical disease characterized by large subcutaneous swellings and the formation of grains and most commonly caused by Madurella mycetomatis. The currently recommended therapy is a combination of antifungal therapy with an azole and surgery. Itraconazole is the current recommended drug and fosravuconazole, the pro-drug of ravuconzole, is currently clinically investigated. At the moment, there are no epidemiological cut-off values (ECV) for M. mycetomatis for either of these drugs or rapid diagnostic tests which can predict the therapeutic outcome of these treatments. Therefore, in this study, we determined the ECV for these drugs and determined whether there was a correlation between minimal inhibitory concentration (MIC) and the DNA sequence of the azole target gene CYP51A. We also assessed beta-glucan concentrations in the serum of mycetoma patients during treatment to establish whether any of these values were predictive for therapeutic outcomes.MethodsIn order to determine the ECV for M. mycetomatis, MIC distributions for itraconazole and ravuconazole were determined in genetically diverse clinical M. mycetomatis isolates using the ECOFFinder software. CYP51A sequences were sequenced and comparisons were made between the different CYP51A variants and the MIC distributions. Beta-glucan concentrations were measured in serum with the WAKO beta-glucan assay. Time points analyzed were 0, 22, 85, 176, 267, 358, and 455 days after the start of treatment.ResultsFor M. mycetomatis the MICs ranged from 0.008 to 1 mg/l for itraconazole and from 0.002 to 0.125 mg/l for ravuconazole. The M. mycetomatis ECV for itraconazole was 1 mg/l and for ravuconazole 0.064 mg/l. In the wild-type population, two CYP51A variants were found for M. mycetomatis, which differed in one amino acid at position 499. The MIC distributions for itraconazole and ravuconazole were similar between the two variants. No mutations linked to decreased susceptibility were found. Before the start of treatment, beta-glucan concentrations ranged from below the detection limit to 217.9 pg/ml. Of these patients, 61.2% had a beta-glucan concentration above 7 pg/ml, the recommended cut-off value for positivity by the manufacturer, 72.8% had a beta-glucan concentration above 5.5 pg/ml, the recommended cut-off value for M. mycetomatis. During the first months of azole treatment, the beta-glucan concentrations remained relatively stable. After surgery, a sharp decrease in beta-glucan concentration in serum was noted. At the end of the observation period, only 13 patients had a beta-glucan concentration above 7 pg/ml and 14 above 5.5 pg/ml. Of these patients, for only 3, there was clinical evidence of a recurrence. For the remaining 4 patients with clinical evidence of a recurrence, the beta-glucan concentration was below the cut-off value for positivity.ConclusionIn conclusion, so far there was no link established with the initial in vitro susceptibility and failure or success of the treatment therapy. Beta-glucan levels, in general, remained high during azole treatment, and a sharp drop in beta-glucan concentration in serum was only noted after surgery. A positive beta-glucan concentration at the end of the treatment was not indicative of a recurrence.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S4.5c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P060 A preliminary in vitro and in vivo evaluation of the effect and
           action mechanism of 17-AAG combined with azoles against azole-resistant
           Candida spp.

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMInvasive candidiasis is the primary reason for the increasing cases of mortality in a medical environment. The resistance spectra of Candida species to antifungal drugs, among which Candida auris is the most prominent, have gradually expanded.ObjectivesHsp90 plays a protective role in the stress response of fungi and facilitates their virulence. In contrast, Hsp90 inhibitors can improve the resistance of fungi to antifungal drugs by regulating the heat resistance of Hsp90 and thereby destroying the integrity of the fungal cell walls. Therefore, we used Hsp90 inhibitor in combination with different antifungal drugs to explore its antifungal effect and mechanism.MethodsThe drugs tested for the resistance included itraconazole, voriconazole, posaconazole, fluconazole, and 17-AAG. A total of 20 clinical strains of Candida were investigated. The broth microdilution checkerboard technique, as adapted from the CLSI M27-A4 method, was applied in this study. At the same time, the effect of 17-AAG combined with antifungal drugs on the formation of Candida biofilm was observed, and the animal experiment of C. mellonella was carried out in vivo. Moreover, we determined that with the use of rhodamine 6 G to detect drug efflux and that of dihydrorhodamine-123 to detect intracellular reactive oxygen species (ROS).ResultsWe found that 17-AAG alone exerted limited antifungal activity against all tested strains. The MIC range of 17-AAG was 8 to >32 μg/ml. The synergy among 17-AAG and itraconazole, voriconazole, and posaconazole was observed against 10 (50%), 7 (35%), and 13 (65%) of all isolates, respectively. Moreover, the synergy between 17-AAG and fluconazole was observed against 5 (50%) stains of azole-resistant Candida. However, no antagonism was recorded. In vivo test, the combination group also significantly prolonged the infection event and improved the survival of larvae. Treatment with 17-AAG combined with azole drugs inhibited the efflux pump of fungi and promoted the accumulation of ROS in the fungal cells.ConclusionOur result adequately verifies the influence of 17-AAG on the formation of Candida spp. biofilm. The mechanism of 17-AAG combined with azoles could kill fungi by inhibiting drug efflux and increasing intracellular reactive oxygen species. These results thereby provide a new idea to further explore drugs against drug-resistant Candida spp.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P060
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P062 Identification of Octenidine (dihydrochloride) inhibiting fungal
           filamentation by the repurposing approach

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesHyphal formation is an important virulence factor of opportunistic pathogenic fungi and plays a vital role in invasive fungal infections. Therefore, hyphae can act as a specific target against invasive fungal infections and it is a new attempt to focus on identification of compounds inhibiting hyphal growth. Amphotericin B has potent inhibitory effect on the growth of hyphae, but its high toxicity limits its clinical use. To address this question, we performed a high-throughput screen of an FDA-approved compound library (HY-L022, MCE®) to identify compounds with mycelial inhibitory function.MethodsWe performed a high-throughput screen of an FDA-approved compounds library to identify potentially novel compounds for inhibiting hyphal growth and used amphotericin B (1.56 μm) as a positive control drug. The screening schematic is shown in Figure 1a. Firstly, we investigated the mycelial inhibitory activity of each compound at 100 μm in RPMI 1640 medium with Candida albicans SN152 strain. Secondly, micro checkboard dilution method was applied to determine the minimum hyphae-inhibiting concentration of compounds. The compound being included in the next round could inhibit the hyphal formation when its concentration was ≤12.5 μm. Lastly, we expanded medium to YPD containing 10% FBS, YPD containing 5 mm N-acetylglucosamine (GlcNAc), and Spider medium. The final Candidate compound was determined due to its minimum hyphae-inhibiting concentration was ≤3.125 μm in four mediums.ResultsWe screened a library of FDA-approved compound and identified 117 Candidate compounds that inhibit hyphal growth (≤100 μm). We excluded 14 compounds with known antifungal activity, and finally 103 compounds were included in the next step of mycelial inhibitory activity screening (Fig. 1a). We further identified that 14 of 103 Candidate compounds (red square) could significantly inhibit the growth of mycelium at a concentration not higher than 12.5 μm in RPMI 1640 medium (Fig. 1b). We then expanded the types of media that induce mycelial growth (such as YPD medium with 10% FBS, YPD medium with 5 mm GlcNAc, and Spider medium) and used amphotericin B (1.56 μm) as a positive control drug and found that Octenidine (dihydrochloride) still has a significant inhibitory effect on mycelial growth in various mycelial induction media when it is as low as 3.125 μm (Figs. 2a and b).ConclusionOur study demonstrates that Octenidine (dihydrochloride) has a potent hyphal inhibitory activity and is helpful to open the way for the development of new antifungal therapeutics targeting filamentous formation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P062
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P082 Synergistic activity, anti-adherence and anti-fungal abilities of
           fluconazole and voriconazole combined with thymol and carvacrol against C
           andida species

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThe current study aimed to assess the anti-adherence and antifungal activities of thymol and carvacrol against Candida albicans, C. glabrata, and C. krusei isolates obtained from patients with oral candidiasis concerning growth inhibition and fungal death as compared to the synthetic antifungals such as fluconazole and voriconazole.MethodsThe susceptibility assay for the test compounds was performed using the disk diffusion method against all Candida isolates. Also, anti-adherence activity was examined using a rapid and highly reproducible 96 well microtiter-based method.ResultsBoth natural phenols and antifungal drugs revealed various efficacies against studied Candida species. The susceptibility to fluconazole and voriconazole were 100% for C. albicans, 50% and 90% for C. glabrata, and 0% and 100% for C. krusei isolates, respectively. The mean diameter of the inhibition zone was greater for thymol than carvacrol in C. albicans (19.89-0.80 mm vs 17.05-0.61 mm), C. glabrata (18.87-0.71 mm vs 15.77-0.57 mm), and C. krusei (15.11-0.91 mm vs 13.91-1.04 mm) isolates tested.Thymol showed more effective inhibition on adherence of all Candida species than other treatments. The mean relative adherence ratios for C. albicans, C. glabrata, and C. krusei were 0.50, 0.60, and 0.64, respectively.Conclusions: This study demonstrated significant inhibitory properties of thymol and carvacrol on the adherence and growth of azole susceptible- and -resistant Candida isolates. Also, thymol was more effective for preventing the adherence of yeast cells to polystyrene in comparison to carvacrol.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P082
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P083 Susceptibility pattern of fungal isolated from patients with
           otomycosis

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesAntifungal resistance is posing several new concerns to clinicians. Increased rates of azole and echinocandin resistance in various non-albicans Candida species and azole resistance in A. fumigatus may arise due to clinical or environmental exposure to these drugs. The study evaluated the antifungal susceptibility for clinical fungal isolates causing otomycosis.MethodsA total of 89 Aspergillus isolates containing A. niger (58 isolates), A. flavus (19 isolates), A. fumigatus (12 isolates), and 25 Candida isolates containing C. parapsilosis (14 isolates), C. orthopsilosis (6 isolates), and C. albicans (5 isolates) collected from individuals with confirmed otomycosis during October 2020-November 2021 were tested for antifungal susceptibility testing (AFST). AFST of ketoconazole, voriconazole, tioconazole, amphotericin B, miconazole, fluconazole, nystatin, and itraconazole was conducted using the broth microdilution method based on CLSI (M38-A2, M27-A3) protocols. Conidia of molds and colonies of yeasts were harvested from fungal cultures on SDA incubated at 35°C; the turbidity of the suspension was then adjusted to OD630 nm = 80%-82%T for molds and 75%-77%T for yeasts.ResultsMainly, all antifungals examined were effective against most Aspergillus isolates, aside from tioconazole (GM = 5.54767 μg/ml) and nystatin (GM = 2.10151 μg/ml). Terbinafine (GM = 1.69824 μg/ml) had minimal in vitro effects (Table 1). Nystatin (GM = 2.94853 μg/ml) and itraconazole (GM = 1.08673 μg/ml) showed higher GM MICs against all Candida species isolates. Conversely, amphotericin B (GM = 0.07129 μg/ml) in Aspergillus, ketoconazole (GM = 0.02570), and voriconazole (GM = 0.03686 μg/ml) in Candida showed the highest antifungal activity (Table 2). Regarding the CLSI-M59 document for ECV, one A. niger (MIC 8 μg/ml), A. flavus (MIC 2 μg/ml), and A. fumigatus (MIC 2 μg/ml) isolates were non-wild type against itraconazole. A total of 3 A. niger non-wild type isolates with MIC 4 μg/ml against voriconazole were inspected (Table 1). Three C. albicans isolates with high itraconazole MICs (two 8 μg/ml and one 16 μg/ml) were observed (Table 2). Even though the MIC50 of Aspergillus niger for tolnaftate was 0.37 μg/ml, 9 isolates with high MICs (16 μg/ml) were found.ConclusionThe foremost commonest yeast isolates in this study, C. parapsilosis, exhibit significant sensitivity to various antifungals, including ketoconazole, voriconazole, tioconazole, amphotericin B, miconazole, fluconazole, and itraconazole. However, contrary to other studies, nystatin had high MICs and is not recommended as an effective drug. Since the pattern of antifungal susceptibility is varied among the cryptic species of Aspergillus sections, we recommend that physicians request a drug susceptibility testing before antibiotic therapy to prevent the development of resistance.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P083
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P103 Role of biofilm production in recalcitrant tinea

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectiveTo determine the role of biofilm production in dermatophytic isolates from tinea infections of recalcitrant skin lesions of study patients.MethodsAn observational study conducted in UCMS and GTB Hospital Delhi, in forty clinically diagnosed and mycologically confirmed cases of recalcitrant tinea infection of glabrous skin to analyze the role of biofilm production in dermatophytes.After taking written informed consent from the study population sample collection (skin scraping) was done.The scraping was then mounted in 10% potassium hydroxide (KOH) for direct microscopic examination followed by culture on Sabouraud Dextrose Agar (SDA) media with antibiotics (Chloramphenicol, Gentamicin, Cycloheximide).The fungal growth was then subjected to LPCB mount (Lactophenol cotton blue).The isolates were allowed to form in-vitro biofilms on polystyrene microtiter plates.Quantification of biofilm biomass was done using crystal violet staining and measuring the optical density (OD) at 570 nm and classified as non-adherent/non-producer, weak moderate, and strong biofilm producers.ResultsTinea corporis and cruris were the most common clinical types of dermatophytosis.T. mentegrophytes-complex was the most common dermatophyte isolated from the clinical specimens.Majority (86.84%) of isolates formed strong (OD >4 ODc) biofilms.ConclusionThere has been an increase in the incidents of chronic and recalcitrant dermatophytosis of skin.The predominance of T. mentegrophytes-complex as observed in our study highlights the importance of the pathogen in causation of current and chronic and recalcitrant dermatophytosis in India.High rate of in-vitro strong biofilm formation by the isolates indicates that these organisms might be forming biofilms in-vivo leading to chronicity and poor response to therapy.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P103
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P105 In vitro interaction of Malassezia and commensal Staphylococcus
           species

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectiveMalassezia is the most abundant fungal skin commensal organism, representing 50%–80% of total fungi present on the skin. It has been associated with many skin disorders such as pityriasis versicolor (PV) and seborrheic dermatitis/dandruff (SD/D). The role of Malassezia in disease manifestation is not discerned. It is important to understand its interaction with bacterial flora such as Staphylococcus epidermidis and S. capitis in vitro. We have studied the interaction of Malassezia and Staphylococcus species isolated from skin flora.MethodsMalassezia restricta, M. globosa (n = 5) isolated from patients with SD and M. furfur (n = 5) isolated from PV were sub-cultured on Modified Dixon's agar (MDA). Staphylococcus epidermidis and S. capitis were isolated from patients with SD and sub-cultured on brain heart infusion (BHI) agar. Malassezia species requires media supplemented with lipids (MDA) for its growth. Bacteria and Malassezia were quantified on MDA and BHI agar by Miles and Mishra method to perform interaction between them. For direct interaction, suspensions (100 μl) of M. restricta, M. globose, and M. furfur were prepared in normal saline and added to wells on the plates of lawn cultures containing S. epidermidis and S. capitis (107 CFU/ml). Plates were incubated for 12 h at 35°C and observed for zone of inhibition. To investigate the release of antibacterial compounds into the extracellular environment, M. furfur was inoculated in modified Dixon's broth (MDB) and incubated at 35°C for 5 days. Supernatant was collected at 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h of incubation and evaluated for antibacterial activity by agar-well diffusion assay. Effect of cell-free supernatant of Malassezia on growth of bacteria was also monitored by growth kinetics of S. epidermidis for 24 h in the absence and presence of M. furfur supernatant using Epoch-2 microplate spectrophotometer.ResultsMDA supported the growth of bacteria at different cell densities (107-103 CFU/ml count) and incubation time of S. epidermidis and S. capitis was similar on MDA and BHI. Zone of inhibition (ZOI) was witnessed with M. restricta (20.6 ± 3 mm, 21 ± 3 mm), M. globosa (21 ±1 mm, 22.6 ±2 mm) and M. furfur isolates (16.5 ± 1 mm, 18 ± 2 mm) against S. capitis and S. epidermidis respectively by direct interaction. Inhibition of bacteria by M. furfur was noted from 48-120 h as ZOI (21.7 ±5.1 mm) was observed on bacterial lawn cultured plate. When growth kinetics of S. epidermidis was monitored in presence of M. furfur supernatant, maximum value reached upto 0.26 ± 0.019 only from 0.01 ± 0.001 at OD600 in 9 h including lag phase of 4 h (Fig. 1). However, OD600 value reached upto 0.97 ± 0.005 in 8 h including lag phase of 1.5 h in absence of supernatant. Doubling time calculated from logistic growth equation was 76.6 ± 4.4 and 65.2 ± 2.9 minutes in the presence and absence of supernatant respectively.ConclusionInhibition of bacteria by Malassezia species noted in our study has not been reported earlier. The possible production of antibacterial compounds by Malassezia might be responsible for dysbiosis leading to disease.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P105
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P106 A dermoscopic finding of Tinea capitis caused by Microsporum canis

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTinea capitis is a relatively common disease, and the mycological examination is the gold standard for diagnosis. However, the probability of false negative on the KOH test is up to 40% and culture examination takes a long time for diagnosis. The characteristic pattern of dermoscopy not only aids in diagnosis, but also enables early treatment.MethodsWe evaluated six patients who were diagnosed with tinea capitis through clinical and dermoscopic findings. The images of the lesions were taken with a digital camera (Nikon, HB-42) and photographed with dermoscopy (Dermlite Foto 2 Pro) from the patients. The pictures were obtained by taking multiple focal points with dermoscopy. The comma, corkscrew, Morsecode-like, zig-zag, and bent hairs were observed as the main findings.ResultsThe dermoscopic finding was seen with overlapping of various findings in each of the patients. Upon dermoscopy, the most common findings were the corkscrew hair (66%) and the bent hair (66%). The comma hair (33%) and the proximal white shaft hair (33%) were less frequently observed and zigzag hair and Morse-code like hair were not seen in six patients. In the photograph taken with a camera, findings considered to be dermoscopic features such as corkscrew hair or comma hair were not observed.ConclusionIt is important for dermatologists to consider that abnormal findings in dermoscopy can play an important role in diagnosing Tinea capitis. And it will help in early treatment and prevent the progression of complications. Here in, we report specific dermoscopic findings which can narrow down the differential diagnosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P106
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P107 Spectrum of Dermatophyte infections and drug susceptibility pattern
           of Dermatophytes in patients visiting to tertiary care hospital in
           Chhattisgarh state of India

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectives1. To isolate and identify various species of Dermatophytes from clinical specimens 2. To perform and analyze the antifungal susceptibility testing of isolated Dermatophytes for commonly used antifungal agents; terbinafine and itraconazole.MethodsA prospective study was conducted from December 2019 to October 2021. Clinical specimens (skin, hair, and nail) from suspected cases of dermatophytosis were received and processed in the department of microbiology. All the samples were subjected to microscopic examination and culture by standard techniques. Their clinico-demographic profile was obtained. Specimen were processed for KOH and fungal culture. Dermatophytes were identified by studying macroscopic and microscopic characteristics of the isolates. The conidium-forming dermatophyte isolates were processed for antifungal susceptibility testing for terbinafine and itraconazole by Microbroth dilution testing following the CLSI M-38A2 guidelines.ResultsTotal 248 patients with male predominance (68%) were noted in the above-mentioned study period. Predominance of study population belonged to rural area. Maximum numbers of cases were from the age group 21-30 years. Majority of patients belong to poor socioeconomic status. Out of 248 samples, 178 (72%) had a positive KOH mount amongst which 72% had positive culture results. Amongst 2 4881% were skin scraping, 17% were nail, and 1.6% hair samples were processed. Out of culture-positive samples 52% were Dermatophytes. The most clinical form of dermatophytosis was combination of both Tinea cruris and T. carporis (31%) followed by T. cruris (22%), and T. corporis (17%) for which skin scraping was processed. The most common isolate was Trichophyton tonsurans (73%) followed by T. mentagrophytes (10%), and T. verrucosum. Onychomycosis was diagnosed in 17% patients of which 59% were positive by KOH 49% were culture positive.11.5% isolates from nails were dermatophytes.Antifungal susceptibility testing was done by Microbroth dilution method and analyzed the range. The MIC range of major isolates, i.e., T. tonsurans showed MIC ranges against terbinafine <0.03-4 μg/ml and itraconazole 0.03-2 μg/ml. Trichophyton mentagrophyte for terbinafine <0.12-4 μg/ml and for itraconazole 0.12-2 μg/ml. Four isolates of T. tonsurans had higher MIC values for terbinafine and two isolates had higher MIC for itraconazole. One isolate of T. mentagrophytes had higher MIC values of itraconazole, and one another isolate had higher MIC for terbinafine.ConclusionThis study highlights the change in pattern of causative agents of dermatophytosis. The present study showed the predominance of T. tonsurans. More extensive studies are needed to evaluate the cut-off range of antifungal susceptibility testing of dermatophytes with clinical follow-up to see the response of respective antifungals and to guide the therapy.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P107
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P126 Effects of Histoplasma capsulatum infection on activation and
           proliferation of hematopoietic stem cells

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMBackgroundHematopoietic stem cells (HSCs) are considered a multipotent population with high proliferative potential, and are widely used in the treatment of leukemias, multiple myeloma, and some lymphomas. In the context of infectious diseases, some microorganisms have been reported to induce changes in the expression of surface markers in HSCs by a direct effect or through the induction of cytokines. Systemic infections are characterized by inducing stress on the bone marrow, which is reflected in an increase or decrease in leukocytes and platelets in peripheral blood, a process known as ‘emergency hematopoiesis’. Histoplasmosis is a systemic mycosis caused by Histoplasma spp., which occurs mainly in immunosuppressed individuals; this mycosis can present a severe clinical picture with dissemination to various organs, including the bone marrow, and is associated with anemia and pancytopenia. So far, the effect of a possible interaction of Histoplasma with HSCs is unknown.ObjectivesTo evaluate, in vitro, the effects of Histoplasma capsulatum infection on activation and proliferation of HSCs.MethodsHSCs were obtained from bone marrow of C57BL/6 male mice; after isolation and purification, they were characterized by flow cytometry. Later, the basal expression of toll-like receptor (TLR)-2, TLR4, and Dectin-1 was determined using flow cytometry. HSCs were infected with H. capsulatum yeasts in a multiplicity of infection (MOI) of 5 and incubated for 24 h. In addition, some of the co-cultures were previously treated with specific blocking antibodies for TLR2 and TLR4 or with a blocking peptide specific for Dectin-1 (CLEC7A). Furthermore, phagocytosis, microbicidal, and cell proliferation assays were done, and the expression of the genes encoding the cytokines IL-1β, IL-6, IL-10, IL-17, TNF-α, and TGF-β as well as arginase-1 and iNOS were assessed.ResultsWe observed that H. capsulatum has the capability to adhere and internalize within these HSCs; nonetheless, this process did not affect the survival of the fungus. The interaction of H. capsulatum with HSCs induced a significantly increased expression of TLR2 and Dectin-1 but not TLR4. In addition, this fungal interaction significantly induced an augmented expression of IL-6, IL-1β, IL-10, IL-17, TNF-α, TGF-β, as well as the immune mediators Arg-1 and iNOS. Interestingly, blockade of these receptors significantly decreased the phagocytosis process as well the expression of all inflammatory mediators evaluated, especially when blocking TLR4 and Dectin-1. Of note, H. capsulatum induced apoptosis but did not inhibit the proliferation of these stem cells.ConclusionsThese results indicate that HSCs are capable of phagocytosing H. capsulatum but do not affect its survival; moreover, this fungal pathogen could induce changes in the expression of pattern-recognition receptors (PRRs), especially TLR2 and Dectin-1, and could subsequently activate the HSCs leading to the expression of inflammatory mediators as well as affecting the viability of these stem cells. Altogether, these findings indicate that H. capsulatum could affect the hematopoiesis process as reflected in an increase or decrease in leukocytes, erythrocytes, and platelets as observed in patients with severe and disseminated disease, especially in those with dissemination to bone marrow.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P126
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P127 Cytokine gene Polymorphism in superficial Malassezia associated skin
           diseases

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesü To isolate and characterize Malassezia species from patients of Pityriasis Versicolor (PV), Atopic Dermatitis (AD), Seborrhoeic Dermatitis (SD), and healthy controls.ü To study single nucleotide polymorphism in IL-10 and IFN- γ genes of the host and its relation with susceptibility to Malassezia infection.MethodsIt was a prospective observational study done in University College of Medical Sciences and GTB Hospital, Delhi. Sample size comprised of 38 cases each of AD. Skin scrapings were used for fungal culture on Sabouraud Dextrose Agar (SDA) and Modified Dixon Agar (MDA) and isolates were identified as per conventional phenotypic methods. Genomic DNA was extracted from blood samples and Cytokine genotyping was carried out by Amplification Refractory Mutations System-Polymerase Chain Reaction (ARMS-PCR) with sequence-specific primers. Three SNPs (IL10-1082A/G; IL10-819/592C/T; IFN-g +874A/T) in two cytokine genes were assessed in all the patients and healthy controls. Chi-squared Test or Fisher's-Exact Test and Bonferroni's correction were used for statistical analysisResultsMalassezia yeast was isolated in 94.7%, 63.1% each and 52.6% in PV, AD, SD, and healthy controls respectively. Malassezia globosa was the most commonly isolated species from both patient and healthy control. Malassezia sympodialis was the second most common followed by M. furfur and M. restricta. Association between specific cytokine gene polymorphism and clinical outcome was found to be significant in PV, AD, and SD group. IFN-γ +874 T allele and IFN-γ +874 A allele were significantly associated with PV and AD respectively. IFN-γ +874 AA genotype frequency was found to be higher in PV and AD patients than in controls. This finding suggests that PV and AD patients may produce a lower IFN-γ. IL10-819/592 C/T alleles were also significantly associated with PV. IL10-819/592 CT genotype frequency was found to be lower, and CC genotype frequency was found to be higher in PV patients as compared to healthy controls, suggesting that IL10 production may be higher in PV patients. AD patients were more likely to carry the IL10–1082 G allele and, it was significantly associated with this disease. Moreover, IL10-1082 AG genotype was significantly associated with AD and SD, which corresponds to high production of IL10.ConclusionThe identification of Malassezia yeast to a species level is of a great importance to determine which species are implicated in certain skin diseases.The use of phenotypic methods for identification of Malassezia species is a reliable, easily executed method, that is also inexpensive. Molecular methods are necessary to decrease the turnaround time, especially for slow-growing Malassezia species.Cytokine gene polymorphism studies in IL10 and IFN γ genes demonstrated susceptibility of host to Malassezia infections. Comparison with the serum cytokine levels will help in understanding the evolution of Malassezia infections in susceptible host.Population genetics studies require inclusion of a larger number of subjects to evaluate the probability or the frequency of occurrence of the genotype.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P127
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P128 Chronic pulmonary aspergillosis in a Tuberculosis c enter of
           Assam—a 2-year study

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesChronic pulmonary aspergillosis is a slow and progressive lung disease that occurs in apparently immune-competent patients. Pulmonary tuberculosis is considered to be a major predisposing factor. Early diagnosis of the condition can improve morbidity and mortality. As the number of studies to detect this disease in India is sparse, this study was undertaken in District Tuberculosis center attached to Assam Medical College and Hospital, Dibrugarh to find out the occurrence of chronic pulmonary aspergillosis in treated pulmonary TB patients.MethodsThis prospective hospital-based cross-sectional study was done in Assam Medical College and Hospital, Dibrugarh from December 2015-November 2017. Every consecutive pulmonary TB case after completion of intensive therapy attending the outpatient department with respiratory symptoms was included in the study. Cases were identified with clinical, serological/mycological, and radiological criteria.ResultsA total of 26 cases of CPA were confirmed out of 211 enrolled cases. Positivity rate of CPA in the enrolled patients was 12.3% (95% CI 8.19-17.51%). The hospital-based occurrence rate was found to be 6/1000 (95% CI 3.8-8.5) in the outdoor attendants in DTC, Dibrugarh. Most of the cases (88.46%) were late cases presenting with aspergilloma. Majority (51.72%) of the aspergilloma cases were detected within 5 years of diagnosis of PTB. Very few (15.38%, n = 4) early cases were detected. The sensitivity of the ELISA test (DRG, Germany) was found to be 72.72% as compared with reference Immunocap method used in this study. A section (37.90%) of the patients with fungal ball was seronegative by Aspergillus fumigatus serological test. Two of them were positive for Aspergillus flavus in sputum culture.ConclusionA serological test to detect Aspergillus flavus IgG may complement the Aspergillus fumigatus IgG test in detecting CPA. CPA is a neglected disease with a high morbidity and mortality. Routine follow-up protocol for the cavitary patients in tuberculosis center by a sensitive serological test for a minimum period of 5 years may be necessary for early detection of cases in PTB high prevalence countries.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P128
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P131 Optimization of MTT assay protocol in Pythium insidiosum zoospores
           incubated together with neutrophils

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThe tetrazolium-based MTT assay is widely used to assess cell viability. This colorimetric assay measures cell viability through the enzymatic reduction of MTT, a yellow water-soluble tetrazolium dye, to purple-colored formazan crystals. The zoospores of Pythium insidiosum are the infective form causing pythiosis. There remains a lack of standardized protocol for P. insidiosum zoospore viability assay. Here, we optimized the MTT assay to assess the activity of neutrophils on zoospores.MethodsNeutrophils and zoospores were incubated for 2 h, 4 h, and overnight at 37°C. Neutrophils were lysed in water (pH = 11), MTT was added to each well and incubated at 37°C for 2 h. Then, SDS-HCl solution was added to each well, and absorbance at 570 nm was measured using a microplate reader. The percentage of viable zoospores was then determined.ResultsThe viable zoospores metabolized MTT to insoluble purple formazan product. The zoospores germinated into hyphae when incubated for ˃2 h. Because of the rapid germination of zoospores into hyphae, reliable results would be obtained with an optimum incubation time of 2 h for the zoospores.ConclusionThe simplicity and low cost of the assay make it a valuable tool for zoospore viability studies, with a focus on immunology and immunotherapy.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P131
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P173 PK PD rationale and efficacy of isavuconazole treatment after failure
           of amphotericin B and posaconazole for COVID-19 associated cranial
           Mucormycosis

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveThis case series describes our experience of using isavuconazole (ISVCZ), along with TDM, after the failure of treatment with Amphotericin B (AmB) and Posaconazole (PCZ) due to the better PK PD properties of ISVCZ.Patients and methodsThere were 6 patients with ROCM who had disease progression despite surgical debridement and adequate treatment with AmB and PCZ. Anti-fungal treatment was switched to ISVCZ which achieves levels in brain (1.86x)R and in bone-marrow (3x)R as compared to serum levelsR.ResultsPK PD considerations for ISVCZ treatment considering the likely levels in brain and bone-marrow and the MIC of majority of Mucoralean molds as ≤4RTable 1Table 2Results of treatmentConclusionTreatment with ISVCZ may mitigate some of the challenges in ROCM due to its PK PD properties. TDM for ISVCZ is not routinely recommended, but could be used to ensure high plasma exposures and enhanced penetration to the site of infection. Our results are encouraging although there are several limitations of a case series, confounding variables involved, and the use of ISVCZ as salvage after failure of previous treatment.Clinical success in this series suggests that extrapolative PK PD considerations in using ISVCZ for such ‘difficult to treat’ patients may be justified.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P173
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P174 Prevalence and outcomes of patients with COVID - associated
           mucormycosis (CAM): A case series

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackground and objectiveCoronavirus disease-19 (COVID-19) pandemic caused by the severe acute respiratory syndrome coronavirus-2 (SARS-COV-2) virus has been associated with increased secondary bacterial and fungal infections. A few centers from India have reported a high number of cases of COVID-associated mucormycosis (CAM). Depending on the anatomical site of infection, mucromycosis is classified as rhino-orbito-cerebral, pulmonary, gastrointestinal, cutaneous, renal, and disseminated mucromycosis. Several risk factors such as uncontrolled diabetes mellitus, hematologic malignancies, renal disease, organ transplant, and corticosteroid therapy administered for COVID-19 are implicated in CAM. In this study, we report a case series of CAM, presenting its prevalence, clinical features, risk factors, etiological agents, site of infection, and outcomes in a single center.MethodsA retrospective data analysis of all proven mucormycosis cases among COVID-19 infected patients from September 1, 2020 to December 31, 2020, was carried out after approval from the institutional ethics committee. All proven cases of mucormycosis (either by culture from sterile site or histopathology), along with compatible clinical and radiological findings, in patients with positive real-time-polymerase chain reaction (RT-PCR) for SARS-CoV-2 within 2 months of the diagnosis of mucormycosis were included in the study. All patients received treatment for COVID-19 and mucormycosis as per the institutional protocol. Data was collected in a predefined case-record form developed for the study which included demographic characteristics, risk factors, days to the diagnosis of mucormycosis after COVID-19, site of involvement by mucormycosis along with microscopy, culture and histopathology, treatment details and outcome at 6 and 12 weeks.ResultsDuring the study period, a total of 19 patients were diagnosed with CAM. The major risk factors of the patients were type 2 diabetes mellitus (DM) (n = 15, 78.9%) and steroid therapy (n = 18, 94.7%), The other co-morbidities included hypertension (n = 7, 38.8), chronic kidney disease (CKD) (n = 4, 22.2%) and chronic liver disease (n = 1, 5.2%). Rhino orbital mucromycosis (ROM) was the most common form (n = 9, 47.3%). The prevalence of CAM (as calculated by the total number of cases of CAM divided by the number of COVID-19 cases treated) was 5.47/1000 COVID patients during the study period. Majority (15, 73.6%) of the patients were successfully treated and discharged whereas three patients succumbed to infection and one left against medical advice. The mortality in this cohort (n = 4) was 21.05% as compared with 13.9% among all COVID patients (n = 9) admitted during the same time period in 2020.ConclusionThough sample size is small, the findings in our study suggest that the fatality from COVID-associated mucormycosis is high, though the risk factors remain the same. The incidence of mucormycosis was twice that in non-pandemic period. Early diagnosis is crucial as despite aggressive surgical medical therapy, mortality continues to be high.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P174
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P176 Basidiobolus meristosporus — anew species on the block!

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesEntomophthorales, including genus Basidiobolus, and Conidiobolus are a well-recognized cause of subcutaneous infections in immunocompetent hosts. Genus Basidiobolus is ubiquitous. All human infections except one reported so far have been due to B.ranarum.Here we present a case of an immunocompetent 5-year-old girl with a soft tissue swelling on the right upper buttock caused by B. meristosporus.MethodsTissue biopsy samples from swelling over right buttock were sent for microbiological and histopathological examination. In microbiology, the samples were subjected to microscopy with Gram stain and KOH-calcofluor, aerobic, anaerobic, and fungal culture. Additionally, CBNAAT was done to rule out Mycobacterium tuberculosis. Growth on fungal culture was identified by slide culture and microscopy. The isolate was sent to PGIMER, Chandigarh for characterization using whole genome sequencing. Environmental surveillance included surveillance of soil samples from in and around the patient's house was attempted to identify the source of infection.ResultsOn physical examination, an indurated mass was noted on the right lower back with a scar of a previously attempted drainage. The surface over the lesion was erythematous, the skin was scaly with no discharging sinuses.Gram stain of the biopsy sample revealed few polymorphonuclear leukocytes and no microorganisms. KOH-calcofluor revealed broad, partially septate, hyaline fungal hyphae. Aerobic and anaerobic cultures did not yield any pathogen. CBNAAT was negative for Mycobacterium tuberculosis. Fungal culture on SDA yielded growth of waxy, expanding colonies with cerebriform center, without aerial mycelium after 72 h of incubation, at both 25°C and 37°C. LPCB mount was prepared from the primary tubes and slide culture was performed. Preliminary identification was established as B. ranarum. VITEK MS (MALDI-TOF) did not identify the isolate as this is not available in the database. Molecular characterization and phylogenetic analysis were done and the isolate was identified as B. meristosporus. Soil samples from in and around the house did not yield fungal growth morphologically resembling Basidiobolus species.Histopathological examination of the sample revealed Splendore Hoeppli phenomenon with occasional broad, aseptate hyphae.The child was initially treated with oral potassium iodide and later initiated on oral nitroimidazole. The response was dramatic with 70% resolution of the lesion within 3 weeks of therapy and almost complete resolution after 6 weeks. The child is on regular follow-up since then and is doing well.ConclusionSubcutaneous entomophthoramycosis in children are rare tropical infections that can mimic malignancy and hence are often misdiagnosed resulting in unnecessary pharmacotherapy or mutilating surgery. Diagnosis is established by isolation and correct identification of fungal species. To the best of our knowledge, only one clinical case of B. meristosporus has been reported so far. Identification of species is vital to understand factors governing pathogenicity, to establish epidemiological data, and probably revise current controversial opinions on the pathogenic species of genus Basidiobolus. Speciation based on morphology alone is unreliable and molecular methods prove useful for confirmation of species. Therefore, it is imperative that all Basidiobolus isolates are sent to referral centers for speciation to build a strong reliable database.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P176
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P177 A Psittacine bite and subcutaneous Zygomycosis in immune competent:
           Case with therapeutic challenge

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesPrimary objective: To document a case of subcutaneous zygomycosis following a Psittacine bite in an immune-competent in India.Secondary objective: To follow-up the case till microbiological and clinical cure.MethodA case report entry prospectively carried out during 1.5 years of hospital visit of the patient with subcutaneous zygomycosis. This had ethical approval and patient consent obtained. A detailed account of case progression from date of first hospital admission to final cure was noted. A 56-year-old female from Vidisha in Madhya Pradesh India, apparently well 2 years back following a wild parrot bite on her back, causing an initial ulcer on infrascapular area gradually spreading bilaterally visited outpatient department of AIIMS, Bhopal. With prominent weight loss and non-healing ulcer; asymptomatic initially, ruptured spontaneously formed sinuses with exudate. Nodules and spontaneous rupture of nodule were mentioned. Provisional clinical differential diagnoses were nocardiosis, deep fungal infection, and Phagedenic ulcer. Tissue biopsy sent for microbiological and histopathological evaluation showed broad pauciseptate hyphae with right angle branching and bulging on direct microscopy suggesting subcutaneous zygomycosis. Histopathology H&E, and PAS showed similar morphology. A second sample sent was exudate from infrascapular region and showed broad pauciseptate hyphae with buildings on KOH mount. The patient was treated and discharged with some relief. Noncompliance to prescribed antifungal led to progression and horizontal spread forming plaque within months. A saturated solution of potassium iodide (SSKI) and itraconazole started. Lesions improved. The patient was again non-compliant and the lesions increased in size. The patient was reviewed again for the exacerbation and worsening. Around Day 10; SDA with chloramphenicol showed whitish growth with satellite colonies and LPCB showed broad quasi-septate hyaline hyphae, sporangia elongated, and beak with rounded zygospores suggesting Basidiobolus species. The patient received itraconazole, SSKI, and terbinafine. Species confirmation as Basidiobolus ranarum from PGIMER Chandigarh Mycology Reference center India was done.ResultsAfter 1.5 years, clinical improvement and final biopsy showed no growth and microscopy negative. The patient is on regular follow-up.ConclusionThis study highlights the traumatic implantation and zoonotic potential of fungal species. Clinical suspicion of fungal etiology and timely mycology laboratory diagnostic support is key to address such cases.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P177
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P193 Candidemia in coronavirus disease 2019 patients in a university
           hospital in Buenos Aires, Argentina

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIt is known that the incidence and epidemiology of candidemia vary according to different geographic regions and/or hosts. Between 1998 and 2019, the incidence in a university hospital in the city of Buenos Aires Argentina, ‘HCJSM’, was 2.19/1000 discharges. The coronavirus disease 2019 (COVID-19) pandemic altered the previously recognized course of severe infections, including candidemia.ObjectiveThe aim of this report is to determine the incidence of candidemia in critically ill COVID-19 patients, and the clinical and microbiological aspects of these episodes hospitalized at HCJSM.MethodsThe source documents of this retrospective study are medical records from patients with Sars-Cov-2 and candidemia who were diagnosed between March 1, 2020 and June 30, 2021. At the onset of the pandemic, the HCJSM began admitting patients with COVID-19, and elective procedures were canceled. Demographic, clinical, and laboratory data were reviewed. All data were analyzed using RStudio, a statistical computing platform (version 4.0.2).ResultsDuring the period under review, 61 episodes of candidemia were identified: 23 episodes (39.7%) in COVID-19 patients, and 38 episodes (60,3%) in no COVID-19 patients. Incidence (x 1000 admission) in no COVID-19 patients was 2.5 (38/14 903): in COVID-19 patients 14.4 (23/1595) and in COVID-19–ICU was 42.3 (20/472). The average age of patients is of 65 years (32-84 range years). The time from admission to ICU to the development of candidemia had a median of 18 days (RIC 9-23). A total of 87.5% of the patients had been on mechanical ventilation and 100% of the patients received broad-spectrum antibiotics and had catheters. Episodes were caused by C. parapsilosis (39.7%), C. albicans (35%), C. glabrata (14%), and other species of Candida (11%). A total of 62% of COVID-19 patients who developed episodes of candidemia died during the period under examination. The survival likelihood at 30 days of COVID-19 patients who developed candidemia was higher for C. parapsilosis episodes and lower for C. glabrata episodes.ConclusionThe incidence of candidemia showed an increase in COVID-19 hospitalized severe patients. The use of broad-spectrum antibiotics, the presence of catheters, and the use of ventilatory support in COVID-19 patients were the risk factors most associated with the development of candidemia. Although the number of episodes of candidemia is low, without the strength of statistical analysis, it is important to consider that the likelihood of survival of patients with episodes of candidemia varies according to the species recovered.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P193
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P194 Disseminated fusariosis in h ematological malignancies with favo
           rable outcomes

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMFusarium is a serious fungal disease that mainly affects high-risk hematological patients. Early recognition of cutaneous entry of Fusarium in severely immunocompromised patients is critical to initiate early treatment.The aim of this presentation is to present two cases of disseminated fusariosis in severe oncohematological patients with favorable outcomes.Case 1: A 65-year-old man was admitted to the hospital for allogeneic hematopoietic cell transplantation. He had chronic myelomonocytic leukemia treated with cytosine analog antineoplastic and received pre-transplant prophylaxis with voriconazole 400 mg/day. On day 8 after transplantation, he presented pain and erythema on the fifth toe. Scarification of the digital intertrigo showed fine septate hyaline filaments. Antifungal treatment with voriconazole 400 mg/day plus liposomal amphotericin B 5 mg/k/d was administered. The patient remained severely neutropenic and the digital lesion progressed to painful necrosis for the following 12 days. BACTEC blood culture developed F. keratoplasticum and MIC (mg/L) amphotericin B 1, voriconazole 8 (CLSI M38-3rd Ed). On day 24 post-transplant, the patient presented an erythematous lesion on the right leg. A toilette of the digital lesion and a skin biopsy of the lesion on the right leg was performed, both of which showed fine hyaline filaments on direct examination with negative culture. On day 55, the patient was stable and amphotericin B was discontinued. He was treated with voriconazole 400 mg/d and had a good clinical evolution. The patient was discharged 65 days after transplantation.Case 2: An 18-year-old man was admitted to the hospital for chemotherapy treatment for acute lymphocytic leukemia (ALL). The patient received prophylaxis with fluconazole. On day 15 after chemotherapy, he developed Candida parapsilosis candidemia; C.parapsilosis MIC (mg/L) amphotericin B 1, fluconazole 0.5, voriconazole 0.015; anidulafungin 0.4 (E Def 7.32.EUCAST). The patient was treated with anidulafungin. He remained febrile and neutropenic. On the 19th day, he presented a digital intertrigo on the foot. Direct examination of the scarification of the interdigital lesion showed fine hyaline filaments and the colony was identified as F. solani complex, MIC (mg/L) amphotericin B 2, voriconazole 8 (M 38 3rd Ed CLSI). The antifungal treatment was changed to voriconazole 400 mg/d and lipid complex amphotericin B 5 mg/kg/d. On day 22, he was still neutropenic and febrile. Chest and sinus CT scans showed no abnormalities. Blood cultures and BAL culture were negative. The patient developed multiple ecthyma gangrenosum skin lesions on the torso and legs. On day 35, he received a granulocyte transfusion. On days 42 and 44, the serum GM Aspergillus was 0.2 and 0.4 respectively. On day 45, he presented a nasal lesion. The nasal biopsy showed a positive direct examination and development of the F. solani complex. On day 47, a surgical toilette of the foot lesion was performed. The patient had a favorable outcome with voriconazole 400 mg/day until hematopoietic cell transplantation.ConclusionEvaluation of skin lesions in severely immunocompromised patients allows prompt diagnosis for antifungal treatment and appropriate debridement in patients with a proven mycological diagnosis of disseminated fusariosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P194
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P195 Factors related to outcome of bloodstream infections due to Candida
           parapsilosis complex: A single center observation study from Central India
           

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesCandida parapsilosis infection has recently emerged as an important antifungal-resistant nosocomial pathogen having the unique ability to grow on inanimate objects and surfaces. Very limited studies from low and middle-income countries are available on the association of risk factors and antifungal susceptibility testing (AFST) of this species. The aim of this study was to analyze the predisposing conditions, outcome, and antifungal susceptibility pattern of candidemia due to C. parapsilsosis complex.MethodsA single-center retrospective observational study from January 2019 to December 2021 of all cases of candidemia was carried out at an 890-bedded University Hospital in central India. Data regarding demographic characteristics and clinical risk factors were collected from the patient's medical records. Antifungal susceptibility testing was performed; MIC results were interpreted according to CLSI breakpoints (M27-A3). Risk factors and outcome association at the species level were analyzed by using Fisher's exact test. Variables with a P ≤ .05 at the descriptive analysis were analyzed by Cox regression. A P-value of ≤ .05 was considered to represent the statistical significance and all statistical tests were two-tailed.ResultsOf 211 patients diagnosed with Candidemia during the study period, 53 (25.1%) were infected with C. parapsilosis which represented the second most frequently isolated yeast after C. albicans (n = 98; 46.4%). A total of 26 (49%) C. parapsilosis isolates were non-susceptible to fluconazole (NSF), which included resistant (n  =  20) and susceptible dose-dependent (n  =  06) isolates. The median patient age was 63 years.15.3% were neonates. The majority of patients (90%) suffered from multiple comorbidities, diabetes mellitus (43%) being the commonest. A total of 55% of patients underwent surgical intervention within 30 days from the onset of candidemia. Univariate logistic regression revealed that ICU admission [odds ratio (OR) 2.45], central venous catheter use (OR 2.46), renal impairment (OR 1.687) were more common among NSF isolates than fluconazole-susceptible (FS) isolates (all P <.05). The overall crude mortality at 30 days was 36%; higher in patients infected with FNS isolates than FS isolates.ConclusionThere is an increase in the absolute number of invasive infections by C.parapsilosis observed over the past 2 years. At this moment, the percentage of fluconazole non-susceptible C. parapsilosis is very high and poses a threat to infected patients and has a clinical impact in our hospital. Being able to identify and treat infections caused by this pathogen is important to prevent clinical outbreaks.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P195
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P196 A rare presentation of subcutaneous Entomophthoramycosis

    • Abstract: AbstractPoster session 2, September 22, 2022, 12:30 PM - 1:30 PMEntomophthoramycosis is a chronic granulomatous type of subcutaneous infection seen mainly in immunocompetent individuals. The usual focus of Conidiobolomycosis infection is as rhinoentomophthoramycosis, characterized by chronic, indolent, and localized swelling of the nose, paranasal tissues, sinuses, cheeks, and upper lips and it infrequently affects the lower extremities.We report a case of subcutaneous Conidiobolomycosis in a 21-year-old male with an alleged history of trauma to left foot by a wooden stake 6 months back. Primary treatment of the wound was done at a local hospital. A total of 4 months post-trauma he developed multiple pus discharging sinuses on the dorsal and plantar aspects of the left foot, for which local dressing was done in a nearby hospital. He presented to our hospital with non-healing multiple sinuses, with active serosanguinous discharge. He underwent wound debridement under spinal anesthesia and tissue was sent for fungal culture, histopathological examination.Aerobic culture of the wound swab revealed moderate growth of Methicillin-resistant Staphylococcus aureus sensitive to clindamycin, gentamicin, and linezolid. Histopathological examination of the tissue showed a resolving abscess with granulation tissue. Direct microscopic examination of the tissue by KOH mount showed no fungal elements. It was inoculated into Sabouraud's dextrose agar with and without cycloheximide and incubated at both 25°C and 37°C. Sabouraud's dextrose agar without cycloheximide incubated at 37°C after 48 h of incubation grew cream-colored glabrous colonies adherent to surface with pale reverse. Lactophenol cotton blue preparation revealed broad, sparsely septate hyphae with primary conidia which are globose approx. 40 μm is diameter, produced singly. They have a characteristic protruding papilla on one side. The fungal isolate was identified as Conidiobolus species. Sequencing results are awaited for species identification and confirmation.Serial wound dressings were done following strict infection control policies and he was started on tablet linezolid 600 mg twice daily, tablet itraconazole 400 mg twice daily for 1 week, followed by 400 mg once daily for 6 months.Conidiobolus is a soil saprophyte, found in decaying vegetation in most warm climates in tropical countries. There has been only one published case report of subcutaneous entamophthoramycosis of the foot, in a 49-year-old female from Venezuela. To the best of our knowledge, we report the first case of subcutaneous entamopthoramycosis of the lower extremity in India and the second case in the world.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P196
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P197 Infant-juvenile paracoccidioidomycosis. Two Argentine endemic zones
           with different epidemiological and clinical aspects' What influences
           this situation'

    • Abstract: AbstractPoster session 2, September 22, 2022, 12:30 PM - 1:30 PMArgentina has two endemic areas of paracoccidioidomycosis (PCM). It is noteworthy that epidemiological characteristics differ in both areas, especially in frequency, and clinical aspects of infant-juvenile PCM form (I-JF). In this work, we have reviewed and analyzed 10 years of juvenile PCM form (JF) in both areas emphasizing in acute/subacute I-JF cases.From January 2012 to December 2021 data of epidemiological characteristics, clinical history and laboratory results of I-JF cases were recorded on standardized protocols and entered into a database that helped consolidate the information.Although the more extensive area of PCM historically with the highest incidence is located in Northeast Argentina (NEA), the major number of I-JF was observed in the smaller PCM endemic area, located in the Northwest of the country (NWA).In NWA, 32 JF were recorded including 20 cases of I-JF form in children from 1-13 years old. No outbreak was registered. Cases were equally distributed over the 10 years.In NEA, 28 JF were recorded including 8 cases of I-JF form in children from 7-14 years old. Of these cases, 6/8 (75%) presented as an outbreak in 2012. The rest were only registered in 2018-2020.More frequent clinical manifestation of I-JF:NWA: 70% hepatosplenomegaly with peritonitis and ascites, 33% gastrointestinal symptoms including diarrhea. Adenomegaly (70% cervical, 15% mediastinal).Serology (ID) non-reactive: 32%NEA: 62% cutaneous, 37% hepatosplenomegaly, 25% osteolytic lesions, 25% pulmonary nodules, 25% pericardial effusion, 25% mucocutaneous. Adenomegaly (75% cervical, 62% mediastinal-retroperitoneal).Serology (ID) non-reactive: 12.5%NWA records most cases of I-JF with a constant frequency and with a lower median age. NEA seems to only occur in outbreaks.Are striking the different epidemiological characteristics observed' Predominantly hepatosplenomegaly and intestinal forms in NWA, being with fecal material the first sample where Paracoccidioides is detected in many cases. In contrast, more diverse clinical manifestations are observed in NEA. Most cases with cutaneous/mucocutaneous lesions and the presence of pulmonary and pericardial forms characterized I-JF in this zone.Considering serological tests are important in the PCM diagnosis and to follow up the treatment success, no-reactive tests obtained (32% in NWA, 12.5% in NEA) show a serious diagnostic problem emphasize the need to work on more sensitive tools to reduce the high mortality of this clinical form. The variable expression of gp43 among isolates of Paracoccidioides species may suggest not to use a single antigen preparation for serological tests and include autochthonous isolates.Our group reported climatic and anthropogenic changes influencing the appearance of I-JF outbreaks in the NEA, a region where the observation of these cases was historically very rare. Probably, NWA provides a different ecological niche for Paracoccidioides, which favors its constant appearance over time. We have already started a multicenter molecular epidemiological, probably include soil studies of NWA would be important to try to better understand this situation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P197
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P198 Persistent Fungemia with Candida auris in a patient with
           enterocutaneous fistula

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveCandida auris (C. auris) is a major emerging threat to the healthcare sector in view of the difficulty in early identification by standard methods, multidrug resistance, and ease of spread in healthcare settings. Here, we report a case of persistent C. auris fungemia (>2 months) in a patient with enterocutaneous fistula.MethodsA 57-year-old man without any comorbidities underwent surgery for diverticular perforation which was complicated by intra-abdominal abscesses, anastomotic leak, and multidrug-resistant bacteremia requiring higher antibiotics, total parenteral nutrition, and prolonged ICU stay. Patient was admitted to our center with sepsis and blood culture grew C. auris. Patient was managed with injection of caspofungin (in the absence of sensitivity breakpoints). Patient continued to grow C. auris in the blood so flucytosine was added as a part of combination antifungal therapy. On dual antifungal therapy for 28 days there was a transient clearance of fungemia. Work up for endocarditis, intrabdominal collection, and endophthalmitis were negative. But Patient was continued on total parenteral nutrition via central line in view of enterocutaneous fistula. Patient developed a recurrence of fungemia after 4 days of stopping antifungal treatment. Patient was started on injection of mycafugin and voriconazole (in view of on treatment resistance to flucytosine), on which cultures turned sterile and patient improved. Plan was made to give total 6 weeks of parenteral combination antifungal therapy.ResultsC. auris management complexities stem from multiple factors. The above case emphasizes the urgent need for C. auris specific minimum inhibitory concentration breakpoints and standard guidelines for treatment. Currently, treatment is based on the Center for Disease Control's proposed breakpoints (extrapolated from other Candida spp.). Upfront combination antifungal treatment might be the answer till further studies.ConclusionManagement of invasive C. auris infection presents a major therapeutic challenge to clinicians and a major threat to healthcare sector even after timely identification.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P198
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P200 Lodderomyces elongisporus fungemia in a late post-operative patient
           with ventricular septal defect: case report

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo report a case of Lodderomyces elongisporus fungemia in a late post-operative patient with the ventricular septal defect.MethodsInformed consent was obtained from the parents of the child. Clinical history was collected. Routine biochemical tests were conducted. Blood samples were sent to the bacteriology and mycology laboratory for culture. Radiological examination of the head was done to ascertain the cause of neurological manifestations.ResultsAn 11-year-old boy, previously diagnosed as a case of ventricular septal defect (VSD) and severe aortic regurgitation, had undergone VSD closure in December 2010 and aortic valve replacement in January 2011. He was discharged on oral anticoagulants. However, he did not follow up.In August 2018, he presented with fever and right-sided hemiparesis. Hemogram was within normal limits except for decreased hemoglobin. Bacteriological blood culture was sterile, but I.V. antibiotics were administered empirically. However, the patient started to have epileptic attacks and therefore was intubated and antiepileptics were administered. An NCCT of the head revealed a large intraparenchymal bleed. Echocardiography revealed intra-cardiac vegetation measuring 8 × 7 mm and moderate aortic regurgitation.Fungal blood culture inoculated in BACTEC Mycosis IC/F bottle flagged positive after 5 days of incubation. A smear and Gram stain from the same revealed budding yeast cells. Sub-culture was done on Sabouraud dextrose agar and HiCromeTM Candida Differential Agar, and blue-tinged colonies were observed on the latter. The isolate was identified as L. elongisporus when subjected to MALDI-TOF analysis. Identification was confirmed by sequencing the internal transcribed spacer (ITS) region of the ribosomal DNA.Antifungal susceptibility test was performed by broth microdilution as per CLSI guidelines. Antifungal therapy was initiated with liposomal amphotericin B, but he continued to have fever even after 1 week and consequently developed status epilepticus. CT scan of the brain revealed massive intracranial hemorrhage. Parents were advised neurosurgery, but they requested discharge against medical advice. The patient was lost to follow-up.ConclusionsLodderomyces elongisporus is a rare cause of invasive bloodstream infections and should not be ignored as a contaminant when isolated from sterile sites. It is often misidentified as Candida parapsilosis by conventional methods and commercially available systems but can be distinguished from it using chromogenic culture media and MALDI-TOF-MS. The current case report highlights the significance of L. elongisporus as a rare cause of invasive fungal infections, the difficulties faced in the identification of this pathogen, and the importance of newer diagnostic methods in identifying it.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P200
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P201 Medicopsis romeroi: an emerging cause of subcutaneous infections

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveMedicopsis romeroi is one of the emerging dematiaceous fungi implicated in subcutaneous human infections. Despite advances in diagnostics, identification of this agent still remains delinquent owing to poor sporulation necessitating molecular modalities. Data on clinical and management profile of M. romeroi are available as case reports. In the present study, we describe an index case of M. romeroi infection and clinical risk factors and management profile of 74 cases of M. romeroi cases from India (n = 32) and those reported in the literature (n = 42) till date.MethodsA detailed history was obtained from the index patient after informed consent. Aspirated fluid was subjected to microbiological investigations. Identification of isolate was done by molecular technique using Sanger's sequencing. All isolates stored at the National culture collection of pathogenic fungi as M. romeroi were retrieved and identity confirmed by ITS sequencing. Demographic and management details were retrieved. We also conducted a systematic literature review of M. romeroi, as per PRISMA guidelines (Fig. 1).ResultsIndex case history: A 59-years-old diabetic female presented with lobulated swelling and sinuses on dorsum of the right hand for 10 months. A provisional diagnosis of mycetoma was made. Calcofluor-potassium hydroxide mount of aspiration fluid revealed dematiaceous septate hyphae and Sabouraud dextrose agar grew non-sporulating greyish black aerial mycelia after 3 days of incubation at 25°C and 37°C (Fig. 2). Molecular identification confirmed isolates as M. romeroi and patient was started on itraconazole with surgical excision. A total of 32 cases of M. romeroi infection from India were included. Mean age of patients was 47.2 years with male:female ratio of 1.3:1. Most common predisposing factors were post-renal transplant (46%) and farming (24%). All the patients presented with nodular or cystic swellings, with frequent involvement of lower limbs (56%). Most of the patients were managed using itraconazole (46%), followed by amphotericin B. All the patients except one responded well to treatment.Literature review: A total of 42 cases have been reported till date, of which 29% are from India. The mean age was 52.3 years, with male:female ratio of 1.4:1. Most common predisposing factors were post-renal transplant (28.5%) and farming/gardening (16.67%). The mean duration to infection in post-transplant cases was 3.26 years and the mean duration to diagnosis in all the cases was 31 months. The noteworthy finding was the absence of predisposing factors in 21.45% cases. A total of 62% presented with skin nodules on the foot, 21.5% on lower limbs, and 11.8% with ocular affliction. Identification was done using molecular modalities in 80% cases. A total of 34% cases were managed using both surgical excision and antifungals, whereas 21% were merely with surgical excision. Another remarkable finding was spontaneous resolution in 5% cases. Antifungals used include itraconazole (25%), followed by voriconazole (21%). MICs of all antifungals showed wide variation (0.25-8 μg/ml for AMB). All the patients except two responded well to treatment and 3 had residual disease.ConclusionMedicopsis romeroi is an emerging cause of subcutaneous infection in India. The present study underlines the significance of molecular tests in the identification of this dematiaceous fungus due to its poor sporulation, hindering the phenotypic characterization.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P201
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P050 Candida auris and non- auris candidemia in adult patients in a
           tertiary care set-up, New Delhi, India

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThe aim of this study was to determine the species distribution, compare Candida auris and non-C. auris candidemia risk factors and antifungal susceptibility pattern of candidemia cases in adult patients at a tertiary care hospital, New Delhi, India.Materials and MethodsCandida species identification was performed by phenotypic methods, VITEK (Biomerieux, France), and DNA sequencing (PGIMER, Chandigarh). The antifungal susceptibility was performed by broth microdilution method as per CLSI M27-A4 guidelines 2017.ResultsOut of 1274 blood samples, 70 samples (5.5%) yielded the growth of Candida species. There was a predominance of NAC spp. over C. albicans in candidemia patients. C. auris (12.85%, 9/70) and non-auris candidemia (87.14%, 61/70) was isolated in this study. In non-auris candidemia, C. tropicalis (28.57%, 20/70) was the predominant Candida species followed by C. parapsilosis (22.85%, 16/70), C. glabrata (14.28%, 10/70). Rare species among NAC spp. included C. mesorugosa, C. lusitaniae, C. krusei and C. haemulonii were isolated. The most common predisposing factor for C. auris and non-auris candidemia was urinary catheter (72.85%, 51/70) followed by an increased period of hospitalization (42.85%, 30/70), diabetes mellitus (21.5%, 15/70), etc. The significantly associated risk factor associated with C. auris was diabetes mellitus (P = .02). The overall resistance was 22.57% to all antifungal drugs. The multidrug resistance (MDR) was noted in 5.71% of isolates.ConclusionsEarly identification of risk factors, Candida speciation, and timely management are crucial for the outcome of candidemia cases. Non-albicans species were predominant over C. albicans depicting the change in the epidemiology and emergence of MDR Candida spp. like C. auris, C. glabrata, C. mesorugosa, C. lusitaniae, and Pichia kudriavzevii (C. kruseii). This warrants routine antifungal susceptibility testing (AFST) and close monitoring. The knowledge of local epidemiological profiles of Candida spp., accurate species identification, and their antifungal susceptibility is crucial for overall patient management.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P050
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P054 Two effects of curcumin to Candida albicans

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesCandida albicans is a pathogenic yeast that causes candidiasis in immunocompromised patients. The overuse of antifungal drugs has led to the development of resistance to such drugs by this fungus, which is a major challenge in antifungal chemotherapy. The utilization of natural products is a significant trial for the development of new antifungals. Curcumin, one such natural product, has been widely studied as a drug candidate and is reported to exhibit antifungal activity against C. albicans. Although studies of the mechanism of curcumin against human cancer cells have shown that it inhibits heat shock protein 90 (Hsp90), little is known about its molecular function against C. albicans. In this work, we investigated the relationship between curcumin and Hsp90 of C. albicans.MethodsFor the molecular genetical analyses of C. albicans Hsp90, a doxycycline-mediated HSP90 strain and a HSP90-overexpressing strain of this fungus were constructed. The effect of curcumin on the gene expression of HSF1, AHR1, HOG1, and CDR1 as well as HSP90 was analyzed. Moreover, the stress responses to high temperature and osmotic pressure and the drug efflux of these strains were investigated.ResultsCurcumin reduced the transcription of HSP90 at the post-transcriptional level and it was suggested to lead to the decrease in Hsp90. This phenomenon resulted in the downregulation of HOG1 and CDR1. In addition, we confirmed curcumin also inhibited Cdr1 efflux activity in C. albicans.ConclusionCurcumin was suggested to influence not only HSP90 expression but also Cdr1 activity in C. albicans.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P054
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P080 Comparison of efficacy of innovator molecule of itraconazole with
           generic forms of itraconazole in treatment naïve subjects with chronic
           pulmonary aspergillosis

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectiveItraconazole capsule has a variable and unpredictable bioavailability. Whether generic brands of itraconazole are as effective as the innovator molecule in the treatment of subjects with chronic pulmonary aspergillosis (CPA) is unclear. We compared the proportion of subjects who achieved therapeutic drug levels with the generic and the innovator itraconazole at 2 weeks after treatment initiation.MethodsIn this retrospective study, we compared the proportion of subjects with CPA achieving therapeutic drug levels (≥ 0.5 mg/l) with the generic and the innovator itraconazole at 2 weeks after treatment initiation. We performed a multivariate logistic regression analysis to ascertain if the trough itraconazole levels affected the treatment outcomes. We also performed morphometric analysis of different brands of itraconazole by video dermoscopy.ResultsA total of 193 [generic brands (n = 94) and innovator itraconazole (n = 99)] subjects of CPA were enrolled. The median (IQR) age of the study population [54% (105/194) men] was 42 (32-55) years. The proportion of subjects who achieved therapeutic trough itraconazole levels was significantly (P <.0001) higher with the innovator than the generic brands [72/99 (73%) vs. 27/94 (29%)]. The median trough itraconazole level at 2-weeks was also higher with the innovator brand than the generic brands [0.8 (0.5-1.6) vs. 0 (0.0.5) mg/l]. The average trough itraconazole levels and the trough itraconazole levels >1 mg/l independently predicted favorable treatment response after adjusting for age, gender, and CPA severity. The generic brands had a variable number, size, and a larger pellet size on the morphometric analysis. Two brands had dummy particles.Table 1.Outcomes.Total (n = 193)Generic drug, (n = 94)Innovator molecule (n = 99)P-valuePrimary outcomeProportion of subjects achieving ≥0.5 mg/l at 2 weeks99 (51.3)27 (28.7)72 (72.7)<.0001Secondary outcomesItraconazole levels at 14 days, mg/l0.5 (0-1)0 (0-0.5)0.8 (0.5-0.1.6)<.0001Average itraconazole levels, mg/l1.4 (0.7-2.4)0.8 (0.4-1.3)2.1 (1.2-2.8)<.0001Proportion of subjects achieving average itraconazole ≥1 mg/l98 (50.8)24 (25.5)74 (74.7)Adverse events, n (%)43 (22.3)23 (24.5)20 (20.2).494* A total of 27 subjects with generic drug achieved therapeutic drug levels and were not given the innovator molecule.ConclusionSignificantly higher proportion of subjects achieved therapeutic drug levels with the innovator brand of itraconazole than the generic brands. Importantly, the serum itraconazole levels independently predicted a favorable response to treatment in CPA.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P080
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P081 Azole-resistant Aspergillus fumigatus among NIH hospitalized patients
           with underlying primary immunodeficiencies

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesAspergillus fumigatus causes a variety of diseases in humans. The drugs recommended for treatment of Aspergillus diseases are the mold-active azole antifungals. However, a wide range of mutations in A. fumigatus confers azole resistance, which commonly involves modifications in the cyp51Agene, the target for azole antifungal drugs.MethodsWe investigated 255 clinical A. fumigatus isolates obtained from patients hospitalized at National Institutes of Health Clinical Center, Bethesda, Maryland, USA. The species-level identification of each isolate was evaluated by colony morphology, microscopic characteristics, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF), and PCR-sequencing of the β-tubulin gene. We also studied sequence-based analysis of the Cyp51A gene for the azole-resistant isolates.The azole antifungal susceptibility profile of each isolate was initially evaluated using 4-well triazole screen plates (Microbiology Associates LLC, Rockville, MD, USA) containing itraconazole (4 μg/ml), voriconazole (2 μg/ml), posaconazole (0.5 μg/ml), and growth control. The full array of antifungal susceptibility was confirmed using microbroth dilution method according to Clinical and Laboratory Standards Institute CLSI M38-A3 guidelines.ResultsOf 255 A. fumigatus isolates, 12 grew on the wells containing azoles, indicating an azole-resistant phenotype. The results were read and recorded after 24 and 48 h of incubation at 35-37°C. Majority of our isolates had visible growth at 24 h. Sequence analysis of the CYP51A gene indicated the presence of M220K mutation in all 12 isolates and no mutations in the other isolates.The fact that the azole resistance was found in A. fumigatus isolated from patients with previous azole exposure, underscores the possibility that prevalence of azole-resistance might be underestimated in various patient populations because in-vitro susceptibility testing of A. fumigatus is not routinely performed.ConclusionIn conclusion, prevalence of azole resistance in clinical A. fumigatus isolates obtained from NIH patients underlying primary immunodeficiencies was 4.7%; all the resistant isolates exhibited azole-resistance mutation in Cyp51A gene.Our finding adds to the growing list of regions where acquired resistance in A. fumigatus of is documented. Our results also indicate that 4-well triazole screen plates are a reliable tool for azole-resistance screening and the selection of isolates that require a full panel of antifungal susceptibility testing.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P081
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P118 Pentraxin-3 interacts with Aspergillus fumigatus conidia to regulate
           pro-inflammatory cytokine production

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesLong pentraxin-3 (PTX3) is a soluble pattern-recognition receptor secreted by phagocytes and non-immune cells at sites of inflammation. It has been reported to have a nonredundant role in the immune response against Aspergillus fumigatus. Indeed, PTX3 knock-out mice show an increased susceptibility to invasive pulmonary aspergillosis (IPA) with a higher mortality rate. In humans, PTX3 genetic deficiency or single nucleotide polymorphism has also been associated with an increased risk of IPA. However, the way in which PTX3 interacts with A. fumigatus and its mechanism of action has yet to be elucidated. The aim of the study was to investigate potential A. fumigatus ligands for PTX3 and the impact of A. fumigatus opsonization by PTX3 on modulating the immune response.MethodsAspergillus fumigatus conidia, the infective morphotype, were incubated with PTX3 with or without human serum, stained with anti-PTX3 antibody, and studied by immunofluorescence. Identification of potential fungal ligands for PTX3 was performed by ELISA. Fixed conidia and germinated conidia were opsonized with different serum factors and co-incubated with human monocyte-derived macrophages (hMDM) for 24 h at 37°C. Culture supernatants were collected, and pro-/anti-inflammatory cytokines were measured by sandwich ELISA.ResultsPTX3 did not bind A. fumigatus conidia directly but in the presence of human serum, purified collectins [surfactant protein D (SP-D) or C1q], and complement products (C3b). Pre-opsonization of conidia with these complement proteins or SP-D stimulated proinflammatory cytokine secretion by hMDM upon interaction (Fig. 1a). In contrast, secondary opsonization of complement proteins or SP-D opsonized conidia with PTX3 significantly reduced pro-inflammatory cytokines and increased anti-inflammatory cytokine secretion from hMDM. PTX3 opsonized PFA-fixed germinating conidia significantly reduced pro-inflammatory cytokine and increased anti-inflammatory cytokines secretion from hMDM (Fig. 1b).ConclusionPTX3 is an acute phase protein expressed in response to pro-inflammatory stimuli during infection and that is increased in bronchoalveolar lavage of patients with aspergillosis. Our recent data with A. fumigatus suggest that PTX3 is an immunoregulatory protein that reduces pro-inflammatory response. Although an inflammatory response is necessary to fight against fungal pathogens, the tissue damage associated with enhanced inflammation can be deleterious and facilitate A. fumigatus infection.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P118
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P119 Dysregulated IL-23R and CD25 T cells in post -COVID-19 Rhino-Orbital
           Mucormycosis patients

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTo study the IL-23R (Th17) and CD25+ (Treg) in CD4 + T cell populations in rhino-orbital mucormycosis post-COVID-19 patients and in healthy controls.MethodsThe study included 20 cases of mucormycosis and 20 healthy controls. Nasal crust, collected post-surgery was subjected to KOH/culture for mycological identification. Venous blood sample (3 ml) was collected in EDTA vials from cases and controls and stained with different monoclonal antibodies such as CD3, CD4, CD25, and IL-23R for analyzing the expression of Th17 and Treg cells by flow cytometry. The assays were performed at the time of enrolment of patients and repeat blood samples were taken from each patient for staining 3 months later after treatment prescribed by Otorhinolaryngologists. Statistical analysis was done using SPSS software and the P-value ≤ .05 considered as significant. All the data are expressed as the mean ± SD.ResultsAll the cases were found positive by KOH and confirmed for Rhizopus arrhizus by culture.The flow cytometry analysis showed that the percentage of CD4 + IL-23R+ (Th17) cells was significantly high in patient before treatment compared to healthy controls and found to be lower post 3 months of antifungal treatment. The percentage positivity of CD4 + CD25+ (Tregs) cells was decreased in patients (before treatment) as compared to controls and after treatment groups. The percentage positivity of CD4 + CD25 + cells was significantly increased in patients after treatment.ConclusionWe observed a noticeable immune imbalance, with elevated CD4 + IL-23R Th17 and diminished CD4 + CD25 + T regulatory cells. The findings imminently indicate the mechanism of immune dysregulation involving Th17 and Treg pathways in mucormycosis and provide evidence that restoration of Th17/Treg may be considered as a therapeutic option for long-term benefit. Recovery of CD4 + CD25 + T cells after treatment indicated a favorable phenotype outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P119
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P147 Fungal osteomyelitis in patients with chronic granulomatous disease:
           a case series from a tertiary care medical centre.

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo present details of a case series of fungal osteomyelitis initially misdiagnosed as disseminated tuberculosis, in pediatric patients with chronic granulomatous disease.MethodInformed consent was obtained from the parents of three children (known cases of chronic granulomatous disease) with clinical features suggestive of chronic osteomyelitis. Clinical history was collected by interview and chart review. Samples were sent to the mycology laboratory for direct microscopy and fungal culture. Following a diagnosis of fungal osteomyelitis, antifungal therapy was administered and patients were monitored till discharge.ResultsFirst case:The first patient presented with fever, cough and progressive painful swelling over the left lower chest, and a past history of recurrent pneumonia and cervical lymphadenopathy, which were previously empirically treated with anti-tubercular therapy (ATT) and broad-spectrum antibiotics. Imaging revealed a soft tissue abscess with underlying rib osteomyelitis and pulmonary consolidation. Pus samples showed hyaline septate hyphae in direct microscopy and growth of Aspergillus nidulans in culture. The patient was successfully treated with intravenous voriconazole, which was switched to oral formulation on discharge.Second case:The second patient presented with fever and post-auricular swelling with multiple discharging sinuses, and a past history of fever and hilar lymphadenopathy, which were previously empirically treated with ATT and broad-spectrum antibiotics. Imaging revealed osteomyelitis involving mandible, temporal bone and skull base, with underlying sigmoid sinus thrombosis. Pus and tissue samples showed hyaline septate hyphae in direct microscopy and growth of Aspergillus fumigatus in culture. The patient was successfully treated with a combination of intravenous voriconazole and liposomal amphotericin B, and discharged on oral posaconazole.Third case:The third patient presented with progressive painful swelling over the right upper chest, and a past history of pneumonia, hemoptysis, and mediastinal lymphadenopathy, which were previously empirically treated with ATT and broad-spectrum antibiotics. During a previous hospitalization, imaging showed features suggestive of fungal pneumonia; BAL showed hyaline septate hyphae in direct microscopy and growth of Aspergillus fumigatus and Aspergillus flavus in culture, providing a diagnosis of fungal pneumonia which was treated with voriconazole and liposomal amphotericin B. During the present admission, imaging of the chest lesion revealed pus collection with underlying rib osteomyelitis, communicating with a cavity in the middle lobe of the right lung. FNAC from the lesion showed hyaline septate hyphae in direct microscopy but no growth in culture (probably due to previous antifungal therapy). The patient was successfully treated with a combination of intravenous voriconazole and liposomal amphotericin B, and discharged on oral posaconazole.ConclusionsFungal pneumonia and fungal osteomyelitis are often misdiagnosed as tuberculosis or bacterial infections, leading to unnecessary and ineffective ATT or broad-spectrum antibiotics. A high index of suspicion for fungal osteomyelitis is required in pediatric patients with a history of recurrent/chronic soft tissue infections, preceded by febrile episodes and/or pneumonia, especially if a diagnosis of chronic granulomatous disease (CGD) has already been established; if not, this characteristic clinical picture should in fact warrant evaluation for CGD.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P147
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P148 Emerging and cryptic Aspergillus species isolated from hospitalized
           patients with underlying primary immunodeficiencies

    • Abstract: Abstract Poster session 2 September 22 2022 12:30 PM - 1:30 PMObjectivesAlthough Aspergillus fumigatus is the most common etiologic agent of invasive aspergillosis multiple poorly recognized non-fumigatus species have been reported from patients with iatrogenic immunosuppression and individuals with underlying primary immunodeficiencies (PIDs). The species-level identification of causative agents and the determination of antifungal susceptibility patterns can play significant roles in the outcome of aspergillosis. In the current study we aimed to investigate the frequency of non-fumigatus Aspergillus species isolated from hospitalized patients with PIDs at National Institutes of Health (NIH) Clinical Center Bethesda MD USA.MethodsIn a prospective study between January 2019 and December 2021 a total of 279 Aspergillus species were isolated from NIH hospitalized patients with underlying PIDs. The species-level identification of each isolate was attempted by colony morphology microscopic characteristics matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF) and PCR-sequencing of the internal transcribed spacer (ITS) region of ribosomal DNA the β-tubulin and Calmodulin (CaM) genes.ResultsOverall members of Aspergillus section Fumigati were the most common group (71%) followed by section Veriscolores (7%) section Usti (4%) section Tanneri (4%) section Terrei (3%) section Nigri (3%) and section Nidulantes (3%). Aspergillus species belong to sections Falvi Clavati Flavipedes and Circumdati were less frequent and each counted for only 1% of the total isolates identified.Notably cryptic and non-fumigatus members of section Fumigati comprised only 12% of the isolates including A. felis A. udagawae A. lentulus A. thermomutatus A. viridinutans, and A. pseudoviridinutans while A. fumigatus was the dominant species (88%).MALDI-TOF assay was able to properly differentiate sections of Aspergillus from each other. However PCR-sequencing of the β-tubulin gene was the most reliable target to separate the cryptic species of each section.ConclusionOur study shows that frequency of rare and cryptic Aspergillus species that primarily affect patients with PIDs may significantly differ from those with acquired immunodeficiencies.Due to their lower susceptibility to available antifungal agents than A. fumigatus correct and prompt identification at the species level is critical for appropriate therapy to improve patient outcomes.In addition DNA sequence-based species identification targeting β-tubulin gene is more accurate than ITS and CaM genes and using MALDI-TOF to differentiate the emerging and cryptic Aspergillus species.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P148
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P157 Entomophthoromycosis: a rare fungal infection case series

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo present a case series of entomophthoromycosis (a rare fungal infection of the skin and subcutaneous tissue with a protracted and chronic clinical evolution), which would aid in the early recognition and management of this condition.Materials and MethodsA total of 7 laboratory-confirmed cases of entomophthoromycosis, diagnosed and treated between May 2018 and March 2022 at our center, were included in the series. Diagnostic criteria were based on the results of conventional mycological diagnostic methods, including direct epifluorescence microscopy and visual identification of isolates obtained by culture on solid media. Clinical histories were collected retrospectively by chart review and correlated with laboratory findings.ResultsOf the seven patients, six were male and one was female, with ages ranging from 2.5 to 42 years. Most of the patients presented with chronic progressive nasal or rhinofacial swelling and nasal obstruction. Aseptate or pauciseptate hyphae were observed in direct epifluorescence microscopy of tissue samples from all the patients. Conidiobolus spp was isolated from samples from five patients, and Basidiobolus spp from the remaining two. Although growth in culture was obtained several days after sample inoculation, specific antifungal treatment for entomophthoromycosis (using a combination of potassium iodide and itraconazole) was initiated early based on concurrence between clinical features, typical fungal elements seen in direct microscopy and histopathological findings. All the patients improved rapidly and made full recoveries.ConclusionEntomophthoromycosis is a rare condition whose identification requires a high index of clinical suspicion. The treatment for this condition is specific and different from the treatment for other clinically significant invasive fungal infections, but confirmation of diagnosis by culture may take weeks. Therefore, early diagnosis supported by a combination of suggestive clinical features as well as mycological and histopathological evidence, is vital to ensure successful outcomes.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P157
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P158 Epidemiology of aspergillosis in Kuwait: a nationwide study

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesAspergillus is the most common filamentous fungi involved in human infections. It is characterized by causing various forms of clinical presentations, ie, invasive, chronic, and allergic forms. It is associated with considerable morbidity and mortality. In spite of this, the epidemiology of Aspergillus infections is scarce in Kuwait. This study aims to describe the epidemiology of aspergillosis in Kuwait on a national scale.MethodsThis is a 2-year retrospective observational study designed to analyze the demographic and mycological data on all Aspergillus isolates derived from clinical samples processed or submitted to the Mycology reference laboratory (MRL) by all government microbiology laboratories in Kuwait. Using the Mycology reference laboratory surveillance system, the required data was collected. It covers patients’ age, gender, type of clinical samples, care settings (outpatient, wards, or ICU), the name of the Aspergillus species, and antifungal susceptibility for Aspergillus fumigatus. Species-level identification of Aspergillus was mostly based on morphological characteristics, except in a few cases where MALDI-TOF or PCR-sequencing of rDNA were performed. Antifungal susceptibility testing was done using Etest method according to manufacturer instructions. EUCAST clinical breakpoints were followed for the interpretation of antifungal susceptibility results for A. fumigatus species.ResultsIn total, 327 Aspergillus isolates from 277 patients were found. A total of 34/277 patients had 2 or more samples yielding either the same Aspergillus spp. (n = 17) or a different species (n = 17). The most prevalent type of clinical specimens was respiratory sample (n = 196, 60%), followed by ear swabs (n = 64, 19.6%), and nails (n = 24, 7.3%). A. niger (n = 147) was the most isolated species, involving 45% of aspergillosis cases followed by four other species including A. fumigatus (n = 64), A. flavus (n = 55), A. terreus (n = 38), and A. nidulans (n = 13). A total of 10 cases were caused by rare Aspergillus spp. All A. fumigatus isolates were susceptible to voriconazole. Itraconazole also exhibited excellent in vitro activity against nearly all A. fumigatus except 4 isolates that were resistant.ConclusionsThis study reveals the epidemiology of aspergillosis from several perspectives. It gives some insights on the burden of Aspergillosis in Kuwait, especially during the COVID-19 pandemic. Respiratory samples were the predominant positive samples suggesting high rates of pulmonary aspergillosis. A. niger, not A. fumigatus or A. flavus, is the most prevalent agent of aspergillosis in Kuwait. Azole resistance is rare among A. fumigatus. Further studies are needed to explore the spectrum of clinical presentations with special emphasis on pulmonary aspergillosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P158
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P159 The impact of COVID-19 pandemic on invasive Candida auris infections
           in Kuwait

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesTo evaluate the impact of the coronavirus disease (COVID-19) pandemic on the incidence of Candida auris invasive infections at a national level.MethodsThis is a laboratory-based, three years-period retrospective study. The demographic and mycological data were obtained from the mycology reference laboratory (MRL) active surveillance system. The number of C. auris blood isolates was retrieved for the following years: 2019, 2020, and 2021. C. auris blood isolates from all hospitals were sent to the MRL as part of patient care. Species-level identification was confirmed by chromogenic media, VITEK 2 yeast identification system, and/or MALDI-TOF MS (VITEK MS). Antifungal susceptibility was performed using Etest according to manufacturer instructions. The following antifungal agents were tested: amphotericin B, fluconazole, voriconazole, and caspofungin. If the strain was resistant or intermediate to caspofungin, other echinocandins (micafungin or anidulafungin) were tested for confirmation. Since there were no established clinical breakpoints for C. auris, tentative minimum inhibitory concentrations were used based on experts’ opinions. Incidence rates of COVID-19 during the years 2020 and 2021 (COVID-19) were obtained from the World Health Organization website. All data were numerically coded and labelled for each variable using Microsoft Excel (Version 16.57, 2021), then analyzed by SAS 9.4 (SAS Institute., USA). P-value <.05 was considered statistically significant.ResultsA total of 307 samples isolated from invasive infections were reported with C. auris in this study (50 in 2019, 102 in 2020, and 155 in 2021). The number of patients reported with C. auris invasive infection increased significantly (P <.05) from 50 in 2019 (pre-COVID-19) to 155 in 2021 (post-COVID-19). This was associated with the waves of the COVID-19 pandemic in Kuwait. Of 307 C. auris isolates tested, all were resistant to fluconazole. Resistance to amphotericin B and caspofungin was 29/307 (9%) and 3/285 (1%) respectively.ConclusionPatients infected with COVID-19 are at considerable risk of invasive candidiasis especially critically ill patients staying in ICU. The significant increase in C. auris invasive infections as seen during this pandemic clearly demonstrates the great ability of this opportunistic pathogen to cause secondary lethal infections among COVID-19 patients. In addition, the spread of C. auris among patients in care facilities results in outbreaks, which further compromises the health care services and threatens patient safety. Therefore, a greater understanding of its epidemiology and awareness among healthcare staff about its identification methods, antifungal resistance profile and infection control measures are essential to improve outcomes and prevent further hospital transmission.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P159
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P160 Paracoccidioidomycosis severe: Bizarre presentation in the face

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroductionParacoccidioidomycosis is a systemic mycosis caused by the dimorphic fungus Paracoccidioides brasiliensis. The disease is restricted to Latin America. It is the principal systemic mycosis in Brazil, with higher incidences in the southern, southeastern and central regions.ObjectivesIt's to report a case of paracoccioidomycosis with a bizarre presentation on the face.Case ReportA 54-year-old male farmer from Açailândia, Maranhão, with a history of an extensive ulcerated lesion that started in the right wing of the nose. After 6 months of evolution, the lesion had already spread reaching the nasal and oral mucosa, evolving with acute respiratory failure, requiring tracheostomy (Fig.1). He was referred to the Cancer Hospital for a biopsy, which was referred for pathological examination, showing an intense inflammatory infiltrate consisting of lymphocytes, histiocytes, neutrophilis with giant, multinucleated cells that phagocytize refrigerant bodies, compatible with paracoccidioidomycosis. Material sent for direct examination and culture, showed positive for Paracoccidioides sp. After PCR amplification of the genetic material and sequencing, P. brasiliensis was identified. Chest tomography showed sparse ground-glass attenuation, but affecting both lungs and radiodense striations in the lower lobes bilaterally. Treatment was established with liposomal amphotericin B, with a good therapeutic response (Fig. 2). The patient was discharged from the hospital using itraconazole and still upper outpatient follow-up, with good healing of the lesions.ConclusionParacoccidioidomycosis can get a severe presentation, distancing the physician from the diagnosis, showing that in all these situations, simple tests, such as the direct examination of lesional material or sputum can elucidate the diagnosis. We need to think about it in endemic area.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P160
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P211 Fungal and bacterial co-infections of the respiratory tract among
           patients with COVID-19 hospitalized in intensive care units

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackgroundsThe pandemic of COVID-19 has created a global public health crisis. ICU patients with COVID-19 are prone to infections of bacterial and/or fungal origins due to several risk factors. Consequently, the current study was conducted to evaluate the frequency, demographic characteristics, underlying conditions, and etiologic agents of fungal and bacterial co-infections of the respiratory tract among ICU patients with COVID-19 in Iran.Materials and MethodsFrom May to October 2020, sputa and endotracheal aspirates were collected from ICU patients hospitalized with COVID-19 who also were suspected of bacterial and/or fungal co-infections according to inclusion criteria. The etiologic agents of bacterial co-infections were identified using the VITEK 2 identification method. For fungal identification, all samples were analyzed by direct microscopy using KOH 10% and culture. Furthermore, all isolates were subjected to the sequencing method.ResultsA total of 73 lung specimens were obtained from patients who met the inclusion criteria. Of these, in 15 cases (20.54%) fungal and/or bacterial co-infections were confirmed. Males were more infected (73.33%) and all of them were between 49 and 79 years. Candida albicans (n = 8, 61.53%) and Klebsiella pneumonia (n = 5, 38.46%) were the most frequent etiologic agents related to fungal and bacterial co-infections, respectively. Pneumonia (n = 15, 100%) and diabetes mellitus (n = 8, 53.33%) were documented as the most prevalent underlying conditions. In the current study, 3 out of 15 patients (20%) died.ConclusionThe frequency of bacterial co-infections of the respiratory tract in ICU patients hospitalized with COVID-19 was relatively high. According to the results, one of the causes of death in these patients could be a secondary infection.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P211
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P212 Fatal invasive aspergillosis in a child with Chronic Granulomatous
           disease; a case report

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIn this article, we have reported a case of invasive aspergillosis in an 8-year-old boy with chronic granulomatous disease, who presented with pleural effusion and pneumonia, cerebral venous sinus thrombosis, and unusual skin lesions (Fig. 1) caused by Aspergillus fumigatus (Fig. 2). The patient received recombinant human interferon-γ subcutaneously (1-2 doses in even days) and antimicrobial prophylaxis, including itraconazole (100 mg/d), cotrimoxazole (5 mg trimethoprim/kg body weight/d), and ofloxacin (3 times a week, 200 mg), during hospitalization.It is noteworthy that treatment was immediately started according to the direct examination results. Due to the MRI findings suggestive of brain abscesses and brain edema, empirical amphotericin and voriconazole were started. The in vitro antifungal susceptibility tests (AFST) of A. fumigatus utilized the microbroth dilution method of the Clinical and Laboratory Standards Institute (CLSI) M38-A2 protocol for five antifungal agents including; voriconazole, itraconazole, fluconazole, caspofungin, and amphotericin B, that the minimum inhibitory concentrations (MIC) of antifungal agents were 0.25, 1, 16, 0.125, and 4 mg/L, respectively. Voriconazole and caspofungin were shown to be the most potent antifungal drugs against this A. fumigatus strain. On the other hand, the IDSA protocols recommend voriconazole as the initial therapy of invasive aspergillosis in most patients. So, in response to the results of antifungal susceptibility testing, treatment was switched to voriconazole at the dose of 100 mg twice a day (taken every 12 h), and interferon-γ subcutaneously (1-3 doses in even days) was introduced. Unfortunately, the patient passed away due to cerebral venous sinus thrombosis (CVST), and intracerebral hemorrhage (ICH) following increased intracranial pressure (ICP) after 1 month.In conclusion, we have reported a case in which a patient who came with pleural effusion and pneumonia in the chest x-ray, CVST, and unusual skin lesion caused by A. fumigatus expired after one month. Our report suggests the importance of early diagnosis in children presenting with invasive fungal infections particularly, those involving the central nervous system.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P212
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P213 Lasiodiplodia theobromae: an emerging human pathogen

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesLasiodiplodia theobromae is a dematiaceous fungus, rarely reported to cause infections in humans. This case-series was conducted to identify the potential risk-factors and spectrum of diseases caused by L. theobromae.MethodsWe performed a retrospective analysis of all cases from which the isolates of the L. theobromae were accessioned at the National culture collection of pathogenic fungi (NCCPF), over the last 10 years (January 2012- March 2022). The isolates were retrieved and identified by conventional (colony morphology, color, and microscopic appearances) and molecular (sequencing of ITS1 region of ribosomal DNA) methods. In vitro antifungal susceptibility testing (AFST) was performed by microbroth dilution recommended by the Clinical and Laboratory Standards Institute (CLSI). (M38-A2). The clinical features, demographic details and outcome were recorded.ResultsIn 10 years, a total of 20 patients were identified. The median age of all cases was 39.5 (range: 13-71 years) and 75% were males. The most common clinical presentation was keratomycosis (12,68.6%), followed by soft tissue/sub-cutaneous infection (3,15%), rhinosinusitis (3,15%), onychomycosis (1, 5%), and pneumonia (1, 5%). Most patients were immunocompetent (85%). Among immunocompromised, two patients had acute myeloid leukemia and developed fungal rhinosinusitis while one patient of post-renal transplant on immunosuppressants developed subcutaneous tissue infection in the interscapular region. The fourth patient had decompensated alcoholic hepatitis, encephalopathy, sepsis, and developed pneumonia while he was on mechanical ventilation. Among the various potential risk factors associated with keratomycosis, the most common were, accidental trauma wounds (9, 45%), and mosquito bite in the eye in one patient. The culture on Sabouraud's dextrose agar (SDA) revealed the growth of black mycelial fungus (Fig. 1a). The lactophenol cotton blue (LCB) mount revealed the presence of only dematiaceous septate hyphae which failed to sporulate (Fig. 1b). All the isolates were confirmed by sequencing of ITS (internal transcribed spacer) region of the rDNA using universal primers ITS1 and ITS2. In vitro antifungal susceptibility testing (AFST) was performed using a broth microdilution (BMD) method which revealed variable MIC (μg/ml), i.e., amphotericin (1-2), voriconazole (0.25-2), itraconazole (8-16), posaconazole (1-2). All patients improved on therapy except one patient who succumbed to death due to pneumonia.ConclusionLasiodiplodia theobromae is an emerging cause of human infections in both immunocompetent and immunosuppressed individuals. It is often difficult to identify due to lack of sporulation making morphological identification challenging. Hence, prompt suspicion and rapid diagnosis with guided therapy are necessary for a better outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P213
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P215 Investigation of an outbreak of neonatal Candida emia in the NICU of
           a 300 -bedded hospital in North India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesNeonatal Candidaemia causes significant morbidity and mortality in very low birth weight neonates. We report the occurrence of an outbreak of neonatal Candidaemia due to Candida krusei in the neonatal intensive care unit (NICU) of a 300-bedded hospital in North India.MethodsA total of 96 blood cultures from 80 neonates admitted in the NICU from October 2020 to April 2021 were received and processed manually in the Microbiology lab. A total of 5 among the 47 yeast isolates were sent to a teaching hospital for identification and antifungal susceptibility testing by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF). Clinical parameters (very low birth weight, gestational age, birth asphyxia, broad-spectrum antimicrobial therapy, intra-uterine growth restriction, and total parenteral nutrition), lab parameters (CRP, platelet count), and patient outcome were evaluated. A total of 26 environmental samples and hand swabs from six health care workers were collected to trace the source of the outbreak. The samples were inoculated on 5% sheep blood agar and MacConkey agar. Regular rounds of the NICU and training sessions were conducted by the infection control team to intensify the infection control measures.ResultsBlood culture results: In all, 57 neonates (71.25%; 57/80) admitted to the NICU had positive blood cultures. A total of 47 blood cultures yielded non-albicans Candida spp. (82.45%; 47/57). The other microorganisms isolated from blood cultures were Pseudomonas aeruginosa (4), MRSA (3), Klebsiella pneumoniae (4) and Acinetobacter baumanni (1). Polymicrobial bloodstream infections were detected in two neonates. All the yeast isolates subjected to MALDI-TOF were identified as Candida krusei and had similar MICs of 0.25, 4, 16, 1, 0.25 and 16 μg/ml for voriconazole, itraconazole, posaconazole, caspofungin, micafungin and fluconazole respectively.Culture results of environmental sampling: Yeast could not be isolated from any environmental sample and hand swabs of health care workers. However, MRSA was isolated from the hands of one health care worker.Observation during the infection control rounds:Sterile gauze pieces soaked in iodine and kept in plastic bottles were being used for skin antisepsis before collecting samples or before introducing an IV cannula.The nursing staff did not wear sterile gloves while collecting blood samples or introducing IV cannula in case of NICU patients.It was observed that the used bottles of IV fluids (eg. Ringer lactate, normal saline) were not capped and kept at room temperature.Intensive infection control measures and training sessions were effective in controlling the outbreak.ConclusionWe report the occurrence of a massive outbreak of neonatal Candidaemia in the NICU of our hospital with a positivity rate of 58.75% (47/80). Identification of yeast and determination of antifungal susceptibility is important for prompt treatment. Though the source of the outbreak could not be traced but intensifying infection control practices could control the outbreak. This study emphasizes the value of educating healthcare workers and regular monitoring of disinfection practices to prevent health-care-associated infections.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P215
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P271 A masquerading case of Cryptococcus neoformans

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroduction: Cryptococcal infections are commonly seen in immunocompromised hosts, especially HIV-infected patients and patients on immunosuppressive therapy. Cryptococcus shows a strong tropism for the central nervous system however cutaneous tropism is not uncommon. Here we describe an HIV-negative immunocompromised patient who developed disseminated cryptococcosis with the predominant presentation being painful thigh lesions.Case Details: A 56-year-old lady presented with skin lesions and burning pain over both thighs for 1 month and a high-grade fever for 15 days. Her thigh lesions were initially treated elsewhere as tinea corporis. Her previous medical history was significant for poorly controlled diabetes, and chronic liver disease (secondary to autoimmune hepatitis or AIH). Her ongoing medications included prednisolone, anti-diabetics, and tenofovir. At presentation, the only significant physical findings were large irregular areas of central hypo-pigmentation with peripheral hyper-pigmentation and superficial small blisters over both thighs. These areas showed signs of inflammation. The empiric antimicrobial therapy included piperacillin-tazobactam and fluconazole (in view of prior urine culture growing Candida species). Over the next 48 h, fever continued, thigh pain worsened and the lesions on thighs blistered with violaceous discoloration. Her blood cultures sent at admission grew Candida kruzei, resistant to fluconazole, sensitive to voriconazole, amphotericin and echinocandins. Beta-D Glucan was also elevated. Fluconazole was discontinued, and anidulafungin was initiated. A repeat culture (prior to the start of anidulafungin) was still positive for C. krusei, but a subsequent blood culture (after the start of anidulafungin) was negative. Echocardiography did not show features of endocarditis. After a transient improvement, she worsened again with breakthrough fever, hypotension, and worsening of thigh lesions with eschar formation. Wound debridement was done, and antibiotics were escalated to carbapenem and polymyxins. Tissue cultures (sent during wound debridement) grew carbapenem-resistant klebsiella pneumonia. With these, the fever and her wounds were better; but the fever still persisted and she described a persisting severe burning pain over both the thigh wounds which did not respond to several analgesics.A few days later, the fever worsened, and she had hypotension and disorientation. Blood and urine cultures were repeated. Repeat Serum beta D glucan levels were elevated. CSF examination was not possible in view of severe coagulopathy. The blood and wound cultures both grew C. neoformans (confirmed on MaldiTOFF). Antibiotics and anidulafungin were discontinued; liposomal amphotericin and flucytosine were started. Patient had significant improvement in sensorium, fever, and thigh pains within the next 72 h. Later, liposomal amphotericin was switched to conventional amphotericin because of financial constraints. This was followed by acute kidney injury and a flare of AIH. Amphotericin and flucytosine were withheld for a few days; a pulse of methylprednisolone was needed for AIH. Following resolution of acute kidney injury and AIH flare, conventional amphotericin B and flucytosine were restarted (and given for cumulative 3 weeks). This was followed by fluconazole consolidation. At hospital discharge, although there were raw areas over the thighs, these were healthy and she was otherwise well. A total of 3 months later, skin grafting was successfully performed.Conclusions: Cryptococcus can be a great masquerader, and can mimic a variety of conditions. A high index of suspicion is required to clinch the diagnosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P271
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P272 Fungal brain abscess in the era of COVID 19: an experience from a
           tertiary care Neurosciences Institute in South India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroduction: Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is ruling the world for more than 2 years since 2020. In 2021, the second wave of COVID-19 attributed to the ‘delta variant’ swept across India, causing significant morbidity and mortality. In addition, the epidemic of COVID-19-associated mucormycosis affected the Indian subcontinent specifically, with a whopping 41 512 cases and 3554 deaths attributed to this dreadful disease.MethodsThe single-center retrospective cross-sectional study was aimed to determine the impact of COVID-19 on fungal brain abscess cases at a non-COVID tertiary care Neurosciences Institute in South India. The study included all cases diagnosed with fungal brain abscess microbiologically (microscopy and/or fungal culture), supported by radiological findings or by histopathological examination. Cases of brain abscess which were negative for fungal elements by microscopy, culture, and imaging were excluded from the study. Fungal culture was done on routine mycological media as per standard procedures. Fungal identification was done by microscopic morphology, MALDI-TOF MS, and ITS sequencing.ResultsA total of 406 cases of brain abscess were recorded between January 2020 and April 2022. Out of these, 26 (6.4%) were cases of fungal brain abscess. In 2020, three out of 153 (2%) cases had a fungal etiology, while it was 10.4% (22/211) in 2021 and 0.24% (1/42) till April 2022. Overall, a male preponderance was observed (20/26, 77% were males). The cases had an even distribution from 6 to 62 years, with no predilection in any particular age group. The most common underlying comorbidity was type 2 diabetes mellitus (13/26, 50%). Four cases had a past history of COVID-19. Radiological suspicion of fungal infection was present in all the cases. Mycological examination (wet mount and 20% KOH mount) of brain abscess pus from all the cases revealed fungal elements. Out of 26 cases, 23 cases showed hyaline, broad aseptate hyphae, 2 showed melanized septate hyphae and 1 showed budding yeast cells with pseudohyphae and arthroconidia on direct microscopy. Culture positivity was observed in 15 cases (57.7%). Out of 23 suspected cases of rhinocerebral mucormycosis based on clinical, radiological, and direct microscopic findings, fungal culture was positive in 13 cases, all of which were identified as Rhizopus arrhizus. Out of two cases that showed melanized hyphae in direct microscopy, one grew a dematiaceous mold that was identified as Cladophialophora bantiana. The other melanized fungus failed to grow in culture. The single case of brain abscess caused by a yeast-like fungus was attributed to Trichosporon dohaense, identified by ITS sequencing. It was initially misidentified as T. ovoides/T. mucoides by VITEK MS due to lack of mass spectral database for T. dohaense.Conclusions: A significant increase in the incidence of fungal brain abscess has been observed in the COVID-19 era, particularly with each new wave of infection. Clinical features along with imaging and mycological findings are crucial in making an early diagnosis and decision regarding antifungal therapy. Accurate identification to the species level is necessary to guide optimal antifungal therapy as several species exhibit emerging resistance to antifungal drugs.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P272
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P273 Diagnostic dilemmas in Pneumocystis pneumonia in case of long COVID
           -19

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackground: To diagnose Pneumocystis pneumonia in an underlying COVID-19 infection is difficult because of the clinical and radiological indistinguishableness of the presentation.Case Presentation: We report the case of a 67-year-old male background of type 2 diabetes mellitus (DM) and hypertension (HTN), who presented to the emergency department for severe dyspnea for 6 days. He is treated with corticosteroid and other supportive therapy. Initially, the patient responded with that treatment but suddenly his hypoxia is increasing and getting intubated. All possible causes of deterioration hypoxia were evaluated and came negative. Later stage, BAL was done and immunofluorescence test for PCP came positive. Systemic, cotrimoxazole started and gradually hypoxia improved and extubated.ConclusionPneumocystis and COVID-19 co-infection needs serious consideration, particularly for patients with long-term COVID-19, even if patients do not have conventional risk factors for Pneumocystis pneumonia.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P273
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P274 COVID-associated invasive pulmonary aspergillosis (CAPA) — a
           case report

    • Abstract: AbstractPoster session 2, September 22, 2022, 12:30 PM - 1:30 PMCOVID-associated pulmonary aspergillosis (CAPA) is a severe fungal infection with a high mortality rate. The incidence of CAPA is on the rise possibly due to the prescription of corticosteroids and tocilizumab two repurposed drugs used for treating SARS COV-2. Diagnosis is challenging due to the non-specific nature of symptoms. Voriconazole is the mainstay of therapy. We present a case of a 42-year-old male presenting with left hydro pneumothorax post recovery from COVID infection, and later succumbed to this complication. Patients developing pulmonary aspergillosis after short-term steroid therapy is uncommon. The possibility of aspergillosis in immunocompetent patients should be considered in those on systemic steroids and deteriorating pulmonary functions.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P274
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P324 Phylogenetic and ecological overview of Onygenales

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesTo evaluate the general taxonomy and phylogeny of the order Onygenales using ecological, morphological, and molecular data, stimulate awareness of correct identification of neglected groups in the order, and contribute to the stabilization of the nomenclature.MethodsIn total 97 genera, 385 species, and 553 strains were analyzed in this study. The ITS, LSU, TUB, TEF3, and RP60S gene regions were amplified and sequenced. Sequences for the RPB1, RPB2, and TEF1 regions were retrieved from the NCBI nucleotide database. Whole genome data for 53 strains were also included in phylogenetic tree analyses. Ecology and ascomata morphology for the type species were retrieved from the literature. Phylogenetic trees were constructed using the maximum likelihood methods implemented in IQ-TREE software and MRBAYES v3.2.7 on the CIPRES portal. Additionally, relative divergence time within Onygenales was estimated based on the RelTime method implemented in MEGA 7.ResultsA total of 1667 sequences for LSU (n = 421), ITS (n = 519), TUB (n = 189), RP60S (n = 123), TEF1 (n = 119), TEF3 (n = 144), RPB1 (n = 71), and RPB2 (n = 97) were examined. The results of the combined data analysis yielded 14 clades with ≥90% support for Bayesian probability and ≥80% support for maximum likelihood analyses. Families, based on their type genera and type species, were resolved as Ajellomycetaceae, Arthrodermataceae, Ascosphaeraceae, Eremascaceae, Gymnoascaceae, Onygenaceae, and Spiromastigoidaceae (Fig. 1). Two families were newly introduced as Malbrancheaceae and Neogymnomycetaceae. The family Nannizziopsidaceae clustered amidst members of Onygenaceae. The ecological preferences were classified as soil/oligotrophic, soil/keratinophilic, dung/agricultural, skin/nail, hair/feather, insect/pollen, osmotic habitats, systemic, plant, and other/unknown (Fig. 2). Almost all families in the order have members that can be found on skin and nails, which can cause asymptomatic or symptomatic infections, or members that are able to grow at 37°C and cause systemic infections. Four main types of ascomata morphology were noted: cleistothecium, gymnothecium, spore cyst, and naked fruitbody. The results of RelTime analysis showed that the diversification of species in Onygenales occurred at 103 Mya. The earliest species of the order were found in Gymnoascaceae, while the most recent species were found close to Arthrodermataceae.ConclusionDetermination of the borderlines in the order can be difficult because of the effects of chosen methods, number of samples, number of genes, and also the choice of outgroups. Taxon sampling and inclusion of both type species and related genera in analyses are particularly essential to minimize changes and stabilize nomenclature for longer periods. Providing molecular data for the isolates and making them publicly available is also important to prevent taxonomic disagreements. Significant ecological traits that determine evolution in Onygenales are osmophily, thermophily, cellulolysis, eutrophism, oligotrophism, keratinolysis, and thermal dimorphism. Morphological and physiological characteristics may be informative for habitat choice and evolutionary processes. Cellulolytic and osmophilic abilities might be ancestral characteristics in Onygenales. Even though most of the species are found in soil and are non-pathogenic, environmental and host alterations can lead to the emergence of new fungal pathogens among soil fungi. Therefore, Onygenales continues to deserve close attention.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P324
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P325 Trend of cryptococcal meningitis in patients attending a teaching
           hospital in north-east india — a single center study

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: To determine the changing trend of Cryptococcal meningitis in patients attending Regional Institute of Medical Sciences Hospital, Imphal.MethodsA total of 142 cerebrospinal fluid (CSF) samples collected from patients with suspected meningitis from January 2013 to January 2022 were analyzed in the department of Microbiology, Regional Institute of Medical Sciences, Imphal. The samples were subjected to India ink preparation (IIP), Gram stain, Cryptococcal antigen (CrAg) testing, fungal culture in Sabouraud Dextrose agar (SDA) medium, and Bird Seed Agar.ResultsOut of 142 CSF samples received, direct examination by IIP revealed Cryptococcus in 28 cases (19.7%) whereas, capsular polysaccharide antigen testing using lateral flow immunochromatography kit (CRYPTO-PS) detected a total of 40 cases (28.2%). Culture showed growth of fungus in 22 samples and all were from CrAg positive samples. Maximum number of cases were detected in the year 2019 followed by 2018. Immunosuppression (AIDS) was an important underlying factor. Recurrence was seen in three patients and two cases who were on Cycloserine succumbed while undergoing treatment.ConclusionCryptococcosis continues to be a serious fungal infection among AIDS patients in spite of HAART. High index of clinical suspicion and microbiological examination is necessary to improve clinical outcomes. Whenever immunosuppressive drugs are administered in HIV patients treated earlier for cryptococcosis, monitoring the patient for likely recurrence is to be borne in mind to improve the overall clinical outcome. CrAg testing is an additional armamentarium for the diagnosis of cryptococcosis in the absence of culture positivity.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P325
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P326 DNA replication initiator proteins stabilize the kinetochore in the
           human fungal pathogen Cryptococcus neoformans

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesDNA replication licensing ensures maintenance of the ploidy state by limiting DNA replication once per cell cycle. The mini-chromosome maintenance (MCM) complex is an evolutionarily conserved DNA helicase in eukaryotes that aids this process. Upon activation in the S phase by several protein kinases, the MCM complex unwinds the double-stranded DNA and moves away from DNA replication origins preventing re-initiation of replication in the remainder of the cell cycle. Deregulation of MCM function can lead to malignant transformation of proliferating cells as indicated by their upregulated expression in human cancer and pre-cancerous cells. MCMs, therefore, serve as important biomarkers and potential targets for anti-cancer drugs. This study aims to decipher the effect of deregulated expression of the MCM complex on the cell cycle events of the human fungal pathogen, Cryptococcus neoformans, which is more similar to metazoans than other budding yeast. Aneuploidy-mediated drug resistance is a common mechanism in many major human fungal pathogens including Cryptococcus and Candida.MethodsWe generated conditional mutants of individual subunits of the MCM complex in C. neoformans and assayed the impact of their altered expression on cell cycle events. We also tested the alternative role of MCM subunits in the assembly of the kinetochore, a vital component of the chromosome segregation machinery.ResultsOur screen with MCM conditional mutants identified two in vivo functional subcomplexes that comprise the MCM complex in C. neoformans. Although upregulated expression of either Mcm2 or Mcm3 does not affect cell cycle progression, overexpression of either Mcm6 or Mcm7 led to the accumulation of cells in the large bud stage with nuclear segregation defects. This work provides evidence for the first time for a mitotic role of pre-replication complex proteins, MCM 2-7 complex in Cryptococcus. Depletion of Mcm2 led to arrest of cells in the S and G2/M stages of the cell cycle with defects in nuclear segregation. Localization and expression of several kinetochore proteins upon depletion of Mcm2 established that Mcm2 is vital for kinetochore assembly/integrity. Although the centromeric histone H3 variant, CENP-A, remains largely clustered, the outer kinetochore did not mature indicating that Mcm2 alone or as part of the MCM complex plays a role in kinetochore assembly/integrity and thereby in chromosome segregation.ConclusionA conserved eukaryotic DNA helicase, MCM 2-7 complex, has an unexplored non-canonical role in kinetochore assembly/integrity and chromosome segregation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P326
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P327 Prevalence of orofacial Mycoses in COVID-19patients: experience from
           a tertiary care center in Northern India

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: Due to coronavirus disease (COVID-19) a new group of patients at risk emerged with COVID-19-associated mycoses (CAM). The studies, evaluating the prevalence of CAM are missing in India.Method: To assess CAM prevalence in a tertiary care hospital in India, we applied direct microscopy, fungal culture, and histopathology on respiratory specimens of 285 critically ill COVID-19 patients admitted between September 2020 and March 2022.Result: Among the 285 patients, 187 were male, and 98 were female. A total of 34.03% had mucor (33.01% Rhizopus arrhizus;1.02% R. microsporus), 59.51% had Aspergillus (50% Aspergillus flavus; 41.17% A. fumigatus; 2.94% A. terreus; 2.35% A. niger), 3.04% had both (Rhizopus arrhizus + Aspergillus flavus), and 3.01% (Schizophyllum sps 5; Fusarium 1, Paecilomyces variotii 1) had other types of mycosis on fungal smear and culture.ConclusionConsistent with others, our findings underline the importance of microbiological/pathological assessment in patients with predispositions for COVID-19-associated mycoses but due to the low prevalence, a routine screening seems not to be indicated currently. However, multicenter studies are desirable for substantiation of findings. A high index of clinical suspicion, diagnosis at an early stage, and use of antifungal agents are essential for a successful outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P327
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P328 An overexpression screen identifies Csa25 as a novel cellular
           morphogenesis regulator in the human fungal pathogen Candida albicans

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: Morphological plasticity is one of the key attributes of microbial pathogens contributing to the successful establishment of infection in host tissues. Candida albicans, an opportunistic human fungal pathogen, lives as a commensal in the gut, skin, and genitourinary tracts of most healthy individuals. The budding yeast form helps it to disseminate easily in the host system, and the filamentous form (hypha and pseudohypha) is believed to invade the host tissue. Strikingly, alterations of gene expression that block cell cycle progression at different stages additionally lead to aberrant cellular morphology in C. albicans. While various morphological states of C. albicans have been well-studied, the search for key players bringing about these changes is far from complete. This is supported by the fact that ∼70% of the C. albicans proteome remains functionally uncharacterized. Thus, the primary objective of our study was to identify novel regulators contributing to cellular morphogenesis in C. albicans.Method: In our current study, we screened an overexpression library of C. albicans ORFeome generated to identify novel regulators contributing to chromosome stability (CSA) in C. albicans. The screen involved overexpression of each gene using a tetracycline-inducible promoter for a duration of 12 h, followed by microscopy-based observations to identify associated aberrant cellular morphologies.ResultsScreening of overexpression library of the C. albicans ORFeome identified 14 unique Candidate genes from 1389 genes screened. While the functions of half of them have been verified in C. albicans, the remaining seven genes are not functionally characterized. Each of the seven uncharacterized genes was predicted to be non-essential for viability in C. albicans. Bioinformatic analysis predicts one of these proteins, Csa25, to be carrying a point centromere-specific kinetochore protein Ndc10-like DNA-binding domain at its N-terminus spanning over a region of 273 amino acids. Sub-cellular localization indicates this protein to be present throughout the nucleus at all stages of the cell cycle. Strikingly, overexpression of this protein led to yeast cells forming chains connected by septa, as visualized by calcofluor staining, without hampering nuclear segregation. In addition, a large proportion of cells overexpressing Csa25 were unable to exhibit hyphal morphology when subjected to hyphae-inducing conditions.ConclusionIn conclusion, our study identified Csa25 as a novel morphogenesis regulator involved in the negative regulation of yeast-hyphae transition in C. albicans. Further studies based on host-pathogen interaction will identify the critical role of Csa25 in the pathobiology of C. albicans and its survival in host-specific niches.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P328
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P329 A tele of fungal burden in chronic suppurative otitis media (CSOM)
           patients of a tertiary care center of Nepal

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesThe study was designed to find out the fungal etiological agents in chronic suppurative otitis media (CSOM) patients attending the tertiary care center of Nepal.MethodsThe laboratory-rooted study was performed at the Department of Clinical Microbiology. Specimen was collected in the ENT and Head and Neck Surgery Department of Tribhuvan University Teaching Hospital (TUTH), Nepal from February 2016 to July 2016. All clinical specimens were collected from hospitalized as well as outdoor patients having CSOM. Specimens were processed according to standard methodology. A total of 117 patients having CSOM were confirmed cases by the otolaryngologists and their 123 specimens were included in the study. Ear discharge was collected using sterile swab sticks which were labeled and sent to the laboratory for potassium hydroxide (KOH) mount and fungal culture studies.ResultsA total of 123 specimens were collected and processed. Distribution of patients according to the site among the total patients (n = 117), 69 (59.0%) were specimens from the left ear, 42 (35.9%) right ear, and 6 (5.1%) from both ears (bilateral) (Table 1). The 19-30 years age group was highest (34.1%) and followed by 31-50 years having 23.6%. Occupationally students were higher in number (29.9%) and it was followed by housewives (27.4%). A total of 47.8% of cases are from Kathmandu and remain from different regions of Nepal. Out of 123 specimens, 23 (18.7%) were found KOH mount positive (Table 2). The distribution of fungal isolates is as follows—among total isolates Aspergillus flavus 7, A. fumigatus 6, Acremonium 3, Candida albicans 2, Penicillium 2 A. niger 1, C. krusei 1, C. tropicalis 1, Curvularia 1, Fusarium 1, Mucor 1, and Syncephalastrum racemosum 1 (Table 3).ConclusionThe prevalence of fungi in CSOM patients was quite high (21.9%). This observation was different from the study of India conducted by Kumar et al. (15%) and in contrast with another researcher in Singapore, Loy et al. (8.8%). Aslam et al. from Pakistan study revealed only 2.1% and Khwakhali et al. study from Nepal estimated about 1.94% of the Nepalese population suffer from a serious fungal infection annually (commonly in HIV/AIDS and immunocompromised hosts) which are diluted by our findings. The possible reason may be due to location, temperature, negligence on mycological complications, and their treatment in Nepal. Treatment of CSOM should be based on the result of fungal culture. CSOM cases are found in all age groups (2-80 years) with various health statuses, different occupations, and in dispersed regions of Nepal. Phenotyping identification is cumbersome and have risk of infections which increases the chance of applying genotyping technique will be beneficial. Antifungal susceptibility testing should be mandatory since it helps in improving clinical outcomes by optimization of antifungal practices. Many CSOM patients complained that they were not cured even long time of use of antibacterial drugs. It clears that fungal etiological agents can't be neglected. If I am not wrong, Nepal has no separate designated mycology laboratory. There is also a lack of funding for clinical fungal studies and their awareness regarding fungal pathogens.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P329
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P330 Role of a D-amino acid oxidase (DAO) in an efficient human commensal
           Candida albicans

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCandida albicans is an opportunistic fungal pathogen residing as a harmless commensal component of the human microbiota. In the gut, C. albicans efficiently colonizes and successfully competes to limiting nutrient resources and overcomes the detrimental effect of an array of secondary metabolites released by the host and the dominant bacterial microflora. Among the metabolites, several free D-amino acids are released into the gut lumen, especially as a result of the degradation of bacterial cell walls. We sought to identify the genes that might confer advantages to C. albicans in metabolizing D-amino acids in diverse morphotypes, which might confer a competitive advantage.MethodsAll C. albicans genetically modified strains were constructed using a standard lithium acetate transformation method. The D-amino acid utilization and growth of C. albicans strains were assessed by spot dilution assays on minimal media agar plates at 30°C. Morphological switching between the yeast and hyphal forms was assessed in liquid media using hyphal-inducing conditions in the presence or absence of D-amino acids. Biofilm assays were performed using YNB-galactose media (with or without D-amino acids) on serum-treated 6-well plates at 30°C.ResultsC. albicans genome harbors three ORFs putatively encoding D-amino acid oxidase genes- DAO1orf19.3065, DAO2orf3365, and IFG3orf19.944. D-amino oxidase genes are lost from the genomes of several fungal species belonging to the Saccharomycetaceae family, including the free-living Saccharomyces cerevisiae. We found that C. albicans utilizes and grows on D-leucine, an amino acid known to be released by the gut bacteria into the intestinal lumen. This utilization is dependent on the growth morphotypes since the cells growing in biofilm fail to metabolize D-leucine. However, deletion of IFG3 but neither DAO1 nor DAO2 completely abrogates D-leucine utilization capabilities of C. albicans. The null ifg3 strain is moderately growth-sensitive in presence of D-alanine, an amino acid abundantly present and synthesized in the gut by bacteria for incorporation into peptidoglycan in their cell walls. By comparing Ifg3 protein levels in a leucine auxotrophic strain in different growth modes, we found that the expression of Ifg3 protein increases several folds in the biofilm growth mode in presence of D-leucine, but cells fail to grow optimally and make three-dimensional biofilm. Furthermore, ectopic expression of CaIFG3 in S. cerevisiae, which lost all D-amino oxidase genes, helps the organism to utilize D-leucine as a nutrient resource as well as overcome its inhibitory effect on growth.ConclusionOur results indicate that Ifg3 provides C. albicans the ability to metabolize D-leucine and helps it to overcome the growth inhibitory effect of D-alanine. Based on these primary observations we speculate a crucial role of Ifg3 in providing a competitive advantage against the resident microflora in the gut where continuous turnover of D-amino acids is crucial in maintaining host-microbe symbiotic interactions. Further in vivo commensalism experiments in mice will provide important clues on the role of this enzyme in C. albicans’s ability in gut colonization.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P330
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P331 A screen to identify the regulators of genome stability in the human
           commensal Candida albicans

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesCell division is a well-regulated process ensuring high fidelity propagation of genetic material to maintain genome stability. A plethora of proteins in distinct cellular pathways, like DNA replication, repair, and segregation contribute to a stable genome. Defects in either of these processes are sensed by cellular surveillance mechanisms ensuring faithful segregation of duplicated DNA during cell division. Failure to correct these defects leads to aneuploidy and rearrangements which may affect the cell viability. On the other hand, rearrangements in the genome are a well-known mechanism for attaining drug resistance in fungal pathogens including the human commensal Candida albicans. With a major percentage of the genome being uncharacterized in C. albicans, the regulators of genome stability are poorly studied. To gain a better understanding of the regulation of genome stability and antifungal resistance, we aimed to identify and characterize novel genome stability regulators in C. albicans using an overexpression ORFeome.MethodsWe utilized an overexpression library of C. albicans genes cloned under the regulatable TET-ON promoter. Each construct was stably integrated at the RPS1 locus in a C. albicans chromosomal stability (CSA) reporter strain.1 The CSA reporter strain contains two different fluorescent markers integrated at the same allelic locus of two homologs of chromosome 4: Chr4a and Chr4b. The resulting library was used to measure increased genome instability using flow cytometry-based analysis upon overexpression of individual ORFs. Genome instability was scored by measuring the frequency of loss of one of the fluorescent markers. The distinction between chromosomal loss events and non-chromosomal loss events was made using a third fluorescence marker present at the opposite arm of chromosome 4b.ResultsOut of the 532 C. albicans ORFs screened, five genes upon overexpression exhibited an increased genome instability. Two of these genes increased genome instability primarily by chromosome loss, while the remaining three exhibit genome instability due to non-chromosomal loss events. We identified one phylogenetically restricted gene, CSA11, present only in the CTG clade species of Ascomycota, with a previously unknown function in genome stability. CSA11 is important for cell cycle progression. Overexpression of CSA11 significantly increased the rate of erroneous chromosome segregation leading to aneuploidy.ConclusionWe identified a phylogenetically restricted gene, CSA11, whose overexpression resulted in chromosome mis-segregation leading to aneuploidies. Further characterization and understanding of the regulatory mechanisms of these Candidate genes may reveal unknown pathways for maintaining genome stability and drug resistance. These genes may also serve as novel targets for developing antifungals.Source:Jaitly P, Legrand M, Das A, Patel T, Chauvel M. et al, A phylogenetically-restricted essential cell cycle progression factor in the human pathogen Candida albicans. 2021; bioRxiv: 2021.2009.2023.461448.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P331
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P391 Research on molecular diagnostic methods and clinical application of
           common pathogenic dermatophytes in tinea capitis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: The main objective of this study was to design and develop a detection system based on qRT-PCR that can quickly and accurately identify the pathogenic fungi of tinea capitis, in order to improve the diagnostic ability of tinea capitis.MethodsA total of 8 isolates of Microsporum spp., 29 isolates of Trichophyton spp., 3 isolates of Nannizzia gypsea, 6 isolates of non-dermatophytic filamentous fungi, Malassezia spp., and Candida spp. were included in this study.Primer Express Software (V3.0) was used to design specific primers and TaqMan probe for qRT-PCR assay. The specificity of each system was validated using the above fungal isolates. The standard curve of each system was constructed by using the DNA of the standard substance of fungal isolates to find the minimum detection.The clinical specimens from confirmed and suspected patients with tinea capitis were collected. Fungal DNA was extracted from clinical samples and detected by a two-step qRT-PCR system. The results of qRT-PCR were analyzed comprehensively and compared with a fungal microscope and fungal culture.As a supplementary interpretation, the next generation sequencing targeted amplicon was conducted in 14 clinical samples that generated objectional results between fungal culture and qRT-PCR.Results:The molecular diagnostic system for tinea capitis herein consists of seven single-tube qRT-PCR assays designed on the complex and species level, which include the group of M. canis complex, T. rubrum complex, T. mentagrophytes complex, T. tonsurans, T. schoenleinii, T. verrucosum, and of N. gypsea. The analytical specificity of each group meets the design expectation.The minimum detection limit of the M. canis complex group, T. rubrum complex group, T. schoenleinii group, and N. gypsea group was 100 Colony Forming Units (CFUs), the counterpart of which for T. mentagrophytes complex group, T. tonsurans and T. verrucosum were 10 CFUs.A total of 351 clinical specimens were collected, including 231 cases confirmed of tinea capitis, 100 suspected of tinea capitis, and 20 with non-tinea capitis. Positive fungal microscopy and/or fungal culture were the gold criteria for diagnosis. Compared with the diagnostic gold standard, the sensitivity and efficacy of qRT-PCR, the combination of qRT-PCR and fungal microscopy, the combination of qRT-PCR and fungal culture were 93.1% and 93.6%, 100% and 100%, and 96.1% and 96.4%, respectively. The diagnostic specificity for cases of non-tinea capitis was 100%. The coincidence rate between qRT-PCR and fungal culture was 95.16%. The positive rate of qRT-PCR in suspected cases was 48%.Amplification sequencing results confirmed that dermatophytes existed in 13 of 14 samples. Consistent with qRT-PCR, there were two species of dermatophytes mixed infection in 4 samples.Conclusions: The seven single-tube qRT-PCR assays validated in this study can rapidly detect a variety of pathogenic fungi causing tinea capitis, with a high level of sensitivity and specificity. The combination of qRT-PCR and traditional mycological identification methods can further improve the diagnostic efficacy of tinea capitis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P391
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P392 Comparative evaluation of Wako β-glucan test and Fungitell assay for
           the diagnosis of invasive fungal infections

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesSerum 1,3 β-D-glucan (BDG) has shown wide utility as a broad fungal biomarker for invasive fungal disease (IFD). Fungitell assay (USA) is the only FDA-approved kit available for the detection of BDG. We planned to compare the performance of the Wako assay (Japan) with that of the Fungitell assay in patients with Invasive aspergillosis (IA) and invasive candidiasis (IC). We defined optimal cutoff values in the Wako assay to reliably exclude IFD (mainly due to Aspergillus and Candida).MethodsA retrospective performance assessment study on archived patients’ serum samples, collected as part of routine clinical care at PGIMER, Chandigarh, India was performed. Only adult patients qualifying as proven/probable IFD as defined by EORTC/MSG criteria were included. Serum samples from patients with risk factors for IFD and not meeting the criteria for proven/probable disease (who had no evidence of IFD) were included as controls. A positivity threshold of 80 pg/ml was used for Fungitell assay. For the Wako, the optimum positivity threshold or cut-off was determined on subsequent analysis. We also noted the time to positivity for BDG test in the Wako assay.Result: A total of 157 individuals, including 97 patients with IFD (33 IA and 64 IC) and 60 non-IFD controls were included in the study. Mean age of the participants was 40.8 ± 16.4 years and 63% were males. The mean BDG levels of Wako assay in various patient groups are depicted in Figure 1. A significantly higher BDG value was noted in patients with IFD vs. controls (70.79 vs. 3.03, P-value: .0002), IA vs. controls (112.3 vs. 3.034, P-value: < .0001), and IC vs. controls (49.4 vs. 3.034, P-value: .0009). A good performance with an AUC of 0.990 for Fungitell and 0.895 for Wako assay was seen. The Youden's index on using the Wako assay at BDG cutoff of 11 pg/mL, 5 pg/ml, and 4 pg/ml were 0.598, 0.677, and 0.664 respectively. Based on this the cut-off of 5 pg/ml was selected as the optimum cutoff for the Wako BDG assay with a sensitivity, specificity, positive likelihood ratio, negative likelihood ratio, positive predictive value and negative predictive value of 79.38%, 85%, 5.43, 0.22, 88.8%, and 73.9% respectively, for diagnosis of IFD. The percentage agreement between Wako and Fungitell assay was 84.7% with a Cohen's k score of 0.691. The mean time to positive test result (i.e., > 5 pg/ml) was 37 min and the negative result was 87 min using the Wako assay compared with 120 min for the Fungitell test. However, an additional 15 min pre-treatment step was required in the Wako assay.ConclusionWe observed that the performance of Wako assay is comparable to Fungitell assay. Results favored a lower cutoff value of 5 pg/ml compared with the kit specified cutoff of 11 pg/ml. Additionally, Wako assay gives positive results faster than Fungitell by allowing real-time observation. Further multi-centric studies on larger populations are required to establish the equivalence of these assays to guide clinicians in the diagnosis of IFDs.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P392
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P393 Clinical spectrum and molecular characterization of Rhytidhysteron
           spp. (now Gloniopsis) from India

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: Rhytidhysteron spp. are emerging dematiaceous fungi implicated in subcutaneous infections in immunocompromised as well as immunocompetent individuals. Diagnosis of Rhytidhysteron spp is delayed owing to non-sporulation and misidentification. The present study was conducted to characterize Rhytidhysteron spp. isolated from India by molecular techniques.Method: We retrieved a total of eight isolates of Rhytidhysteron spp from our National Culture Collection for Pathogenic Fungi (NCCPF) that were received from various centers across India. Colony morphology on Sabouraud's dextrose agar (SDA) and potato dextrose agar (PDA) was recorded. Molecular identification was performed by sequencing internal transcribed spacer (ITS) and 28 s region of rDNA. Phylogenetic tree was constructed using the Neighbor-Joining method along with sequences of standard strains retrieved from the NCBI database.ResultsRhytidhysteron spp was confirmed by sequencing from cutaneous specimens of eight cases. Six patients were immunocompetent while two were post-renal transplant recipients. Phenotypic features on SDA and PDA revealed growth of greyish-black mycelia on the obverse with black pigmentation on reverse after 7 days of incubation. On microscopic examination of lactophenol cotton blue mount, only dematiaceous septate hyphae without any spores were noted. On phylogenetic analysis of 28 s region, four of our isolates were closely clustered with Gloniopsis calami (Fig.1b), whereas two isolates with G. pneumonia and one each with G. percutanea, and Gloniopsis spp. (Fig.1b). On ITS phylogeny, the same four isolates closely clustered with G. calami (Fig.1a) as in 28 s region, one each isolate clustered with G. pneumonia, and G. percutanea while two isolates formed a separate clade with Rhytidhysteron rufulum (Fig.1a).ConclusionThis fungus is often difficult to identify due to lack of sporulation making morphological identification challenging. Therefore, molecular sequencing is a must for its identification. However, identification using the sequence of ITS and 28 s rDNA does not clearly correlate. Hence to confirm the identity additional genes needs to be sequenced and analyzed.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P393
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P394 Evaluation of diagnostic potential of recombinant secretory aspartyl
           proteinase 2 (Sap2) protein from Candida parapsilosis for use in systemic
           candidiasis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesSystemic candidiasis is the fourth most common bloodstream infection in ICU patients worldwide. Along with Candida albicans, infections caused by non-albicans Candida (NAC) species are increasingly becoming more prevalent globally along with the emergence of drug resistance. The diagnosis of systemic candidiasis is difficult due to the absence of significant clinical symptoms in patients. Since conventional diagnostics methods for candidiasis show less sensitivity and specificity, novel immunodiagnostic techniques are needed for early diagnosis. We investigated the diagnostic potential of recombinant secreted aspartyl proteinase 2 (rSap2) from C. parapsilosis for the detection of Candida infection.MethodsGenomic DNA was isolated from C. parapsilosis, followed by PCR amplification of Sap2 gene using designed gene-specific primers. Sap2 protein expression and purification was performed using Ni-NTA affinity chromatography under denaturing conditions. The denatured protein was subsequently refolded using a multi-step dialysis procedure. CD and FTIR studies were performed to confirm refolding. Mice were immunized with rSap2 protein and serum ELISA assays were performed for testing immunogenicity. Immunoblotting assays and human serum ELISAs were performed using whole-cell Candida and rSap2 protein in proven systemic candidiasis patient serum and controls, recruited at PGIMER, Chandigarh.ResultsSap2 protein from C. parapsilosis was successfully cloned and expressed using an E. coli-based prokaryotic expression system. Protein refolding was performed in vitro using step-wise dialysis. Structural analysis by CD and FTIR spectroscopy revealed the refolded protein to be in its near native conformation. Immunogenicity analysis demonstrated the rSap2 protein to be highly immunogenic as evident from significantly high titers of Sap2-specific antibodies in antigen immunized BALb/c mice, compared to sham-immunized controls. The diagnostic potential of rSap2 protein was evaluated using immunoblotting and ELISA assays using serum from proven systemic candidiasis patients and controls. Our immunoblotting results demonstrate that the recombinant Sap2 protein was recognized as a single band of approximately 41 kDa by systemic candidiasis patient serum samples and no cross reactivity was observed in healthy controls. On evaluating the diagnostic potential of the rSap2 antigen using an ELISA-based approach, our results show that anti-Sap2 Ig, IgG and IgM antibodies could be detected in the sera of proven candidiasis patients. Of note, the differences in Sap2 antibody titers observed amongst patients and controls were similar to the serological response observed when heat-killed whole-cell Candida was used as a coating antigen.ConclusionIn summary, the rSap2 protein from C. parapsilosis has the potential to be used in the diagnosis of systemic candidiasis, providing a rapid, convenient, accurate, and cost-effective strategy. Our results indicate that the rSap2 protein from C. parapsilosis can be used to detect and diagnose systemic candidiasis infection in human patients and can be used as an alternative/replacement of whole-cell Candida-based ELISA procedures, which are currently in use.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P394
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P395 Clinical utility of semi-nested conventional PCR for diagnosis of
           mucormycosis in fresh clinical samples

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesWe aim to assess the clinical utility of the semi-nested conventional PCR in smear positive, culture-negative clinical samples for diagnosis of mucormycosis.MethodsThis prospective study was conducted for a period of 3 months (April-June 2021). A total of 218 clinical samples were included from patients in whom smear was positive for aseptate hyphae, but the culture failed to grow within 2 days of incubation or smear was negative but had high suspicion of mucormycosis. Molecular diagnosis was attempted using semi-nested PCR with Mucorales-specific primers targeting 18S region, described previously by Bialek et al.1. Phenol-chloroform based manual DNA extraction protocol was optimized in the mycology laboratory of the department of medical microbiology, PGIMER, Chandigarh. This method was applicable to different types of clinical samples to yield good quality DNA with minimal chances of extraneous contamination (Fig. 1). Amplified PCR products were further sequenced to identify the causative species (Fig. 2).ResultsAmong 218 patients with suspected mucormycosis included in this study, the majority were rhino-orbito-cerebral mucormycosis (ROCM), (77.7%, n = 169), followed by pulmonary mucormycosis (19.2%, n = 42), cutaneous (0.02%, n = 4), and gastro-intestinal (GI) mucormycosis (0.01%, n = 3). In 24 samples, the presence of both septate and aseptate hyphae was seen under microscopic examination raising the possibility of mixed infection. On microscopic examination, 90.3% samples (197/218) had aseptate hyphae while the remaining samples were smear-negative but had strong clinical suspicion of mucormycosis. The molecular technique was able to identify causative agent in 154 culture-negative samples (81.9%, 154/188) and 52.4% (11/21) in smear-negative cases. Among 218 patients, only 20 samples show delayed growth of Mucorales, and on comparison with molecular results 100% concordance was observed. However, 10 patients with strong clinical suspicion for mucormycosis were negative by both conventional and molecular methods. The low culture positivity necessities the molecular diagnosis based on in-house semi-nested PCR using above-mentioned primers followed by Sanger sequencing. In the case of 24 mixed infections with aseptate-septate hyphae, Mucorales-specific PCR correctly identified 23/24 (95.8%) Mucorales as a causative agent. The overall turn-around-time from the sample receiving to diagnosis was ˂48 h. Overall, R. arrhizus (85/143, 59.4%) was most commonly associated with ROCM, while R. microsporus (13/38, 34.2%), and R. homothallicus (5/38, 13.1%) were seen mainly with pulmonary mucormycosis. Apophysomyces and Saksenaea genus were associated with GI and cutaneous mucormycosis.Conclusions: The molecular technique utilizing semi-nested PCR, followed by Sanger sequencing was able to identify Mucorales species 81.9% of culture-negative cases. Optimized manual DNA extraction protocol is suitable for different sample types, with minimum chances of extraneous contamination and offers low cost with a shorter turnaround time (TAT).
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P395
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P396 Utility of nasal swabs as samples for the diagnosis of Mucormycosis
           using molecular methods for detection

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesMucormycosis is an aggressive, life-threatening infection caused by fungi in the order Mucorales. There was an explosion of new cases of rhino-sino-orbital mucormycosis following the COVID pandemic in India, and the need for easy and rapid diagnostics was felt. The current diagnosis of mucormycosis relies on mycological cultures, radiology, and histopathology. These methods lack sensitivity and are most definitive later in the course of infection, resulting in the failure of timely intervention.A real-time multiplex PCR platform is commercially available for the detection of Rhizopus spp., Mucor spp. Rhizomucor spp., Lichtheimia spp., and Cunninghamella spp. (PN-700, MucorGenius®, PathoNostics®, Maastricht, The Netherlands) This real-time PCR has been validated to identify these fungal pathogens from bronchoalveolar lavage, tissue, and serum samples. This study aimed to validate this PCR-based system to detect Mucorales from nasal swab samples and evaluate its utility in the detection of Mucorales from nasal cavities of high-risk patients developing signs and symptoms of mucormycosis.MethodsA single-center cross-sectional observational study was conducted on 50 hospitalized adult patients with signs and symptoms of mucormycosis. Nasal swabs were taken for PCR analysis once there was a clinical suspicion and were compared with the results of the gold standard. The gold standard for the diagnosis of mucormycosis was the conventional method (KOH mounted microscopy/HPE). Demographic details and risk factors for these patients were recorded, and the RTPCR-based test was run on the nasal swab samples of all these 50 patients. The workflow is depicted graphically in Fig. 1 (Created with BioRender.com).ResultsThe study population mean (SD) age was 50 (16) years and consisted of 32 (64%) males. A total of 39 (78%) patients were known cases of diabetes mellitus, 48 (96%) patients had amphotericin B intake, and 20 (40%) had posaconazole intake. In all, 21 (42%) patients had a past history of COVID-19 infection; 14 patients had received steroids and 10 patients received oxygen support. PCR for Mucorales was positive in 15 (30%) patients while the KOH mount was positive in 4 (8%) patients.ConclusionThese results are not encouraging for the use of nasal swabs as the sample for diagnosis of mucormycosis. Though the PCR performed better on the swab samples than KOH preparation and culture techniques, it highlights the importance of using standard sampling methods.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P396
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P397 Influence of underlying conditions on disease presentation and
           diagnostic strategy during pulmonary mucormycosis: Anational study of 114
           cases

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesPulmonary mucormycosis (PM) is a life-threatening invasive fungal infection mostly affecting immunocompromised patients. We aimed to study the influence of underlying conditions on disease presentation and diagnostic strategy during PM.MethodsAll PM cases from six French teaching hospitals between 2008 and 2019 were retrospectively reviewed. Cases were defined according to EORTC/MSG 2019 criteria with the addition of diabetes and traumatism as host factors and positive serum or tissue PCR as mycological evidence. Thoracic CT scans were reviewed centrally.ResultsAmong 114 cases of PM, 52 (46%) were proven and 62 (54%) were probable, including 12 cases with a positive serum qPCR as the sole mycological criterion. Hematological malignancy was the most common risk factor (49%), followed by allogeneic hematopoietic stem-cell transplantation (21%), and solid organ transplantation (SOT, 17%). Fever was the first symptom for 66% patients and was more frequent in patients with neutropenia than in those without (97% vs 52%, P <.01). A total of 46 (40%) patients had a disseminated infection, which was more frequently reported in neutropenic patients (50% vs 25%, P <.01). Main dissemination sites were the liver (48%), spleen (48%), brain (44%), and kidneys (37%). Sinusitis was present in 13% of cases.Chest radiological presentation included consolidation (58%), pleural effusion (52%), reversed halo sign (26%), halo sign (24%), vascular abnormalities (26%), and excavation (23%). The excavation was more frequently reported in SOT patients (64%, P <.01) compared with other groups. Vascular involvement was associated with reversed halo sign and Rhizomucor infection. Neutropenic patients presented more frequently than non-neutropenic patients with ground-glass opacities (75 vs 49%, P = .01), halo sign (32% vs 10%, P = .02), and reversed halo sign (35 vs 10%, P <.01).A total of 83 (73%) patients had a positive fungal culture from any type of respiratory sample. Serum qPCR was positive for 42/53 patients (79%) and respiratory fluid qPCR for 16/21 (76%) patients. In neutropenic patients, BAL culture was less often positive (30% vs 66%, P <.01), and serum qPCR was more frequently positive (91% vs 62%, P = .02). A transthoracic lung biopsy was contributive in 8/11 (73%) patients with negative bronchoalveolar lavage (BAL). Serum qPCR was more frequently positive in patients with the main lesion of >3 cm in diameter (91% vs 62%, P = .02). Rhizomucor spp. Was identified in 31 patients (32%), Rhizopus spp. In 29 patients (30%), Lichtheimia spp. In 24 patients (25%), Mucor spp. In 10 patients (10%) and Cunninghamella spp. In 4 patients (4%). Neutropenic patients were more frequently infected with Rhizomucor (43% vs 13%, P <.01) and less frequently with Rhizopus (17% vs 50%, P <.01). Histopathological specimens were available for 48 patients (42%) and revealed Mucorales hyphae in 85% of cases. Patients with a disseminated infection and neutropenia presented more often with angioinvasion than patients with localized disease (50% vs 9%, P <.01 and 38% vs 13%, P = .10). Overall, 90-day mortality was 59%.ConclusionUnderlying conditions significantly influenced clinical and radiological presentation and diagnostic tools’ contribution. Neutropenic patients present more frequently with dissemination, fever, reversed halo sign, pathological angioinvasion, the negativity of BAL culture, the positivity of serum qPCR, and Rhizomucor infection.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P397
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P398 COVID-19-associated pulmonary aspergillosis: Species distribution and
           susceptibility profiles

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesThis study aimed to investigate the species distribution and susceptibility profiles of Aspergillus species isolated from patients admitted to the intensive care unit with severe COVID-19 in Isfahan, Iran, between April 2021 and March 2022.MethodsThis retrospective study included intubated patients with COVID-19 in three referral COVID-19 hospitals. Tracheal aspirate (TA) samples were taken from 267 patients to investigate pulmonary co-infections. COVID-19-associated aspergillosis (CAPA) was defined according to the 2020 European Confederation of Medical Mycology/International Society of Human and Animal Mycosis consensus criteria. Aspergillus species obtained from samples were characterized based on conventional and molecular assays. In vitro antifungal susceptibility testing was performed on the obtained isolates according to the guidelines from the Clinical and Laboratory Standards Institute.ResultsThe mean age of the patients was 61.73 ± 12.69 years. The mean length of hospitalization and admission in ICU were 18.77 ± 12.94 and 13.51 ± 9.83 days, respectively. A total of 61 (22.9%) patients presented with a single cavity lesion. Pulmonary artery pseudoaneurysm was seen in seven patients and post-COVID-19 changes were seen in all patients. Based on the conventional and molecular techniques, 72 isolates of Aspergillus species (26.9%), including A. flavus (10.1%%), A. fumigatus (8.6%%), A. niger (3.3%), A. tubingensis (2.9%), A. terreus (1.1%), A. luchuensis (0.37%) A. quadrillineatus, and (0.37%), were obtained from 267 patients. MIC results showed that all Aspergillus species were susceptible to all tested antifungal drugs.ConclusionAccess to priority clinical groups, improving the care of patients with simultaneous pulmonary aspergillosis with COVID-19, and identifying Aspergillus species are essential steps in the care cascade to manage those affected by them.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P398
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P482 Burden of serious fungal infections in India

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMFungal disease is frequent in India but its incidence and prevalence are unclear. Literature searches yielded over 2900 papers; 434 papers with incidence/prevalence/proportion data were analyzed. Deterministic modeling allowed annual incident and prevalence estimates for multiple life and sight-threatening infections with significant morbidity. An estimated 55 916 148 of 1 393 400 000 people in India (4.01/100 000) suffer from a serious fungal disease. The prevalence (in millions) of recurrent vulvovaginal candidiasis is 24.3, allergic bronchopulmonary aspergillosis (ABPA) is 2.0, tinea capitis in school-age children is 25, severe asthma with fungal sensitization of 1.36, chronic pulmonary aspergillosis of 1.75 and chronic fungal rhinosinusitis of 1.52. The annual incidence of Pneumocystis pneumonia (58 400), invasive aspergillosis (250 900), mucormycosis (195 000), esophageal candidiasis in HIV (266 600), candidemia (18 800), fungal keratitis (1 017 100) and cryptococcal meningitis (11 300) were also determined. Histoplasmosis, talaromycosis, mycetoma, and chromoblastomycosis are less frequent. India's fungal burden is high and under-appreciated in clinical practice.See Figures below.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P482
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P483 Invasive fungal infection in hematopoietic stem cell transplant
           recipient from an Indian oncology setting

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesInvasive fungal infections (IFI) are one of the major causes of morbidity and mortality in post-hematopoietic stem cell transplant (HSCT) recipients. Data from India are limited. The objective was to analyze the incidence, risk factors, and outcomes associated with IFI in our center.MethodsAdult patients, who underwent marrow/stem cell transplantation between 2014-2018, in an oncology center in India, were included in this retrospective observational study. The revised consensus definition of IFI by the European Organization for Research and Treatment of Cancer/Invasive Fungal Infections Cooperative Group and the National Institute of Allergy and Infectious Diseases Mycoses Study Group (EORTC/MSG) in 2008, was considered to define cases. Incidence, risk factors, and outcomes associated with IFI were analyzed.ResultsOut of the 126 patients who underwent HSCT between 2014-2018, 56 (44.4%) had Allo HSCT, 64 (50.8%) had auto HSCT and 6 (4.8%) had haplo-identical HSCT. A total of 83 (63%) were males and 43 (34%) females, 113 (83.9%) Asians, and 13 (10.3%) Africans. Total 111 (88%) patients received myeloablative conditioning and 24 (19%) received total body irradiation. The hematological conditions were acute myeloid leukemia (AML) n = 23 (18.25%), acute lymphoblastic leukemia (ALL) n = 16 (12.69%), chronic myeloid leukemia (CML) n = 4 (3.17%), Hodgkins lymphoma (HL) n = 17 (13.4%), non-Hodgkins lymphoma (NHL) n = 11 (8.73%), Myeloma n = 35 (27.7%), sickle cell disease n = 13 (10.31%), etc. Most patients received fluconazole 78 (61.9%) followed by micafungin 23 (18.25%), posaconazole 20 (15.87%), voriconazole 4 (3.17%), and liposomal amphoterin B 1 (0.79%) as antifungal prophylaxis. The overall rate of IFI (possible cases included) was auto-HSCT n = 5 (7.81%), and Allo-HSCT n = 5 (8.92%). Among auto-HSCT, the IFI was Proven = 0, Probable n = 1 (1.5%), and Possible n = 4 (6.25%), and among Allo-HSCT Proven = 0, Probable n = 2 (3.57%), and Possible n = 3 (5.35%). These cases had IFI lung based on imaging and serological tests. None of the cases had a lung biopsy. There were no incidents of candidemia. No patients in Haplo-HSCT had IFI. The 1-year survival rate among the IFI cases was 8/10 (80%). As the number of patients with IFI was very low, a meaningful comparison of the risk factors, and the impact of prophylactic regimens were difficult.Conclusions: The overall rate of IFI in HSCT patients in our setting was low compared to global data.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P483
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P484 Expanding VGVI—evidence for distinct Cryptococcus gattii
           (decagattii) endemic to the American Southwest

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesWe aimed to understand the nature of autochthonous Cryptococcus gattii clinical and veterinary cases identified in Arizona, a state in the American Southwest, a locale well outside of the known endemic regions.MethodsWhole-genome sequencing and phylogenomic comparative analyses were conducted on four unrelated isolates collected from recent cases along with other relevant C. gattii genomes.ResultsPhylogenomic analysis grouped the Arizona genomes with a previously known set of Mexican isolate genomes, labelled as VGVI or C. decagattii. These genomes are clearly delineated from the nearest major molecular type (VGIII), but show no recombination with other molecular types or species of C. gattii.See Figures below.ConclusionThese findings expand VGVI into a definitive clade and establish this molecular type as a clinically important and distinct population. These findings also expand the known Cryptococcus ecological range into a previously unrecognized endemic area, typified by extreme heat and aridity.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P484
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P485 Hiv-positive, solid organ transplant (SOT), and
           non-Hiv-positive/non-transplant (NHNT) associated with cryptococcosis in
           Brazil: First national multicenter cohort study

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectives. To describe the characteristics, mortality, and therapeutic response among hospitalized patients with cryptococcosis in Brazil.Methods. This is a multicenter retrospective cohort study of seven Brazilian public tertiary hospitals (Figure 1). Medical records of patients admitted from January 2014 to December 2019 were evaluated. Confirmed cases of the first episode of cryptococcosis were included. Hosts were classified as HIV-positive, solid organ transplant (SOT), and non-HIV-positive/non-transplant (NHNT). Mortality was defined as the time of patient admission to in-hospital death from any cause. Statistical analysis was performed using the software R and JAMOVI.Results. A total of 384 patients were included; the median (25th-75th) age was 39 (31-48) years and 283 (73.7%) were men. Hosts were 304 (79.2%) HIV-positive, 16 (4.2%) SOT, and 64 (16.7%) NHNT. More frequent diagnosis tools were culture, direct microscopic examination of infected body fluids using India ink, histological examination of tissue samples, and detection of cryptococcal polysaccharide antigen in body fluids (CrAg) using latex. Central nervous system (CNS) cryptococcosis had a significantly higher counting level across disease categories, with 313 cases or 81.5%. NHNT were more likely to have CNS cryptococcosis than people HIV-positive (84.4% vs. 81.9%, respectively). SOT patients had more pulmonary form infections (31.2%) as compared with HIV-positive (3.3%) and NHNT (1.6%). Other extrapulmonary sites category had HIV-positive and NHNT basically the same percentage of disease involvement (14%) compared with SOT (6.2%) (P < .001, Figure 2). Among cases with identification of specie, 56% were Cryptococcus neoformans and 4.4% were C. gattii. A total of 271 (70.6%) patients were discharged home with total or partial improvement and 113 (29.4%) patients died during hospitalization. In-hospital mortality among HIV-positive, SOT, and NHNT patients was 30.3% (92/304), 12.5% (2/16), and 29.7% (19/64), respectively. Induction therapy with AMB had the conventional deoxycholate mainly in combination with fluconazole (234, 84.2%). Only 80 (22.3%) patients received an AMB lipid formulation (liposomal AMB, n = 35 and AMB lipid complex, n = 45). The median (25th-75th) length of AMB therapy was 20 (14–32) days. Death patients had more age when compared with discharged-to-home cases (43 vs. 38 years, P < .002). Patients with CNS cryptococcosis had lower mortality (83/313, 26.5%) when compared with the other categories [pulmonary, 5/16 (31.2%) and other extrapulmonary sites, 25/55 (45.4%)] (P = .017). Survival benefits were seen for patients who received monotherapy or combination therapy. However, D-AMB alone showed a higher mortality rate, although not statistically significant (P = .537).Conclusion. HIV infection is the most important condition among patients with cryptococcosis in Brazil and CNS involvement is the commonest manifestation in all hosts, mainly HIV-positive and NHNT. The proportion of pulmonary cryptococcosis is relevant in SOT patients. Mortality was high in all categories of hosts. Understanding the epidemiology and characteristic of patients admitted to our hospitals will help to understand the burden and causes of mortality and identify strategies to improve this scenario. Optimized diagnosis (i.e., lateral flow assay) and treatment (i.e., AMB lipid formulation plus flucytosine) are urgently necessary for our setting.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P485
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S7.3d Environmental surveillance of Aspergillus fumigatus in Dutch
           agricultural crops

    • Abstract: Abstract S7.3 Emergent theories on pathogenic fungal dispersal around the globe, September 23, 2022, 10:30 AM - 12:00 PMObjectivesAzole-resistant Aspergillus fumigatus isolates from the environment hamper the treatment of patients suffering from Aspergillus diseases due to cross-resistance with agricultural azoles. Previous work has suggested A. fumigatus likely gains resistance through environmental azole exposure in so-called hotspots.MethodsWe investigated A. fumigatus resistance at multi-environmental sites including the compost, strawberry, and potatoes, where farmers used azole fungicides for crop protection.ResultsOn average 105 A. fumigatus CFU/g was recovered of which roughly half were itraconazole and tebuconazole resistant. Similar tandem repeat-mediated resistance mechanisms were found in colonies cultured from these environmental sites as reported in clinical azole-resistant isolates.Conclusions: Our results suggest that not only azole-containing plant-waste material but also other agricultural crops can be hotspots for resistance selection in A. fumigatus and underscores the need to further investigate transmission routes.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S7.3d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S7.4a Vaccine-inducing lung resident CD4 + memory T cells are protective
           against Cryptococcus gattii infections

    • Abstract: Abstract S7.4 Pathogenesis and host defense, September 23, 2022, 10:30 AM - 12:00 PMCryptococccus gattii is a highly virulent fungal pathogen that can cause cryptococcosis in previously healthy individuals. It is not fully understood how innate and acquired immune responses cooperatively suppress C. gattii infection. Hitherto, we have reported the following findings, (1) Specific environment for exposure of dectin-1 and dectin-2 ligands in cryptococcal cells (PLOS ONE 2019, PMID 31398236), (2) CD11b-mediated immune recognition for C. gattii and capsule dependent immune evasion from CD11b recognition (Eur J Immunol 2021, PMID 33728652), (3) Dendritic cells (DCs)-based vaccine induced lung resident memory Th17 cells and ameliorates C. gattii infection (Mucosal Immunol 2018, PMID 30279512), and (4) Neutrophil and opsonization can mediate fungicidal activity for cryptococcal cells (Med Mycol 2019, PMID 30668754). Based on these findings, we have inferred that induction of lung resident memory T cells (lung TRM) and TRM-driven myeloid cells including granulocytes is necessary for controlling this infection. Currently, we are developing new intranasal (IN) vaccines using highly immunogenic whole cell antigens and characterizing protective lung TRM induced by the vaccines. Just as with component vaccines, whole cell vaccines are also featured for cryptococcal infection because these are highly cross-reactive and protective against each serotype (Biol Pharm Bull 2020, PMID 32009111).We developed two IN vaccines using whole cell antigen and adjuvant. Both vaccines induced IL-5-producing lung TRM and significantly reduced fungal burden in lungs and improved survival rates of mice following C. gattii infection, while not protective against C. neoformans infection. Although immune suppressive agent FTY720 can eliminate most circulating T cells and sustain tissue-resident subset, IN vaccines induced Th2-related immune response including eosinophils and IFN-γ independent granuloma, and reduced the fungal burden in lungs after the infection in the presence of FTY720. Vaccine-mediated protection was completely lost in the Rag-1 knockout mice deficient in T- and B-cells, while the fungal burden was reduced in the Rag-1 knockout mice after receiving the immunized CD4 + T cells in the adoptive transfer experiments. These results suggest that Th2-related lung TRM induced by IN vaccines are also protective against C. gattii infection as well as Th17-related counterparts induced by DC vaccine.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S7.4a
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S7.4b Microaerobic conditions enhance fungal pathogenesis in Candida spp.

    • Abstract: Abstract S7.4 Pathogenesis and host defense, September 23, 2022, 10:30 AM - 12:00 PMBackgrounds. Fungal pathogen colonizing mucocutaneous membranes and indwelling medical devices is associated with invasive infections. Its pathogenetic mechanisms are poorly understood, although environmental oxygen levels have been recently suggested to alter pathogenic phenotypes in the human body. Our study aimed to compare the adhesion capabilities of Candida spp. depending on various oxygen levels and investigated the mechanisms contributed to pathogenic alteration.Results and Conclusion: We observed significant differences in capabilities for cell adhesion and for biofilm formation of pathogenic yeasts in response to different oxygen levels. Under hypoxic conditions, the C. glabrata adhesion capability increased and the expression levels of several adhesion-related genes were up-regulated. Among these mutants, observed significantly lower adhesion capability for intestinal colonization than the wild-type in a murine model. Pathogenic yeasts showed different phenotypes in hypoxic conditions from ordinary aerobic circumstances, and those molecules which work on increased pathogenesis would be applied for novel therapeutic targets.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S7.4b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S7.4d Candida albicans SR-like protein kinases regulate different cellular
           processes: Sky1 is involved in thecontrol of ion homeostasis, while Sky2
           is important for dipeptide utilization

    • Abstract: Abstract S7.4 Pathogenesis and host defense, September 23, 2022, 10:30 AM - 12:00 PMProtein kinases play a crucial role in regulating cellular processes such as growth, proliferation, environmental adaptation, and stress responses. Candida albicans genome comprises of 108 predicted protein kinases, of which the exact role of nearly half of those kinases remains unknown. One family of protein kinases is serine-arginine (SR) protein kinases, which are highly conserved in eukaryotes and regulate fundamental processes such as constitutive and alternative splicing, mRNA processing, and ion homeostasis. The C. albicans genome encodes two (Sky1, Sky2) and the C. glabrata genome has one homolog (Sky1) of the human SR protein kinase 1, but their functions have not yet been investigated. We used deletion strains of the corresponding genes in both fungi to study their cellular functions. C. glabrata and C. albicans strains lacking SKY1 exhibited higher resistance to osmotic stress and toxic polyamine concentrations, similar to their ortholog Sky1 in Saccharomyces cerevisiae. Deletion of SKY2 in C. albicans resulted in impaired utilization of various dipeptides as the sole nitrogen source which was shown by utilizing a high-throughput phenotypic screen. Subsequent phosphoproteomic analysis identified the di- and tri-peptide transporter Ptr22 as a potential Sky2 substrate. Our data suggest that Sky2 seems to be involved in Ptr22 regulation since overexpression of PTR22 in the sky2∆ mutant restored the ability to grow on dipeptides and made the cells more susceptible to the dipeptide antifungals Polyoxin D and Nikkomycin Z. Altogether, our results demonstrate that C. albicans and C. glabrata Sky1 protein kinases are functionally similar to Sky1 in S. cerevisiae, whereas C. albicans Sky2, a unique kinase of the CTG clade, likely regulates dipeptide uptake via Ptr22.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S7.4d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.1b Is a search and destroy strategy still feasible for Candida auris in
           South Africa'

    • Abstract: Abstract S8.1 Tackling Candida auris in resource-limited settings, September 23, 2022, 3:00 PM - 4:30 PMCandida auris was prospectively detected as a healthcare-associated pathogen in South Africa in 2014. However, a retrospective review of a culture collection from national laboratory-based surveillance for Candidaemia in 2009-10 showed that earlier cases had been missed owing to species misidentification. National surveillance, which was repeated during 2016-17, revealed that C. auris caused >10% of cases of Candidaemia in South Africa, with most (86%) cases detected in the Gauteng Province. We recommended all hospitals to passively monitor cases of C. auris disease and colonization by each maintaining a line list of culture-confirmed cases. Facilities were thus classified into three tiers. Tier 1 (‘green status’) included facilities with no prior known cases. Such facilities were requested to report their first cases for urgent intervention. This included active colonization surveys, isolation and/or cohorts of infected or colonized patients as well as intensified infection prevention and control and antifungal stewardship activities. Tier 2 (‘orange status’) included facilities with sporadic cases defined arbitrarily as fewer than 12 cases in the past 6 months and/or fewer than three units affected. Such facilities were requested to report any increase in the number of cases compared with a baseline, clinical units affected for the first time, or apparent case clustering within the facility for investigation. Tier 3 (‘red status’) included facilities with a relative endemicity defined as >12 cases and/or >3 units with cases in the last 6 months. Tier 3 facilities were only requested to report increases over a baseline or apparent clustering within the facility. Owing to limited resources, colonization screening of newly-admitted patients was not recommended in acute-care facilities in South Africa. During 2019-21, the proportion attributable to C. auris increased even further to 25% (of 12 959 national cases of Candidaemia), with a concomitant reduction in cases caused by C. parapsilosis. This suggested a concerning replacement of multidrug-resistant C. auris in an ecological healthcare niche previously occupied by azole-resistant C. parapsilosis. An epidemiological shift was also observed with an expanding number of acute healthcare facilities outside Gauteng Province reporting C. auris and large persistent healthcare-associated infection outbreaks in neonatal units, particularly in the under-resourced public health sector.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.1b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.2a Trends in epidemiology of pediatric Candida infections

    • Abstract: Abstract S8.2 What is new in pediatric mycology', September 23, 2022, 3:00 PM - 4:30 PMInvasive Candida infections are a cause of increased morbidity and excessive mortality in immunocompromised and critically ill patients including premature neonates. In the pediatric setting, they are more frequent in the neonatal intensive care unit (ICU), in the pediatric ICU, and in the pediatric oncology/hematology departments. Its frequency in other pediatric departments, such as gastroenterology, surgery, and nephrology is less of a problem. Candida albicans remains the most frequent Candida species, whereas other non-albicans Candida spp. are less frequent. Candida parapsilosis is second in frequency, but in certain pediatric settings and countries, it may be first. While C. albicans is almost entirely susceptible to azoles, C. parapsilosis has started to manifest increasing resistance to fluconazole and this is of concern. However, due to improved infection control and prevention measures and to use of fluconazole prophylaxis in a number of neonatal ICUs, its incidence has been shown to decrease in a multi-state study conducted by the Centers of Disease Control and Prevention in the United States. Another large multinational study that was conducted in many European countries showed no changes in epidemiology over a number of years, and more non-albicans Candida, particularly C. parapsilosis, in South Europe. The epidemiology of Candida in pediatric ICU has been less studied. Similar epidemiology and risk factors exist in PICU as in neonates. Abdominal surgery and multi-site colonization with Candida of patients are risk factors for developing invasive Candida infections, mainly candidemia. In the patients with hematological malignancies, antifungal prophylaxis for mold infections is also active against Candida, therefore, the incidence of invasive candidiasis is relatively low. However, non-Candida albicans species with reduced susceptibility to azoles, such as C. glabrata, are found more frequently. In pediatric patients with solid organ transplantation, invasive candidiasis is the most frequent fungal infection, mainly in those with liver transplantation. Candida causes infection in the first weeks after transplantation earlier than other fungal infections.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.2a
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.3b How fungal cell wall glycans modulate the activation of platelets
           '

    • Abstract: Abstract S8.3 How the fungal cell wall glycan can modulate the immune response', September 23, 2022, 3:00 PM - 4:30 PMPlatelets are the first circulating blood cells that interact and adhere to vascular lesions. They play an important role in vascular repair and maintenance of blood homeostasis. Platelets are involved in the immune defense of the host against many infections caused by bacteria, viruses, and fungi. Following infection, these microorganisms can alter platelet function leading to platelet activation. During fungal infection, β-glucans, mannan, and chitin, are critical components of Candida albicans, an opportunistic pathogenic yeast of humans. These fungal glycans play an important role in the modulation of the host response. They are released into the bloodstream and can be detected up to 10 days before the onset of clinical signs of invasive candidiasis. However, their role in the modulation of platelet activities is unknown. In our studies, we observed that β -glucans and chitin decrease platelet activation and modulate the production of inflammatory mediators, mediated by TLR4 or TLR8 respectively. These glycans also reduce platelet adherence to C. albicans and to polynuclear neutrophils, suggesting a process by which C. albicans can escape from cells of innate immunity by releasing cell wall polysaccharides into the close environment or the blood circulation. This study provides evidence that fungal glycans play a role in the modulation of the immune response and how C. albicans can escape from the innate immune response.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.3b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.3c Cell wall glycans as targets for the development of new antifungals

    • Abstract: Abstract S8.3 How the fungal cell wall glycan can modulate the immune response', September 23, 2022, 3:00 PM - 4:30 PMBeing an extracellular organelle, the cell wall plays a crucial role in fungal life, by protecting fungal cells from a hostile environments and providing cells with mechanical strength. Exploiting the essentiality of this cell wall, available antifungal drugs target cell wall biosynthesis directly or by altering the fungal cell membrane. However, the emergence of resistance to antifungal drugs, new at risk-cohorts, and drug-drug interaction issue with antifungals demand new/alternative therapeutic strategy. In this regard, we have identified that surfactant protein-D (SP-D; a host humoral immune component) has growth inhibitory activity on Aspergillus fumigatus, a ubiquitous airborne opportunistic pathogen. SP-D, a soluble pattern recognition receptor of the collection family, targets galactosaminogalactan and galactomannan, the cell wall glycans of A. fumigatus hyphae, as the ligands. Hyphae grown in presence of SP-D show a significant decrease in the growth and are hyperbranched compared to control hyphae. SP-D treatment alters surface exposure of hyphal cell wall polysaccharides, thereby modifying hyphal immunoreactivity. SP-D pre-treatment increases the efficacy of the echinocandin and azole classes of antifungals against A. fumigatus. Interestingly, SP-D show hyphal growth inhibitory activity against multi-/pan-azole-resistant isolates of A. fumigatus. Overall, SP-D seems to target A. fumigatus cell wall glycans to execute its fungistatic activity. We are currently investigating the exact mechanism of anti-A. fumigatus activity associated with SP-D.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.3c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.3d Characterization of glycosylphosphatidylinositol-linked aspartyl
           proteases in Candida glabrata: Role in pathogenicity

    • Abstract: Abstract S8.3 How the Fungal Cell Wall Glycan Can Modulate the Immune Response', September 23, 2022, 3:00 PM - 4:30 PMCandida glabrata is the second to fourth most common yeast pathogen found in Candida bloodstream infections, depending upon the geographical location. C. glabrata, which belongs to the Nakaseomyces clade, possesses a distinct set of virulence attributes which include the ability to survive and proliferate in macrophages, adhere to biotic and abiotic surfaces and survive a wide range of stresses. Our research is focused on unveiling the strategies that C. glabrata employs to survive the nutrient-poor hostile host environment and evade host immune response. Toward this end, we are delineating the cellular processes, that are regulated by the family of 11 putative glycosylphosphatidylinositol-linked, cell surface-associated aspartyl proteases (CgYapsins, CgYps1-11). We have recently characterized the secretome of C. glabrata wild-type and aspartyl protease-deficient mutant strains, and showed that the GPI-anchored aspartyl proteases are both bonafide constituents and key modulators of the C. glabrata secretome. Further, besides elucidating the role of CgYapsins in the suppression of the host pro-inflammatory immune response, we have identified the flavodoxin-like protein CgPst2 as a substrate of the CgYps1 protease and demonstrated that the CgYps1-mediated cleavage of CgPst2 is pivotal to oligomerization and activity, and functions of CgPst2 in quinone detoxification. These findings underscoring the importance of multifunctional CgYapsins in the physiology and pathogenesis of C. glabrata will be presented.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.3d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.4b Population biology of hedgehog fungus Trichophyton e r inacei

    • Abstract: AbstractS8.4 Cases of animal mycoses, September 23, 2022, 3:00 PM - 4:30 PMTrichophyton erinacei is a main cause of dermatophytosis in hedgehogs and is increasingly reported from human infections worldwide. It is found in wild European hedgehogs (Erinaceus europaeus) but also in the African four-toed hedgehog (Atelerix albiventris), a popular pet animal worldwide. Little is known about the taxonomy and population genetics of this pathogen despite its increasing importance in clinical practice. Notably, whether there are different populations or even cryptic species associated with different hosts or geographic regions is not known. To answer these questions, we collected 161 isolates, performed phylogenetic and population-genetic analyses, determined mating type, and characterized morphology and physiology. Multigene phylogeny and microsatellite analysis supported T. erinacei as a monophyletic species, in contrast to highly incongruent single-gene phylogenies. Two main subpopulations, one specific mainly to Atelerix and the second to Erinaceus hosts, were identified inside T. erinacei, and slight differences in the size of microconidia and antifungal susceptibilities were observed among them. Although the process of speciation into two lineages is ongoing in T. erinacei, there is still gene flow between these populations. Thus, we present T. erinacei as a single species, with notable intraspecies variability in genotype and phenotype. The data from wild hedgehogs indicated that sexual reproduction in T. erinacei and de novo infection of hedgehogs from soil are probably rare events and that clonal horizontal spread strongly dominates. The molecular typing approach used in this study represents a suitable tool for further epidemiological surveillance of this emerging pathogen in both animals and humans. The results of this study also highlighted the need to use a multigene phylogeny ideally in combination with other independent molecular markers to understand the species boundaries of dermatophytes.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.4b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.5c MLST genotyping and phylogenetics of AD-hybrids

    • Abstract: Abstract S8.5 Genotyping of Cryptococcus neoformans and C. gattii, September 23, 2022, 3:00 PM - 4:30 PMObjectivesIn a previous study a set of new molecular-type specific primers were designed to apply the standard ISHAM consensus multi-locus sequence typing (MLST) scheme to Cryptococcus neoformans AD hybrids. In the present study, we report the preliminary results of the investigation by MLST of a large number of AD hybrids with the aim to identify the circulating genotypes, their phylogenesis, and population genetics.MethodsA total of 50 AD-hybrid isolates from different parts of the world and from different sources were genotyped by MLST. Minimum spanning trees using GoeBurst algorithm were generated by comparing hybrid genotypes and by comparing separately either allele-A and allele-D portions of the hybrid genotypes to the haplotypes recorded in the MLST global database.ResultsAnalysis identified 32 hybrid genotypes grouped in three distinct main clusters (CC12, CC21, and CC30) including 12 isolates each. Both CC12 and CC21 clusters included isolates from different countries and continents but the former grouped only isolates with mating type aADalpha whereas the latter those with mating type alphaADa. Cluster CC30 included only isolates from Ivory Coasts. Heterozygous allelic combinations in each of the seven MLST loci presented two or three combinations more frequent than the other ones. In some isolates, one or more alleles were not amplified after multiple attempts, and therefore, they were considered as lacking. A total of 22 MLST profiles were identified by analyzing separately the allele-A combinations of the hybrids. Comparison with all MLST profiles of VNI, VNII, and VNB included in the MLST global database showed that the allele-A portion of the hybrid genotypes was grouped in few VNI or VNB clusters. In none of the investigated hybrids, the allele-A portion originated from VNII genotypes. Similarly, when the MLST profile of allele-D portion of hybrids was compared to all VNIV genotypes present in the global MLST database, few clusters were identified but, in this case, mostly originated from genotypes not yet found among VNIV haplotypes.Conclusions: These preliminary results suggest that the AD hybrids here investigated originated from the mating of A haploids very common in both clinical and environmental isolates and D haploids that are not circulating at present or are very rare. Therefore, it is likely that hybrids originated in the environment where VNIV genotypic diversity is higher and suitable AD combinations can occur. Sequencing of further AD hybrids is in progress to confirm these results.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.5c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S8.5d Cryptococcus neoformans and Cryptococcus gattii clinical isolates
           from Colombia develop heteroresistance to fluconazole at high
           concentrations

    • Abstract: Abstract S8.5 Genotyping of Cryptococcus neoformans and C. gattii, September 23, 2022, 3:00 PM - 4:30 PMIntroduction: Cryptococcosis is a worldwide mycosis caused by Cryptococcus neoformans and Cryptococcus gattii. Although resistance to antifungals is infrequent, isolates with decreased susceptibility to fluconazole have been reported globally, including Colombia, which may be due to 1) heteroresistance, defined as the ability to adapt to increasing concentrations of this azolic antifungal, and 2) point mutations in the EGR11 gene encoding the fluconazole target enzyme, lanosterol 14-α-demethylase.Objective: To determine the development of heteroresistance to fluconazole in C. neoformans and C. gattii clinical isolates from Colombia and to amplify and sequence the ERG11 gene of the isolates to seek for mutations that might characterize resistant or heteroresistant phenotypes.MethodsThe minimum inhibitory concentration (MIC) to fluconazole was determined in 31 and 24 isolates of C. neoformans and C. gattii, respectively, using broth microdilution. Heteroresistance was evaluated by plating each isolate on YPD agar that contained fluconazole at concentrations equal to the MIC of each isolate. Heteroresistant colonies were then replated at increasing concentrations of fluconazole, as high as 128 μg/ml.ResultsAll isolates were susceptible to fluconazole with MICs of 1 μg/ml (n = 3), 2 μg/ml (n = 6), 4 μg/ml (n = 17), 8 μg/ml (n = 23), 16 μg/ml (n = 5), and 32 μg/ml (n = 1). However, all isolates developed heteroresistant colonies, with increments in the MIC from 2 to 6 dilutions. Notably, 5 (16.1%) isolates of C. neoformans and 8 (33.3%) of C. gattii, grew up to 64 μg/ml of fluconazole, which is the MIC that defines resistance to this azole, and 1 (3,2%) isolate of C. neoformans and 4 (16.7%) of C. gattii grew up to 128 μg/ml of fluconazole. Currently, the ERG11 gene is being amplified for further sequencing. Conclusion: clinical isolates of C. neoformans and C. gattii that develop heteroresistance to fluconazole in high concentrations circulate in Colombia, which is important since this characteristic contributes to the relapse of cryptococcosis during therapy with this triazole.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S8.5d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S9.1d Chronic pulmonary aspergillosis in post-TB and retreatment TB
           patients in Lagos, Nigeria

    • Abstract: Abstract S9.1 Chronic Pulmonary Aspergillosis - where do we stand', September 23, 2022, 4:45 PM - 6:15 PMObjectivesChronic pulmonary aspergillosis (CPA) is a known complication of post-TB treatment. It is a progressive disease characterized by progressive cavitation, fibrosis, and pleural thickening among others. Globally, an estimated 3 million people are affected. This study determined the burden of CPA amongst the post-TB and retreatment TB patients in two facilities in Lagos, Nigeria.MethodsThis was a prospective longitudinal study that was carried out at two TB clinics (LUTH and NIMR) in Lagos, Nigeria between February 2021 and March 2022. The study cohorts were patients that had been previously managed (2-4 years earlier) for TB, they were clinically classified as retreatment TB and post-TB patients. Patients were seen in clinics every 3 months and the following data were collected: Quality of life (WHO and SGRO questionnaires used), 5 mls of blood for Aspergillus IgG level (using Bordier; cut-off of 0.8 AU/ML), sputum for culture (those with productive cough), and chest X-ray. Infectious disease society of America (IDSA) case definition was used to determine cases of CPA.ResultsA total of 112 post-TB treatment patients were recruited, 60 (53.1%) were retreatment TB and 52 (46.0%) post-TB patients. The mean age was 41.14 years; with the majority between the ages of 21-30 years. The male/female ratio was 0.9/1. 98 (87.5%) were HIV negative, and only 40 patients had GeneXpert testing done. In all 32/40 were GeneXpert negative; of which 24/32 and 8/32 belonged to the retreatment, and post-TB groups respectively. Cough was the predominant symptom with 39 (34.8%) having productive cough. Hemoptysis occurred in 11 (9.8%), 10 in the retreatment group with 2 having frank hemoptysis. Chest imaging revealed that 27/112 of the studied cohort presented with multiple cavities, 4/112 had single cavities, 26/112 had cavities with surrounding opacities and 23/112 had upper lobe consolidation. A total of 17/112 of them had bilateral lung infiltrates and 13/112 had pleural thickening. Sputum culture yielded growth of Aspergillus spp, with A. flavus (n-11; 36.7%) being the predominant species followed by A. fumigatus (n-10; 33.3%), and A. niger (n-9; 30%). In all 38/112 (33.93%) patients had Aspergillus IgG titer above the cut-off level, while 6 symptomatic patients had borderline Aspergillus IgG levels. A total of 11/112 (9.82%) of the study cohorts with positive Aspergillus IgG levels were also culture positive; 8/68 of the Aspergillus IgG negative patients were culture positive and had abnormal chest imaging reported. A total of 38 (33.93%) were confirmed cases of CPA using IDSA criteria. Of the GeneXpert positive; 7/40 were retreatment TB; 16/32 of GeneXpert negative and 8/40 of GeneXpert positive met the criteria for CPA.ConclusionOur findings demonstrate that CPA is easily misdiagnosed as treatment failure TB or TB relapse. There is a need for further follow-up of post-TB patients for early identification of post-TB lung disease. It is also imperative to educate our clinicians to screen patients who have persistent symptoms and are GeneXpert negative for other post-TB lung diseases.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S9.1d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P505 Genotyping of Trichophyton mentagrophytes infections in animals in
           Italy through sequencing of the ITS region

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesTrichophyton mentagrophytes is a zoophilic dermatophyte that recognizes lagomorphs and rodents as primary hosts. The fungus can also infect other animals, such as dogs and cats. While T. mentagrophytes is a polymorphic sexual species, T. interdigitale is recognized as its clonal offshoot. This delineation is meaningful from a clinical point of view in human patients. Trichophyton interdigitale is exclusively anthropophilic and mainly causes non-inflammatory chronic tinea pedis or onychomycosis. Trichophyton mentagrophytes is predominantly of animal origin and often leads to the development of inflammatory lesions. These two dermatophytes form a species complex and have several ribosomal internal transcribed spacer (ITS) region genotypes. Identifying the ITS type allows species attribution and simultaneously strain typing. Many studies have been dedicated to this argument concerning human infections, while scarce information is available regarding animals. This study aimed to gain insights into the current epidemiology of T. mentagrophytes genotypes in animals.MethodsThe fungal isolates included in the study regarded cases involving various animal species seen at multiple veterinary clinics in Italy (n = 39) and France (n = 1) between 2005 and 2021. DNA was extracted from isolates cultured on Sabouraud dextrose agar using a commercially available kit (NucleoSpin® Tissue, Macherey-Nagel, Düren, Germany). PCR was performed with the primer pair V9G and LR3. PCR products were sequenced using ITS5 and ITS4 primers through a commercial service (Macrogen Europe). Using MEGA11 software (https://www.megasoftware.net/), ITS sequences were aligned with the currently recognized genotypes (6 and 22 for T. interdigitale and T. mentagrophytes, respectively).ResultsFigure 1 shows the ITS Type attribution for our isolates within a phylogenetic tree that includes the currently recognized genotypes. A new genotype (that, following the nomenclature, we called XXVII) was found in two isolates coming from a dog and a cat living in the same city. Figure 2 shows the distribution of the genotypes according to the animal host.A total of 23 samples out of 40 (57.5%) belonged to the ITS Type III*. It was the lone found in rabbits and the most prevalent in cats. This finding agrees with past literature, which reported a wide distribution of this ITS type in European animals. Of note is the high number of isolates with ITS Type II* found in dogs. ITS Type II* differs only by one nucleotide substitution from T. interdigitale and is considered an ‘intermediate’ entity between it and T. mentagrophytes. Clinical pictures, as well as molecular data, would suggest attributing this genotype to T. interdigitale. On the other hand, it has been detected from animal sources (chinchilla, guinea pig, and brown rat) which would justify its interpretation as T. mentagrophytes. Our data support the latter possibility.Though we could not have a detailed description of all the dogs harboring ITS Type II*, it is noteworthy that many showed the same clinical presentation, i.e., exfoliative chronic disseminated alopecia. Moreover, in most cases, despite the extensive lesions, the infection was not transmitted to the owners.Conclusions: This study adds information on the molecular epidemiology of T. mentagrophytes infections in animals.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P505
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P001 Characteristics and dynamics of azole-resistant Aspergillus fumigatus
           variants emerging over a 28-year period in the Netherlands

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMBackgroundAspergillus fumigatus, a globally distributed opportunistic pathogen, is the main cause of invasive aspergillosis, especially in immunocompromised patients with high mortality. The emergence of azole-resistant A. fumigatus isolates has been a significant concern worldwide and an important clinical problem.ObjectivesWe aim to determine the presence of variants in a large collection of clinical A. fumigatus isolates from the Netherlands, if the number of variants increased over time and if the presence of additional short nucleotide polymorphisms (SNPs) or tandem repeats (TR) variations impacted on the triazole phenotype.MethodsThe Radboud University Medical Center has collected 11 813 clinical A. fumigatus isolates since 1994. The collection includes isolates cultured from patients admitted to our own center, isolates sent from other hospitals for identification and in vitro susceptibility testing, and isolates sent from five university medical centers and five teaching hospitals that contribute to the national Aspergillus resistance surveillance. The genotypes were detected by Cyp51A Sanger sequencing. All isolates were subjected to in vitro susceptibility testing using the EUCAST microdilution reference method. Minimal inhibitory concentrations (MICs) were determined for itraconazole, voriconazole, posaconazole, in all isolates and for isavuconazole in isolates cultured in 2015 and thereafter.ResultsIn total, 1826 A. fumigatus isolates harbored azole-resistant mutations in the Cyp51A-gene with 92 genotypes. Tandem Repeat-associated resistance genotypes accounted for 55.43% of the variants and were involved in 1728 isolates (94.63%). TR34/L98H and TR46/Y121F/T289A resistance mutations remained dominant, and increasingly additional SNPs in the Cyp51A-gene or changes to the gene promoter were observed. The G448S mutation was relatively common and present in various genetic backgrounds. This SNP was most often found in isolates harboring the TR46 resistance mechanism (8 variants) and was also observed in two variants in the TR34 genetic background. TR34 and TR46 resistance mutations are associated with 1170 (64.07%) isolates that exhibited a pan-azole resistance phenotype, 547 (29.96%) a multi-azole resistance phenotype, and 75 (4.11%) resistance to a single azole. TR34/L98H confers high itraconazole resistance, while T289A confers high voriconazole resistance in the TR46 background. Isolates with a G448S point mutation show high MICs for both voriconazole and itraconazole. The TR34/L98H/T289A/G448S isolate showed low itraconazole MICs but high voriconazole resistance, and mutations in the promoter region, TR34/C-86 G/L98H, and (T-66 G)/TR34/L98H variants, showed increased voriconazole and isavuconazole MIC compared with the parent phenotype. TR46/Y121F/M172I/T289A/G448S variant was observed with an increased itraconazole (GM MIC 16 mg/L, 1→16 mg/l) and decreased voriconazole (GM MIC 18.664 mg/l, 4→16 mg/l) compared with the parent MIC of TR46/Y121F/T289A, while TR92/Y121F/M172I/T289A/G448S and TR46/Y121F/ T289A/G448S variants showed the consistent MIC distribution with parent genotype. The variants with more combination mutations showed pan-azole resistance with increased MIC distribution.ConclusionOur survey showed a significant increase in resistance genotypes in clinical A. fumigatus over a period of 28 years. Azoles resistance phenotypes vary from resistant variants in clinical isolates; it is an implication for clinical A. fumigatus infection treatment options and antifungal stewardship.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P001
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S10.5c Insight into the role of secondary metabolism in the pathogenesis
           of Scedosporium apiospermum

    • Abstract: Abstract S10.5 Fungal respiratory infections in Cystic Fibrosis, September 24, 2022, 10:30 AM - 12:00 PMSecondary metabolism is a general term defining biosynthetic pathways that occur in plants, bacteria, and fungi and lead to the production of highly diversified molecular structures. Among the diverse functions that were attributed to these molecules, it is now obvious that they are predominantly involved in chemical warfare with competitors in their environments. In fungi, the two main classes of fungal secondary metabolites are polyketides (PKs) and nonribosomal peptides (NRPs). The biosynthesis of such bioactive molecules is performed by large multifunctional enzymes (NRP synthases, NRPS, and polyketide synthases, PKS) encoded by genes usually located within clusters. Conversely to Aspergillus fumigatus, only a few data are currently available for other pathogenic fungi. In this context, our research group is interested in delineating the role of secondary metabolism in Scedosporium apiospermum, a multi-resistant mold known to colonize chronically the airways of patients with cystic fibrosis (CF).Taking advantage of the availability of the S. apiospermum genome sequence, we first conducted an in silico analysis aiming at exploring the PKs and NRPs battery of the fungus. A total of 9 genes encoding PKs, 9 encoding NRPs, and 5 encoding hybrid NRPs/PKs enzymes were identified. All 3 of the PKs gene clusters presented homologies with those involved in the biosynthesis of pseurotin A. transbergamotene, and ovalicin, or the tremorgenic toxin b-aflatrem while a fourth one is involved in the biosynthesis of melanin. Among the NRPs encoding genes, 6 exhibited sufficient similarity scores with other fungal NRPs to predict the class of the generated peptide: siderophores (2), epidithiodioxopiperazines (2), and cyclopeptides (2). Nevertheless, substrate prediction methods for NRPs domains failed, thus questioning about the nature of the produced peptides. We thus focused our attention on the characterization of some NRP and PK biosynthetic pathways. Since iron acquisition is known to be crucial for the survival of microorganisms as for the virulence of numerous pathogens, we first investigated clusters predicted to be responsible for the biosynthesis of siderophores in S. apiospermum. For instance, we disrupted the SAPIO_CDS2806 gene, an ortholog of sidD which drives the production of the extracellular hydroxamate-type siderophore fusarinin C in Aspergillus fumigatus. A comparison of culture supernatants from sidD mutants and their parent strain revealed that S. apiospermum secretes a unique extracellular siderophore, namely Nα‐methylcoprogen B and that sidD gene was essential for the biosynthesis of this siderophore. sidD mutation resulted in the lack of growth under iron limiting conditions. Interestingly, pyoverdine supported the growth of the parent strain only, suggesting that Nα‐methylcoprogen B is required for iron acquisition from this Pseudomonas aeruginosa siderophore. Finally, the deletion of sidD resulted in the loss of virulence in a murine model of scedosporiosis.Altogether, our results demonstrate that S. apiospermum sidD gene drives the synthesis of a unique extracellular siderophore, namely Nα‐methylcoprogen B, which is essential for fungal growth and virulence. Above all, we also provide unprecedented data suggesting that this fungal siderophore scavenges iron from pyoverdine, which might explain the antagonism between S. apiospermum and P. aeruginosa in CF.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S10.5c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P030 Highly slow-release antifungal wound dressing for chronic
           dermatophytosis

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesThe aim of this research was to make a biocompatible and affordable nanofibrous wound dressing that is able to release terbinafine at the site of chronic superficial fungal infection over time.MethodsPolymer solution (10%) of poly (caprolactone) (PCL) was prepared in hexafluoroisopropanol (HFIP). Terbinafine hydrochloride (TFH) was added equal to 5% of PCL weight for drug-loaded samples. Electrospinning was performed with a 27-G-needle equipped syringe at a distance of 15 cm which the injection flow rate of the solution was 0.2 ml/h and a 30 kV voltage was applied. The measurements of drug release were performed with HPLC. Antifungal tests were done on three different fungal species and MTT assay was done based on ISO-10993 on 24 h L929 cells. The drug release was monitored for 144 h in a human body simulated system (incubation at 37°C, shaking by 30 rpm, and passing the drug through a wet Whatman filter into PBS).∷ΞResultsThe mean diameter of fibers was obtained at 1262 nm for PCL nanofibers without TFH and 249 nm for PCL nanofibers with TFH. The drug loading for PCL was 83.4%. Antifungal activity of PCL fibers was examined against a dermatophyte (Trichophyton mentagrophytes), a saprophyte (Aspergillus fumigatus), and a yeast (Candida albicans). The terbinafine hydrochloride-contained electrospun PCL fibers inhibited the growth of T. Mentagrophytes and A. Fumigatus but did not inhibit C. albicans growth. None of the samples showed cytotoxic effects after 24 h and 2 weeks.ConclusionsThe diameter of PCL nanofibers with TFH apparently decreased by fives times (P >.05). PCL nanofibers successfully inhibited two important fungal species while no toxicity was observed in MTT assay for its extraction of 2 weeks. They were able to release TFH slowly over time which makes them suitable for the treatment of chronic superficial fungal infections.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P030
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P046 Local adaptation to antifungal compounds in the model organism
           Neurospora crassa

    • Abstract: AbstractPoster session 1, September 21, 2022, 12:30 PM - 1:30 PMThe domestication of Neurospora crassa has been a major driver of the fields in fungal molecular and cell biology. Not only this filamentous species enjoys modest nutritional requirements and grows swiftly in the laboratory, but also its genome is considerably well annotated, and a near-complete deletion strain collection is available for functional analyses. Furthermore, decades of research with N. crassa have been accompanied by the accrual of wild isolates from different points of the globe, which are an invaluable tool to study local adaptation. Using a panel of antifungal compounds, we found that drug resistance is naturally heterogeneous in wild populations of N. crassa, and chromosomal mapping of the causal loci is underway to unveil the genetic basis of the observed natural diversity. Furthermore, we are interested in the regulatory role played by two Zn2Cys6 transcription factors, CZT-1, and TAH-3, during fungal responses to various drugs. In summary, despite it being non-pathogenic, N. crassa presents many advantages as a model to study antifungal drug resistance. Since the paucity of valid molecular targets in the fungal cell has been hindering the discovery of new antifungal drugs, we consider that the identification and functional characterization of new genes and pathways involved in drug resistance may inform the adoption of new therapeutic schemes.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P046
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P047 Comparative evaluation of disc diffusion and E-test with broth
           micro-dilution in susceptibility testing of amphotericin B, posaconazole,
           isuvuconazole, itraconazole against Rhizopus isolates of post COVID
           mucormycosis

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTo investigate and compare susceptibility pattern of Rhizopus isolates in post-COVID mucormycosis by disc diffusion (DD), E-test, and broth micro-dilution for amphotericin B, posaconazole. DD and BMD for isavuconazole and itraconazole.MethodsAll the isolates were identified by MALDI-ToF (Vitek MS). A total of 72 isolates of R. oryzae complex and 48 isolates of R. microsporus complex were selected. AFS by DD and E-test was done on non-supplemented Mueller Hinton Agar (MHA) and was compared with the Clinical Laboratory Standard Institute (CLSI M 38 A2) broth micro-dilution (BMD) method of AFS.ResultsThe disk diffusion method for amphotericin B showed 91.6% agreement while E-test showed 97.2% agreement with broth micro-dilution. Disk diffusion method for posaconazole showed 93% agreement while E-test showed 97.2% agreement with broth micro-dilution. Disk diffusion method for ITZ and ISC showed 94.4% and 100% agreement respectively with broth micro-dilution.ConclusionCLSI method of DD promises to be an easier, reproducible, and cost-effective method of susceptibility testing, but this method must be interpreted with caution in the case of amphotericin B susceptibility testing. E-test correlates better than DD with BMD.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P047
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P067 Cumulative hospital antibiogram of AIIMS Bhopal for Candida species

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesPrimary Objectives:To perform the phenotypic identification of the Candida isolates.To perform genotypic identification for confirmation of the Candida species.To prepare antifungal susceptibility profiles of each Candida isolate.Secondary Objectives:To determine the clinical spectrum.To stratify patients based on clinical risk such as per parameters as prior hospitalization and risk for invasive fungal infections.MethodsCross-sectional hospital-based study of 1-year duration 2020-2021. All samples sent to the microbiology laboratory with clinical suspicion of Candida infection and fulfilling the inclusion criteria were considered as sample size for the study period. The study population was the clinically relevant Candida isolates for which antifungal susceptibility testing was done and fulfilling the inclusion criteria. Study duration was for 1-year and was held at AIIMS, Bhopal. The data collected was entered in MS EXCEL and latest WHONET software and analyzed by WHONET software to generate antibiogram for Candida. Results are summarized in percentages and frequencies.ResultsTotal 110 Candida isolates were included in the study for antifungal susceptibility testing and WHONET entry after fulfilling the inclusion criteria.The commonest isolate across all samples processed and included was C. tropicalis 40% followed by C. glabrata 15.5%. A total of 43.6% Candida species were isolated from urine samples followed by 29% from blood samples and 10% from sputum samples. In all 54.5% of yeast isolates were from ICU followed by 40% from ward patients and at least 5.45% from OPD.The commonest isolate across all locations was C. tropicalis 40% followed by C. glabrata 15.5%, C. albicans 14.5% and C. parapsilosis 11.8%. The predominant isolates were under the age category 19-60 years, 69% followed by 26.4% >60 years of age. The percentage susceptibility of C. tropicalis isolates showed >90% susceptibility to tested antifungals. The percentage susceptibility of C. glabrata isolates showed susceptibility to echinocandin but reduced susceptibility to fluconazole. For Candida albicans overall no azole or echinocandin resistance was noted. For Candida parapsilosis overall no azole or echinocandin resistance was noted. C. krusei showed 100% susceptibility to anidulafungin, caspofungin, micafungin, and voriconazole by BMD. C. guilliermondii percentage susceptibility available for caspofungin 33.3%.A total of 80% of the isolates were from patients with community-acquired infections and 19% Candida species were from health care-associated infections. Among the community-acquired infections C. tropicalis was the commonest 37.5% followed by C. albicans 17%, C. glabrata 16%, and C. parapsilosis 12.5%. Among the HAI commonest isolate was C. tropicalis 47.6% followed by 14.3% each of C. auris, and C. glabrata. C. auris all isolates showed elevated MIC fluconazole(≥64 μg/ml), voriconazole (≥1 μg/ml), and caspofungin (≥1 μg/ml).ConclusionThe study conducted just over a year period in the department of microbiology of AIIMS Bhopal has been instrumental in generating cumulative antifungal antibiogram for Candida species.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P067
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P068 Inhibition of Candida glabrata biofilm using the combination of a
           novel antifungal cyclic lipopeptide and azole: An in vitro synergistic
           approach

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMThe general feature of the biofilm is a densely packed microbial community with an extracellular matrix composed of polysaccharides and proteins. Candida glabrata was reported as the most biofilm-forming species responsible for causing virulent Candida infections among Candida non-albicans (CNA). Candida glabrata is the most azole-resistant species of all Candida species. The early and maturing biofilms enable the Candida cells to overcome the effects of azoles and exhibit higher drug resistance. Since simple azole mono-therapy rarely eradicates recalcitrant Candida biofilms, removal of the infected device becomes necessary for curing the infection.ObjectiveThe objective was to assess the biofilm inhibition effect of antifungal cyclic lipopeptide which has been purified by a multi-step process from the cell-free supernatant of Bacillus subtilis, and to analyze the synergistic activity of the purified lipopeptide lead compound designated as AF4 with the standard antifungal fluconazole using different concentrations.MethodsBriefly, cell-free supernatant was extracted using a solvent mixture and silica gel-based adsorption chromatography. The potential antifungal cyclic lipopeptide variant AF4 was extracted from the soil isolate B. subtilis by a multi-step purification process that involves reversed-phase HPLC and exhibited a wide-spectrum of anti-Candida activity. The XTT reduction assay was used for metabolically active cells after treatment with a combination of drugs, and crystal violet (CV) assay was performed to quantify the cell biomass. Scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM) were used to analyze the biofilm morphology and architecture of the AF4 lipopeptide at (2xMIC) and fluconazole (8x-16xMIC)-treated biofilms. For confocal microscopy-based biofilm visualization, a combination of two different dyes was used. Extracellular polymeric substances were stained by concanavalin A-Alexa Fluor 488 conjugate and, the FUN- 1 fluorescent dye was used for staining the live biofilm-forming Candida cells. After capturing the Z-stack images in CLSM, the biomass (μm3/μm2), average thickness (μm), and roughness of the biofilm were analyzed by Comstat 2.1 software.ResultsThe AFST analysis showed that the MIC of the lead antifungal lipopeptide was 8 μg/mL against the C. glabrata planktonic cells. Adding the antifungal compound at higher MICs such as by 2-folds exhibited strong antibiofilm effect that significantly enhanced the synergistic antifungal activity of the fluconazole against C. glabrata biofilm formation. Synergistic effect of fluconazole at 8x-16xMIC with 2xMIC of the lead compound AF4 on C. glabrata 24 h maturing biofilm had increased significantly as revealed by the XTT and CV assays. The results confirmed ˃ 50% inhibition of the biofilm in both 6 h developmental and 24 h maturing biofilms in 8xMIC fluconazole plus 2xMIC AF4 while compared with fluconazole alone at the same concentration. The results from the XTT and, CV assays and SEM and CLSM (Fig. 1) suggest that the combinatorial treatments of the lead antifungal lipopeptide and fluconazole at varying concentrations have the potential of eradicating or nearly eradicating the maturing biofilm of CAN.ConclusionsThe combinatorial study was found effective in combating the biofilm formation. A correlation between metabolic activity and antifungal resistance in maturing biofilms has been found.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P068
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P076 The promising antimycotic activities of a novel cyclic antifungal
           lipopeptide against Human Dermatophyte Isolates

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTo determine the minimum inhibitory concentrations (MICs) of a novel antifungal lipopeptide against clinical isolates of dermatophytes of human origin.MethodsTo perform antifungal susceptibility testing (AFST) by CLSI microbroth dilution method, a reversed-phase high-performance liquid chromatography (RP-HPLC) purified lipopeptide of 1071.4 Da from a wild-type soil isolate Bacillus subtilis was used and compared with the standard allylamine terbinafine MICs. Briefly, 1200 ml of cell-free culture supernatant was extracted using a solvent mixture and silica gel (230-400 mesh size)-based adsorption chromatography. The semi-preparative RP-HPLC system consisted of an Agilent quaternary pump and a variable wavelength detector equipped with a Phenomenex Luna C18 column (10 mm × 250 mm, 5 μm). The solvent system for RP- HPLC was (A) water with 0.1% trifluoroacetic acid (TFA) and (B) acetonitrile containing 0.1% TFA. The gradient of solvent B used for purification was as follows: 0%-54% for 0-20 min at the flow rate of 1 ml/min, 54%-60% from 20-48 min at 0.5 ml/min, 60%-100% from 48-58 min at 0.5 ml/min, 100%-0% from 58-65 min at 1 ml/min and monitored at 210 nm.ResultsSuperficial skin infections are caused by dermatophytes including Trichophyton spp. Nowadays, resistance to terbinafine in Trichophyton spp. isolates with higher MICs have been documented in India. We report here the antifungal prowess of a novel small antifungal lipopeptide against 20 clinical isolates of Trichophyton spp. of human origins (from human skin scrapings and nails) with the clinical diagnosis of tinea corporis/cruris and tinea unguium. The representative photographs of T. tonsurans, T. rubrum, and T. mentagrophytes complex are provided below. A total of 6 isolates of T. mentagrophytes and T. rubrum carry point mutations at F397L of squalene epoxidase (SQLE) protein. The in vitro antifungal efficacies determined by AFST revealed that the lipopeptide showed less or equivalent MICs (100% inhibition) in the case of five dermatophytes. The lipopeptide drug has exhibited improved MICs against two T. mentagrophytes complex and two T. rubrum isolates with amino acid substitution F397L in SQLE protein. Trichophyton mentagrophytes complex and T. rubrum with F397L mutations were inhibited at MICs 4-32 μg/mL of terbinafine. In comparison, the lipopeptide showed 4-16 μg/ml (100% inhibition). In the case of all four Trichophyton tonsurans, the MICs ranged between 2-4 μg/ml for the lipopeptide.ConclusionsThe broad-spectrum lipopeptide showed promising antifungal activity against dermatophytes and may be considered for nano-emulsion formulation and tested for topical application in a mice model.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P076
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P077 Detection of CYP51A mutations in airborne Aspergillus spp isolates
           from intrahospital environments

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMIntroductionAerobiological studies have found an increasing number of fungal taxa in the intrahospital environments, including Aspergillus species. There is a gap in knowledge on drug-susceptibility in spores circulating in intrahospital environments. In this work, we evaluated the CYP51A genome alterations and Aspergillus spore susceptibility to antifungal drugs.ObjectivesTo determine the sequence of CYP51A gene in clinical and environmental Aspergillus spp. isolates from intrahospital environments in Medellín, Colombia II. To evaluate the phenotypical response of Aspergillus isolates harboring mutations in CYP51 gene from intrahospital environments.MethodsWe used Aspergillus spp. collected from air and surfaces from intrahospital environments, as well clinical samples. We performed Whole Genome Sequencing (WGS) using HiSeqXten Illumina platform for species identification. Genomes were assembled de novo using the SPADES algorithm. Genome annotation by ab initio prediction was done using the Augustus program. We extracted the sequences from the CYP51A gene and its promoter using OrthoFinder workflow. To identify previously described mutations related with drug-resistance, we performed SNPs search in Geneious software using Clustal Omega. For the determination of broth dilution minimum inhibitory concentrations (MIC) of antifungal agents, we used the Eucast method 9.4.ResultsWe identified 26 Aspergillus from Fumitagi section using morphological characteristics. Three were isolates from clinical samples and twenty-three were obtained from intrahospital environments. We performed whole genome sequence for identification to species level. We identified 26 Aspergillus fumigatus using an in-house script base in BLASTn algorithm for 4 genes: internal transcribed spacer, b-tubulin, calmodulin, and RNA polymerase II. OrthoFinder workflow was performed to obtain CYP51A sequence. Clustal-Omega analysis showed two SNPs A1147G and T11167A, which constituted two non-synonymous mutations N248K and I242V respectively. A total of 8 and 3 isolates presented the changes in the CYP51A gene respectively. To determine their role in antifungal resistance, the strains were tested against 10 concentrations (0.03-8 mg/l) of voriconazole antifungal agent. We used one clinical isolate without genomic changes in the CYP51A gene as control. The MIC was 0.5 mg/l for all the tested isolates. This value suggests isolates are susceptible to voriconazole.ConclusionsIdentification of Aspergillus fumigatus to species level was achieved through whole genome sequence.Described mutations had been related to resistance to voriconazole, itraconazole and had not been tested for posaconazole. In this work, isolates presenting non-synonymous mutations were susceptible to voriconazole with breakpoints >1 mg/l. It is necessary to evaluate the antifungal susceptibility to other antifungal agents.The mutation N248K was previously described only in isolates from clinical samples. Mutation I242V was found in clinical and environmental samples from agricultural lands. Here we described SNPs in isolates from intrahospital environments.This work is the first one describing mutations and elucidating their role in the drug-resistance of airborne A. fumigatus in Medellín, Colombia.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P077
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P078 Baseline antifungal usage patterns and knowledge regarding management
           of invasive fungal infections as a part of a multidisciplinary antifungal
           stewardship (AFS) program

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTo establish a baseline of antifungal usage patterns (indication, duration, toxicity, and cost) and physician's knowledge of management of invasive fungal infections, as a basis for implementation of a multidisciplinary antifungal stewardship (AFS) program at a tertiary care center.MethodsData including clinical history, investigations, and antifungal therapy was collected by chart review and bedside rounds from 100 patients with laboratory-confirmed invasive fungal infections (IFIs). Requirement and adequacy of antifungal therapy were assessed in comparison with IDSA and EORTC/MSG guidelines and scored at discharge/death using the Valerio system. This system assigns points to six parameters: indication, optimal selection of antifungal agent, dosage according to individual characteristics, loading and maintenance dose, therapy adjustment after microbiological results, route of administration, and length of therapy. The maximum score (10) indicates appropriate therapy. Any score of ˂ 10 is classified as inappropriate.ResultsOut of 100 patients who met the criteria for IFI, 85 patients had a single IFI, 45 (52.9%) of whom received appropriate antifungal therapy, 17 (20%) received other than the recommended antifungal therapy and 23 (27.1%) received no antifungals. A total of 15 patients had dual IFIs, 10 (66.7%) of whom received other than the recommended antifungal therapy for one or both infections, 1 (6.7%) was treated appropriately for one infection but left untreated for the other, 2 (13.4%) patients were untreated for both infections and 2 (13.4%) were appropriately treated for both infections. The most common types of inappropriate antifungal use were inappropriate antifungal for organism (16 incidents), inadequate dosage (11 incidents), inappropriate antifungal for site (6 incidents), inadequate duration (6 incidents), and failure to adjust antifungal therapy based on microbiological test results (6 incidents). Common reasons observed for inappropriate antifungal use were delay in starting antifungal therapy or in ordering appropriate tests for establishing diagnosis, uncertainty in distinguishing fungal pathogens from colonisers, lack of rigorous antifungal charting, unavailability of first-line drug, and attempts to use a single antifungal to cover dual IFIs.ConclusionsThere are several inadequacies in Valerio scoring system, i.e., no weightage given to timely initiation of treatment, no deductions for delay in starting treatment once reports have been received, or for use of unnecessary antifungals in addition to recommended ones. Antifungals are often chosen by organism only while ignoring site-specific action and penetration of the drug. There is no comprehensive system for recording antifungal use, making it difficult to ascertain cumulative antifungal use over time. Direct association could not be made between inappropriate antifungal use and outcome as most patients had multiple comorbidities apart from fungal infection. Where fungal infection occurs along with TB, fungi are often considered commensals and left untreated. Many immunocompetent patients with IFIs are ‘unclassifiable’, ie, cannot be categorized under existing guidelines. Even for ‘classifiable’ patients, there is considerable subjectivity in antifungal treatment guidelines. There is a need for a standardized algorithm-based treatment at institutional level for these groups of patients.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P078
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P120 Vaccine induced protection by secreted aspartyl proteinase 2 from
           Candida parapsilosis in Candida tropicalis mediated murine systemic
           candidiasis: a role of B-cells and antibodies

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesNon-albicans Candida species are increasingly becoming more prevalent globally and emergence of drug resistance is another cause of concern. These challenges merit the need for developing novel immune therapies against Candida infections. We investigated the protective potential of secreted aspartyl proteinase (Sap2), a leading Candidate vaccine antigen identified from research based on C. albicans, in murine systemic candidiasis caused by non-albicans Candida species. Moreover, while the role of cellular immune responses in anti-Candida immunity is well established, less is known about the role of humoral immunity against systemic candidiasis. As such, we also investigated the role of humoral immunity in vaccine-mediated protection during murine systemic candidiasis.MethodsThe Sap2 genes were successfully cloned and expressed as recombinant proteins from C. albicans, C. tropicalis and C. parapsilosis strains prevalent in India. Groups of wild-type BALb/c mice were vaccinated with individual rSap2 protein along with alum as adjuvant, followed by systemic infection with a lethal dose of C. tropicalis. The protective potential of each rSap2 protein was evaluated using survival analysis and estimation of organ fungal burden. Histopathological assessment was performed using H&E and PAS staining. Serum cytokine levels and antigen-specific antibody titers were measured by ELISA. Cellular responses were analyzed in detail using flow cytometry. Functional evaluation of antibody role was performed using in vitro (biofilm inhibition and neutrophil-mediated killing) and in vivo (passive transfer) studies. B-cell epitope analysis was carried out using immunoinformatics approaches.ResultsMice vaccinated with rSap2 cloned from C. parapsilosis (Sap2-parapsilosis) showed highest increase in survival time (P = .02) and maximum reduction in organ fungal burden (spleen, kidney, lungs, brain) (P <.05); compared with sham immunized controls. Vaccination with rSap2 cloned from C. albicans did not improve survival in non-albicans C. tropicalis infection, despite the protein having ∼60% homology across species. Mice vaccinated with rSap2-parapsilosis also exhibited significantly higher levels of IFN gamma, IL-17, and IL-4 cytokine levels just before infection, which correlated with protection. In addition, rSap2-parapsilosis vaccination induced high titers of Sap2-specific antibodies, and a fraction of antibodies could bind whole fungus (which were predominantly of IgM isotype). Notably, sera from rSap2-parapsilosis vaccinated mice exhibited increased C. tropicalis biofilm inhibition ability and enhanced neutrophil-mediated fungal killing in vitro. Sap2-specificity was further confirmed by depleting antigen-specific antibodies. Passive transfer of Sap2-parapsilosis immune serum significantly reduced fungal burdens in naive mice, as compared to mice receiving sham-immune serum, upon infection. Higher numbers of total CD19 + B-cells, plasma cells, and Candida-binding B-cells in rSap2-parapsilosis vaccinated mice indicate a role of B-cells during early stages of Sap2-mediated immune response. Epitope analysis performed using identified B-cell epitopes provides insights about including important IgM and IgG epitopes, when designing multivalent or multi-epitope anti-Candida vaccine/s.ConclusionMice immunized with recombinant Sap2 cloned from C. parapsilosis exhibited increased survival during C. tropicalis mediated systemic candidiasis. Both Th1/Th17 mediated cellular immunity and humoral immunity contribute toward protection. Our results establish a role of B-cells and antibodies in generation of protective immune responses against Sap2 vaccine antigen during non-albicans Candida mediated murine systemic candidiasis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P120
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P121 Effect of corticosteroids on the host innate immune response and in
           vitro growth characters during dermatophyte infection.

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectiveDuring the current epidemic of dermatophytosis, dermatologists in India are noticing atypical clinical presentations of dermatophytosis lesions. Though fixed drug combinations of topical application containing corticosteroid-antifungal-antibacterial drugs are attributed to this phenomenon, it is still not clear about its exact role. Corticosteroids alleviate itching but do not clear off dermatophyte infection from the skin surfaces, which may lead to a relapse of dermatophytosis. Therefore, we analyzed the effect of corticosteroids on host immune response and pathogen in vitro during dermatophyte infection.MethodologyPatients (n = 15) were recruited in three groups; proven cases of dermatophytosis with a history of corticosteroid usage for >30 days (Group A), dermatophytosis with no history of corticosteroid usage for >30 days (Group B), and patients without dermatophytosis and expected to have normal skin (Group C). Skin biopsies were collected and subjected to scanning electron microscopy (SEM) and cytokine expression study. All in vitro experiments were performed with HaCaT Keratinocytes cell line co-cultured with Trichophyton mentagrophytes complex conidia isolated from dermatophytosis (n = 4) and standard strain (n = 1, ATCC 18748). Biopsies were fixed in 2.5% glutaraldehyde and dehydrated through (50%-100%) ethanol gradient. RT-PCR expression of pro-inflammatory cytokines (IL-6, TNF-a, IL-1β, IL-1α, IFN-ϒ, TLR-2, and TLR-4) from skin biopsies and HaCaT cells were conducted using beta-actin as reference gene. The viability and Cell-cycle analysis of HaCaT cells in the presence and absence of clobetasol propionate (0.05% w/w) was performed by MTT assay and Propidium Iodide (PI) staining via flow cytometry, respectively. Growth kinetics of dermatophytes was performed for 96 h in presence and absence of corticosteroid. Expression of sulfite efflux pump gene (ssu1) and pH response gene (pacC), involved in virulence of Trichophyton mentagrophytes complex clinical isolates from classical and atypical lesions (n = 3 each) as well as standard ATCC 18748 was studied by RT-PCR. All results were statistically analyzed using GraphPad Prism 6 software.ResultsSEM results showed skin atrophy in skin biopsies from patients with steroid usage. Relative gene expression (2-Δct) of pro-inflammatory cytokines from skin biopsies was significantly reduced in IL-6, IL-1β, IFN-ϒ, TLR-2 (P-values = .001; .005; .004; .001) in steroid-modified tinea group. Similarly, a difference was observed in keratinocytes in vitro. According to in vitro analysis clobetasol propionate treatment significantly arrests HaCaT cells in the S/G2M phase (P-value = .04). Corticosteroid slows down the growth of dermatophytes in the presence of corticosteroid. A significant upregulation was observed in ssu1 during co-culture of dermatophytes with HaCaT cells as well when co-culture was treated with corticosteroid as compared to the culture alone whereas significant changes were not observed with pacC in similar conditions.ConclusionIncreased atrophy caused by corticosteroids allows dermatophytes to thrive on the intact keratin when steroid pressure is removed. Reduced cytokine response, viability, and S-phase arrest in host correlate with delayed clearance of dermatophyte infection from skin. Delayed growth of dermatophytes in the presence of corticosteroids and upregulation of ssu1 in dermatophytes when co-cultured with keratinocytes and corticosteroid correlates with recurrent infection. In addition, increased production of sulfite ions that degrade keratin may lead to the formation of widespread lesions.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P121
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P122 Myeloid-derived suppressor cells as a potential biomarker and
           therapeutic target in rhino-orbital mucormycosis patients

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMBackgroundMucormycosis is a deadly fungal infection that emerges in patients affected with COVID-19. All fungal illnesses are caused by dysregulated adaptive immunity, but Myeloid-derived suppressor cells (MDSC) have added a new dimension to the chronic inflammatory response.ObjectiveWe attempted to enumerate the MDSC immune response in rhino-orbital mucormycosis patients before and after treatment and compared the data with healthy control.MethodsA total of 3 ml of blood samples were taken in an EDTA vial from 20 patients with mucormycosis and 20 age-matched healthy control. A second blood sample was collected to examine the immune system post three months of treatment. Mycological identification was performed on nasal crust retrieved after surgery using KOH/culture. The expression of the MDSC marker was analyzed by immunostaining with the antibodies against CD14, HLA-DR, CD11b, CD33, CD66 (Biolegend). Fluorescence profiles were recorded by Flow Cytometer (BD FACSAria™ III) and analyzed by Flow Jo software (BD Biosciences). The percentage of positive cells is used to express the results. The GraphPad Prism (version 8, GraphPad software, LaJolla, CA, USA) was used to analyze the data. All of the results were considered significant when P <.05.ResultsAll of the patients tested positive for Rhizopus arrhizus, which was confirmed by the culture. The percentages of Monocytic-MDSC (mMDSC: CD14 + HLA-DR-/low) cells were significantly high in patients compared to healthy control. In post-3-month treatment, the percentages of mMDSC were found significantly low and comparable with healthy control. Granulocytic MDSC (gMDSC: HLA-DR-/low CD33 + CD11b + CD66+) cell population was higher in patients compared with healthy control and patients with post-3-month treatment.ConclusionMDSC regulates T cells and other immune cells with a different mode of action. The findings in this study imminently indicate the mechanism of immune dysregulation involving MDSC pathways in mucormycosis and provide evidence that restoration of immune balance causes reduction of MDSC cells may be considered a therapeutic option for long-term benefit.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P122
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P123 Study of naïve and memory T helper cell response in patients of
           chronic rhinosinusitis with nasal polyposis (CRSwNP) after in vitro
           exposure to Aspergillus flavus

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesTo study the CD45RA (naive) and CD45RO (memory) in CD4 + T cell population after in vitro stimulation to Aspergillus flavus antigen in CRSwNP patients and healthy controls.MethodsThe study included 30 cases of CRSwNP (before and after six months of treatment) and 30 healthy controls. Postoperatively biopsies (polyp tissues) were subjected to KOH and culture for mycological investigation. Preoperatively, blood sample (4 ml) was collected from cases and controls for peripheral blood mononuclear cells (PBMCs) separation. PBMCs were treated in vitro by Aspergillus flavus antigen (20 μg/ml) and Phytohemagglutinin and incubated for 18 h at 37°C in CO2 incubator. Cells were harvested after incubation and stained with different monoclonal antibodies such as CD3, CD4, CD45RA, and CD45RO for flow cytometry analysis. Statistical analysis was done using SPSS software. Data were expressed as mean ± SD and the significance level was considered at probability below 0.05.ResultsThe profiles of various CRSwNP patients and healthy controls were studied. The mean age and duration of disease of the patients were recorded as 28.92 years and 9.08 months. A total of 24/30 (80%) cases were found positive for Aspergillus flavus from KOH/culture investigation. The percentage positivity of CD3 + CD4 + T cells was significantly increased after A. flavus stimulation in patients as compared with healthy controls. Decreased levels of CD45RA + CD4 + T cells were analyzed in patients before and after treatment as compared with healthy controls. The percentage of CD45RO + CD4 + T cells was found to be increased upon A. flavus stimulation in patients compared with the healthy control group.ConclusionThe continuous exposure to fungal spores may induce unusual immune responses to Aspergillus flavus spores, triggering an allergic immunological reaction with increased CD4 + T cell responses. Increased levels of CD4 + CD45RO + T cells may transform the pathogenic reaction and highlight the chances of A. flavus reactive T cells involvement in initiating inflammation in cases of CRSwNP.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P123
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P165 Mycological profile of keratitis from tertiary care center in the
           state of Chattisgarh, India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveTo assess the burden of fungal etiology of clinically suspected mycotic keratitis amongst the patient presented to the Ophthalmology department in a tertiary care hospital in Chhattisgarh.MethodsThis is a laboratory-based retrospective study of the corneal scrapings received for mycological processing between January 2020-December 2021. Demographic data were collected from patients and from their medical records. Corneal scrapings were aseptically collected from the margins of the ulcer using a sterile Kimura blade in the Ophthalmology department and the samples were processed by following the standard microbiology protocol. A wet mount examination with 10% KOH was done. Samples were also smeared onto a sterile slide for Gram stain. Samples were inoculated in a C-shaped manner on media on blood agar, chocolate agar, and Sabouraud's dextrose agar supplemented with chloramphenicol. Media were incubated in a 25°C aerobic incubator and observed for growth daily for a week and thereafter on alternate days. Blood agar was incubated at 37°C. Fungi were identified by the conventional method by Lactophenol cotton blue microscopy (LPCB) and slide culture. Antifungal susceptibility testing for Voriconazole with E-test was performed for Aspergillus and Fusarium species.ResultsA total of 37 patients with suspected mycotic keratitis were included in the duration of the study period. The demographic details hinted more predisposition of keratitis in females than in males; with a mean age of 49 ± 2 years and a range from 21 to 80 years. The predominant predisposing factor was trauma with organic matter in agricultural background. Amongst the total 37.8% (14/37) were positive for both KOH and culture, while 5.4% (2/37) were KOH negative but culture positive. There were 5 isolates that could hint toward low sample load or certain technical logistic issues could not be culture. Amongst culture-positive isolates, Fusarium species (37.5%) was the most common isolate showing predominance of Fusarium oxysporum, followed by Acremonium species and Aspergillus species 19%, with rare isolation of Colletotrichum dematium and Scedosporium species.ConclusionCulture remained the gold standard for the detection of fungal agents which will help to know the epidemiology of the local areas and guide the clinicians to prevent and treat the affected patients effectively. The tropical environment and agricultural occupation in Chhattisgarh present variability in the etiology of mycotic keratitis. With the predominance of Fusarium species, unusual fungal isolates of C. dematium and Scedosporium species from corneal ulcers were observed. Early detection is essential to initiate appropriate antifungal therapy and to minimize preventable ocular complications like blindness.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P165
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S6.3c Adaptive dynamics in experimental populations of Aspergillus
           nidulans

    • Abstract: Abstract S6.3 Fungal adaptation and evolution, September 22, 2022, 4:45 PM - 6:15 PMA total of 12 replicate populations initiated with a laboratory strain of the ascomycete fungus Aspergillus nidulans evolved on synthetic minimal glucose agar medium for 1 year, using weekly transfers of 1% of the produced asexual spores to fresh medium. This Aspergillus short-term evolution experiment (ASEX) was designed to understand how filamentous fungi adapt to growth on limited carbon in a spatially structured environment. We observed no systematic improvement in the fitness components tested and neither in the competitive fitness relative to the ancestor. Instead, we observed the repeated evolution of at least two morphotypes, with a fluffy-like (FL) or an ancestor-like (AL) colony morphology, leading to non-transitive fitness interactions among isolates in two selected populations. The genomic analyses of clones from all 12 populations at an early (week 10) and the final time point (week 52), show a clear role of natural selection during ASEX. We also observed a shared genetic basis and different timing of adaptation of AL and FL types. In addition, in most populations, both morphotypes do not form monophyletic groups, but they frequently disappear and re-evolve from ancestral forms of both types. Reduction in asexual spore yield, the most evident parallel phenotypic change found in all our evolved populations, is not due to the direct selection of genes involved in asexual reproduction. Instead, we argue that reduced spore yield is a pleiotropic effect of adaptive changes in metabolism.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S6.3c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S6.3d Candida albicans commensalism in the oral mucosa is favored by
           limited virulence and metabolic adaptation

    • Abstract: Abstract S6.3 Fungal adaptation and evolution, September 22, 2022, 4:45 PM - 6:15 PMObjectivesAs part of the human microbiota, the fungus Candida albicans colonizes the oral cavity and other mucosal surfaces. Commensalism is tightly controlled by complex fungus-host interactions that preclude fungal elimination but also fungal overgrowth and invasion that would result in disease. As such, defects in antifungal T cell immunity render individuals susceptible to oral thrush due to interrupted immunosurveillance. The factors that promote commensalism and ensure persistence of C. albicans in a fully immunocompetent host remain less clear. In this study, we aimed at identifying determinants of C. albicans commensalism in the oral cavity.MethodsWe used an experimental model of C. albicans oral colonization in mice, profiled the transcriptome of the fungus in the mucosal tissue, and conducted functional studies with the prototypical commensal isolate 101 in host-free and host-involving conditions.ResultsC. albicans commensalism is associated with a characteristic metabolic profile tailored to the nutrient-poor conditions in the stratum corneum of the epithelium where the fungus resides. Metabolic adaptation of the commensal isolate 101 was also reflected in enhanced nutrient acquisition when grown on oral mucosa substrates. Persistent colonization of the oral mucosa by C. albicans also correlated inversely with the capacity of the fungus to induce epithelial cell damage and to elicit an inflammatory response. These immune evasive properties of isolate 101 are explained by a strong attenuation of numerous virulence genes, including those linked to filamentation. De-repression of the hyphal program by deletion or conditional repression of the transcriptional repressor NRG1 abolished the commensal behavior of isolate 101.Conclusions: This study establishes a central role of NRG1 in the commensal lifestyle of C. albicans in the oral niche of the host.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S6.3d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S6.4c Primary cutaneous implantation coccidioidomycosis

    • Abstract: Abstract S6.4 One health approach for endemic mycoes in the Americas, September 22, 2022, 4:45 PM - 6:15 PMObjective: To present a series of cases of primary cutaneous coccidioidomycosis, to highlight this mycosis that can start as cutaneous implantation, after trauma, and to emphasize the classification criteria.MethodsA series of cases of primary cutaneous coccidioidomycosis will be presented, all of them confirmed by mycological studies, fresh examinations, stains, and cultures, as well as their molecular identification; also confirmed by histopathology.ResultsA series of 22 cases of primary cutaneous coccidioidomycosis is presented, 16 (72.8%) in men, 6 (27.2%) in women. With an average age of 35.2 years, with the lowest case in a 14-year-old child and the highest at 72 years. All from rural and endemic areas. A total of 11 (50%) with fieldwork and the rest due to various injuries. The etiological agent was isolated in all of them: Coccidiodes posadasii in 16 (72.8%), C. immits in 3 and one by Coccidiodes sp. 20 cases were managed with itraconazole, with an average of 8 months and two more with a cycle of amphotericin B and subsequent itraconazole. Clinical and mycological cure was obtained in all.Discussion: Primary cutaneous coccidioidomycosis, is considered an implantation mycosis, similar to other endemic ones, it occurs between 2%-10% of cases. It begins after trauma that inoculates the fungus, such as a primary chancre. To confirm that it is a primary form, Wilson's criteria must be met: the presence of skin trauma, regional lymphadenopathy, no evidence of pulmonary involvement, positive intradermal reaction, and low antibody titers. It may present auto involution and in immunosuppressed patients, it can spread.ConclusionThe initial cutaneous form of coccidioidomycosis is rare, usually seen in patients living in endemic areas, and usually present in patients with rural occupations. It has a variety of clinical forms, being confused with many diseases. Its diagnosis is simple, being the biopsy the most used, and it must be confirmed by mycological tests. It has a good prognosis and its main management is with itraconazole.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S6.4c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S6.5b Genomics and metagenomics of Madurella mycetomatis

    • Abstract: Abstract S6.5 Efforts of improving the management of mycetoma: working towards the 2030 goals, September 22, 2022, 4:45 PM - 6:15 PMMycetoma is a debilitating disease recognized as a neglected tropical disease by the World Health Organization. The etiology of mycetoma is poorly understood; ∼ 60% of cases are caused by fungi and the rest are bacterial, although this varies by region. The pathogenic fungus, Madurella mycetomatis, is most frequently identified in mycetoma cases. Here, we present a high-quality genome assembly of M. mycetomatis and the results of the whole genome sequence analysis of 25 isolates from Sudan. We demonstrate evidence of at least seven genetically diverse lineages and extreme clonality among isolates within these lineages. Shotgun metagenomic analysis of DNA from mycetoma grains confirmed that M. mycetomatis was the predominant causative agent of eumycetoma Sudan; however, 10% of grains also contained bacterial reads suggestive of secondary infections. A thorough understanding of the genetic structure and diversity of fungi causing mycetoma is essential for the development of new diagnostic methods and for identifying potential drug targets.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S6.5b
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S6.5c MycetOS: identifying drugs which can penetrate the mycetoma grain

    • Abstract: Abstract S6.5 Efforts of improving the management of mycetoma: working towards the 2030 goals, September 22, 2022, 4:45 PM - 6:15 PMMycetoma is a neglected tropical disease characterized by large subcutaneous swellings and the formation of grains. Madurella mycetomatis is the most common causative agent. Currently, mycetoma is treated with a combination of itraconazole therapy and surgery with low success rates, resulting often in amputation and social sigma. To improve the current therapeutic success rates a novel drug is needed. Due to the lack of interest in the pharmaceutical industry, an open-source drug discovery program for mycetoma was established called MycetOS.In total 1360 compounds were screened for in vitro activity against M. mycetomatis, and many more are currently being screened. Compounds that were able to inhibit growth at 100 μm, 25 μm, and had an IC50 <8 μm were selected for studying the in vivo efficacy in an M. mycetomatis grain model in the invertebrate Galleria mellonella.Out of the 1360 compounds screened against M. mycetomatis, 302 were able to inhibit growth at 100 μm, and 23 of those met all criteria to be screened in vivo. Of these 23, nine did prolong larval survival. These included 3/7 azoles tested, olorofim, fenbendazole, MMV006357, MMV022478, MMV675968, and MMV1782387. Based on these results, 6 compound series were selected for further studying, these included the fenarimols (series 1), the aminothiazoles (series 2), the phenotiazines (series 3), dihydrofolate reductase inhibitors (series 4), benzimidazoles (series 5) and the ketoximines (series 6). For series 1 in total 185 additional compounds were screened. By analyzing the in vitro activity and in vivo efficacy in relation to the chemical properties of the molecules it appears that the LogD value of a compound was important for penetrating into the mycetoma grain.In conclusion, using an open source drug discovery approach for mycetoma we were able to identify novel lead compounds. Some of these compounds were highly active against M. mycetomatis only (fenarimols, aminothiazoles, phenotiazines, and ketoximines), while other compounds such as the benzimidazoles also were active against other causative agents as well. Screening more analogs of identified compounds allowed us also to identify chemical properties which are favorable for grain penetration in vivo. This will allow us to chemically design more active compounds for this difficult to treat infection.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S6.5c
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S6.5d Molecular identification of mycetoma causative agents from patients
           in ahospital setting in Senegal

    • Abstract: Abstract S6.5 Efforts of improving the management of mycetoma: working towards the 2030 goals, September 22, 2022, 4:45 PM - 6:15 PMBackground: Mycetoma is a chronic granulomatous inflammatory disease that is caused either by bacteria or fungi. The diagnosis of species is important to guide the therapeutic management of patients particularly for white and yellow grains. However, the identification of the causative agents using mycological and histological techniques is a real problem in our countries. This study aims to identify etiologic agents using molecular techniques in Senegal.MethodsA prospective study was carried out to compare mycological and histological techniques with molecular methods in patients attending hospital settings. Biopsy specimens and/or grains obtained from these patients were examined by PCR targeting the ITS (fungal agents) and 16S (actinomycosis agents) genes. Sequencing with the SANGER method allowed us to identify the species.ResultsPreliminary results were obtained from 30 patients. The grains collected were black (38%), red (4.7%), white (47.6%), and yellow (9.5%). Discriminative PCR ITS vs 16S identified 5 actinomycosis agents including white and yellow grains and 1 fungal agent. The fungal agent was identified after sequencing as Microsporum langeronii.ConclusionThe preliminary results of this study show the importance of discriminative PCR to guide the therapeutic choice of clinicians. Its widespread use could improve the detection and management of mycetoma cases in Senegal.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S6.5d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S7.1d Reliability of bedside point-of-care tests for Candida neoformans ,
           M. tuberculosis and S. pneumoniae in adults living with HIV presenting
           with suspected central nervous system infection (CNS) in low- and
           middle-income settings: Preliminary results from the DREAMM study

    • Abstract: Abstract S7.1 Update in management of fungal infection in adult hematology, September 23, 2022, 10:30 AM - 12:00 PMBackground: Bedside point-of-care (POC) testing, with parallel laboratory testing, represents a unique opportunity to improve and speed up the diagnostic workup of people living with HIV with suspected CNS infection in resource-limited settings.ObjectivesTo assess the agreement between POC tests for Cryptococcus neoformans, Mycobacterium tuberculosis, and Streptococcus pneumoniae performed at the bedside and in the routine laboratory, in African low- and middle-income countries (LMICs).MethodsFrom January 2018 to March 2021, the following POC tests were performed in parallel at the bedside and in the routine laboratory: Cryptococcal antigen lateral flow assay (CrAg LFA, Immy) in blood and cerebrospinal fluid (CSF), tuberculosis lipoarabinomannan (TB-LAM, Alere) in urine, and, where indicated, pneumococcal antigen (Streptococcus pneumoniae (SP), Biosynex) in CSF.Participants: HIV-infected adults (>18 years old) suspected of CNS infection.Setting: The prospective multicenter DREAMM project (Driving Reduced AIDS Meningo-Encephalitis Mortality) in five hospital sites in Cameroon, Malawi, and Tanzania.Primary outcome: Cohen's kappa statistic of agreement between the results of POC tests obtained at the bedside and the routine laboratory.ResultsThe study included 356 consecutive participants (mean age 39.5 +/- 10 years; 68.7% ART-experienced; 46.3% male; median CD4 count 75/mm3; abnormal mental status 75%). In total, 148/355 (41.7%) participants had positive bedside CrAg in blood, 140/315 (44.4%) positive bedside CrAg in CSF, 64/339 (18.9%) positive bedside TB-LAM in urine, and 10/175 (5.7%) positive bedside SP in CSF. Kappa statistics evaluating agreement between bedside and laboratory test results were: 0.98 [95% confidence interval (CI) 0.96-1.00; n = 347] for blood CrAg, 0.99 (95%CI, 0.98-1.00; n = 307) for CSF CrAg, 0.92 (95% CI, 0.87-0.98; n = 330) for urinary TB-LAM, and 0.68 (95%CI, 0.40-0.96; n = 34) for CSF SP.Conclusions: Bedside POC tests for Cryptococcus spp. are highly reliable and can be safely performed in parallel to laboratory testing to expedite targeted treatment in people living with HIV with suspected CNS infection in African LMICs. Other bedside POC tests need further evaluation before large-scale implementation.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S7.1d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • S7.2d Divergent EGFR/MAPK-mediated immune responses to clinical Candida
           pathogens in vulvovaginal candidiasis

    • Abstract: Abstract S7.2 More than just candidemia: clinical aspects, diagnosis and treatment, and pathogenesis of deep-seated candidiasis, September 23, 2022, 10:30 AM - 12:00 PMObjectivesVulvovaginal candidiasis (VVC) is characterized by symptomatic inflammatory responses in the vagina caused by Candida albicans and non-albicans Candida (NAC) species. The epidermal growth factor receptor (EGFR) -mitogen-activated protein kinase (MAPK) signaling pathway has been linked to immune responses of oral epithelial cells upon C. albicans exposure, but whether this pathway plays a similar response in vaginal epithelial cells is not determined.MethodsThe activation of EGFR and MAPK signaling pathways in vaginal epithelial cells infected with C. albicans was determined by RNA sequencing and Western blot. The relationship between EGFR and MAPK signaling was verified via inhibition of EGFR and construction of EGFR-overexpressing cells. Enzyme-linked immunosorbent assay (ELISA) and Real Time Cellular Analysis (RTCA) techniques were used to detect the effect of EGFR-MAPK signaling pathway on regulating the secretion of inflammatory cytokines and cell damage induced by C. albicans. The mouse model of VVC infected by C. albicans was constructed, and the role of EGFR signaling pathway in regulating fungal burden, vaginal inflammation, and epithelial damage was determined by Periodic Acid-Schiff stain and immunofluorescence.ResultsWe observed that phosphorylation of EGFR and p38 was continuously activated in vaginal epithelial cells by C. albicans strain SC5314. The response is not in a biphasic manner that is critical for oral epithelial cells to discriminate the morphology of C. albicans. When compared with SC5314, a highly azole-resistant C. albicans isolate 1052 can induce a stronger phosphorylated signal of EGFR and p38, while clinically-isolated NAC strains including C. tropicalis, C. glabrata, C. parapsilosis, and C. auris triggered higher levels of phosphorylated ERK1/2 and c-Fos than C. albicans. Consistently, inhibition of EGFR significantly reduced inflammatory response and epithelial damage induced by C. albicans in vitro and in vivo, while inhibition of p38 led to great loss of epithelial damage triggered by both C. albicans and NAC species.ConclusionThese results confirm the importance of the EGFR-MAPK signaling in VVC pathogenesis and highlight the remarkable immunogenic differences between C. albicans and NAC species in host-microbe interactions.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.S7.2d
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P009 Investigation of in vitro antifungal susceptibility testing and
           genetic diversity of clinical isolates of Trichophyton benhamiae and
           Trichophyton eriotrephon in Iran

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMBackgroundTrichophyton benhamiae is a zoophilic dermatophyte, known as one of the causative agents of dermatophytosis.ObjectivesThe purpose of this study was to explore the genotypes of T. benhamiae strains isolated from geographically different areas of Iran and also to evaluate in vitro antifungal susceptibility profile of these strains against seven antifungal drugs.MethodsA total of 22 strains of T. benhamiae and 2 strains of T. eriotrephon were isolated from patients with distinct types of dermatophytosis. DNA extraction and amplification of rDNA regions using ITS1 and ITS4 primers were conducted on the isolates. The in vitro antifungal susceptibility of posaconazole (PSC), voriconazole (VRC), itraconazole (ITC), ketoconazole (KET), caspofungin (CAS), terbinafine (TRB) and griseofulvin (GRZ) was evaluated according to CLSI M38-A2 protocol.ResultsThe multiple alignments of the ITS-rDNA sequences of T. benhamiae indicated a mean similarity of 99.5%, with 0-3 interspecies nucleotide differences. The geometric mean (GM) values of minimum inhibitory concentrations (MICs) and minimum effective concentrations (MECs) across the all isolates were respectively: TRB: 0.025 mg/l, PSC: 0.032 mg/l, ITC: 0.050 mg/l, and VRC: 0.059 mg/l with lower values and CAS: 0.31 mg/l, KTZ: 0.56 mg/l, and GRZ: 0.76 mg/l with higher values.ConclusionDiverse ITS sequence types of T. benhamiae were shown in different geographical regions of Iran. The TRB, PSC, and ITC were the most effective drugs against T. benhamiae strains, respectively. Furthermore, in our study, two strains of T. eriotrephon as a scarce dermatophyte species were described.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P009
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P043 Amphotericin B in pediatrics: analysis by age stratification suggests
           a greater chance of adverse events from 13-month of age onward

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMBackgroundDeoxycholate amphotericin B (D-AMB) remains an antifungal of great therapeutic value in pediatrics. It is generally accepted that its use in neonates is safer than in older children. However, childhood presents different periods of development which deserves to be evaluated more precisely. Our goal was to assess the usage profile of D-AMB in stratified pediatric age groups, adapted according to the National Institute of Child Health and Human Development (NICHD) classification.MethodsWe conducted a retrospective cross-sectional observational study at a Brazilian tertiary children's hospital. Nonparametric tests were applied, such as the chi-square test to compare proportions and Fisher's exact test to assess the association between categorical variables or in contingency tables.ResultsA total of 127 medical records were stratified as preterm neonatal (birth <37 weeks postmenstrual age), term neonatal (birth 27 days), infants (28 days-12 months), toddler (13 months-2 years), early childhood (3-5 years), middle childhood (6-11 years) and early adolescence (12-18 years). Very few acute infusion-related side effects were observed during administration of D-AMB in pediatrics. We found an unfavorable impact of D-AMB from 13 months onward, suggesting this group as a turning point for a greater chance of adverse events, and not soon after the neonatal period as is conventionally known (Fig. 1).ConclusionsClinical or observational studies based on age stratification are essential to precisely elucidate whether drugs with toxicity potential can be used safely in the pediatric population. Searching for a turning point has been shown to contribute to the accuracy of the study, while providing more substantial information on the impact of D-AMB on different pediatric age groups.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P043
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P055 Antifungal resistance of clinical Candida albicans isolates in Iran:
           asystematic review and meta-analysis

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectiveAntifungal susceptibility patterns of Candida infections can play an essential and decisive role in the treatment outcome. The present systematic review and meta-analysis aimed to investigate the drug susceptibility pattern of Iranian clinical Candida albicans isolates to antifungal drugs (azoles, polyenes, and echinocandins).MethodSix electronic databases including ‘PubMed,’ ‘Scopus,’ ‘Web of Science,’ ‘IranDoc’, ‘SID’, ‘Magiran’ were searched from May 2000 to June 2021.ResultsThe susceptibility of 6322 C. albicans strains from 19 967 patients against 14 antifungal drugs was evaluated according to Clinical and Laboratory Standards Institute (CLSI) methods. The pooled prevalence of antifungal resistance ranged from 0 to 26%. The lowest resistance levels among azoles were observed in luliconazole with a frequency of 0% and voriconazole of 3.94% [95% confidence interval (CI), 2.24%-6.09%]. An increase in trend of itraconazole (7%-16.65%), voriconazole (1.4%-6.52%), and amphotericin B resistance (7.5%-9.11%) among C. albicans strains since 2006 in Iran, while a decreasing trend was observed in fluconazole resistance (23.42%-14.42%).ConclusionDue to the resistance of C. albicans species to common antifungal drugs, antifungal stewardship strategy combining therapeutic drug monitoring to reduce the emergence of resistant multi-drug Candida species.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P055
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P056 Oral Ibrexafungerp outcomes by fungal disease in patients from an
           interim analysis of a Phase 3 Open-label Study (FURI)

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMBackgroundThere are limited oral treatment options for patients with fungal infections who fail currently available antifungals or have an infection caused by resistant organisms. Ibrexafungerp is an investigational broad-spectrum glucan synthase inhibitor with activity against Candida and Aspergillus species, including azole- and echinocandin-resistant strains. A Phase 3 open-label, single-arm study of ibrexafungerp (FURI; NCT03059992) is ongoing for the treatment of patients intolerant of, or with fungal disease refractory to, standard antifungal therapy. We present an interim analysis of patient outcomes from the FURI study by fungal disease type.MethodsFURI patients are eligible for enrollment if they have proven or probable: severe mucocutaneous candidiasis, invasive candidiasis, chronic or invasive aspergillosis, with documented evidence of failure, intolerance, or toxicity related to a currently approved standard-of-care antifungal treatment; or patients who cannot receive approved oral antifungal options (e.g., due to susceptibility), and continued IV antifungal therapy is clinically undesirable or unfeasible.ResultsAn independent Data Review Committee (DRC) provided an assessment of treatment response for 113 enrolled patients in the FURI study from 27 centers in US, UK, and EU treated with ibrexafungerp for mucocutaneous or invasive fungal infections from 2016-2021. A total of 56 patients (49.5%) had invasive candidiasis/candidemia, 32 (28.3%) had mucocutaneous candidiasis, 14 (12.4%) had vulvovaginal candidiasis (VVC), and 11 (9.7%) patients had aspergillosis.Upon DRC review, the percentage of patients with complete or partial response, or for VVC, clinical improvement (defined as vulvovaginal signs and symptoms score ≤ 1) was 58.4%; stable disease was 23.9%; and 11.5% had disease progression (including 2 VVC patients not meeting the criteria for clinical improvement). There was one death due to underlying causes, and six outcomes were indeterminate. Table 1 shows outcomes by disease type.ConclusionsAnalysis of 113 patients from the FURI study indicates that oral ibrexafungerp provides a favorable therapeutic response in patients with challenging fungal disease and limited treatment options.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P056
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P110 AIRE gene mutation predisposing chronic mucocutaneous Candidiasis in
           two kids from a Chinese family

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMObjectivesChronic mucocutaneous candidiasis (CMC) is a group of clinical syndromes characterized by chronic recurrent skin, nails, and mucosal superficial Candida infections. Various gene mutations have been reported to predispose individuals to CMC and its related syndrome. This study aims to study the clinical features and the genetic background underlying two kids of CMC from a Chinese family.MethodsClinical and laboratory findings of the two patients were studied, including physical examination, direct microscopic examination, and fungal culture. Genomic DNA of all family members was extracted from peripheral blood leukocytes, and whole-exome sequencing (WES) was performed.ResultsA 2-year-old boy and his sister were admitted to the hospital due to recurrent thrush and thickening of their nails. Direct microscopic examination of their nails and the brother's tongue showed branched pseudohyphae and yeast cells, and Candida albicans was identified through fungal culture. The brother also experienced a progressively impaired vision, which was diagnosed as retinitis pigmentosa, causing no light perception in one eye and light perception up to 0.1 in the other. Their parents belonged to the Hui population (a minority population in China) and had a history of consanguineous marriage. Chronic mucocutaneous candidiasis (CMC) was diagnosed, and oral fluconazole was prescribed. After continuous fluconazole treatment for 6 months, the nails and the tongue became normal. These patients are still under follow-up.Due to the recurrent Candida infections and history of consanguineous marriage, genetic susceptibility was suspected. When we compared the WES data with all genes reported to be related to CMC, a homozygous mutation in the AIRE gene was noted (C. 769 C >T, p. Arg257Ter) in both patients. The parents were heterozygous carriers of the variant.ConclusionIn this study, we identified two CMC patients of Chinese harboring AIRE mutations. These patients remind us the importance of genetic analysis in management of CMC, which then help to adjust the time of treatment, as well as to predict and early detect related complications.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P110
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P111 A case of nail discoloration due to topical treatment of
           onychomycosis with luliconazole 5% nail solution

    • Abstract: Abstract Poster session 1, September 21, 2022, 12:30 PM - 1:30 PMWe use efinaconazole 10% topical solution and luliconazole 5% nail solution for topical treatment of onychomycosis in Japan. We show a case of onychomycosis treated with nail debridement and topical luliconazole 5% nail solution to the nail and topical luliconazole 1% cream to the foot.A woman in her seventies with chronic urticaria had a nail spike color change on her left big toe (Fig. 1).We opened the spike lesions with a plastic nipper and KOH direct microscopic examination showed dermatophytoma. We treated with topical luliconazole cream on the toes and soles of the foot and 5% solution on the nail. Because of the summer season, she walked outside in sandals without socks during treatment and noticed the nail yellow color change (Fig. 2). We advised the patient to protect from sun light and not to walk outside without socks. Due to the report from the production company, the reason for nail color change to yellowish is photodegradation of luliconazole. After 1 year since first visit, the fungal infection of the big toe disappeared by our topical treatment. The nail yellow color change also disappeared. We recommended avoiding sunlight exposure on the treated nail during topical treatment of luliconazole 5% nail solution.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P111
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P155 A Mexican case series of COVID-19 - associated pulmonary
           aspergillosis

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMThe pandemic coronavirus disease 2019 (COVID-19) has been in the scope for invasive pulmonary aspergillosis (IPA) after the first reports worldwide, now known as CAPA.Objectiveto describe a case series of CAPA documented in four intensive care units while treating patients with severe COVID-19 pneumonia in order to describe clinical characteristics, cultures result and MICs from Aspergillus isolations, and treatments.MethodsA prospective and descriptive study was performed from March 2020 to February 2022 in four tertiary level hospitals that treated COVID-19 patients in Mexico. We followed every single culture coming from the COVID-19 ICU, Aspergillus positive cultures had morphologic identification, and the MICs were obtained by broth microdilution. We did not interfere in the treatment.ResultsDuring 24 months of follow-up of patients with severe COVID-19 we found 17 adult cases with a mold identification, from those, 14 patients fit in the possible CAPA definition according to ECMM/ISHAM, and the remaining 3 were treated after expert opinion. The baseline characteristics of overall 47% had diabetes, and 41% were obese. Of the 14 cases included as a possible CAPA all of them had acute severe respiratory syndrome (average PaO2/FiO2 134 mmHg), 64% were in prone position, 78% had steroids at ICU admission, 92% had antibiotics at ICU. The computed tomography pattern predominantly associated were pulmonary infiltrates, nodules and cavitation. Only 2 patients (14%) had a positive galactomannan (>4.5) from non-bronchoscopic lavage. We had 9 Aspergillus fumigatus isolations and 4 A. niger, 1 A. flavus, 6 patients received voriconazole, 3 patients received isavuconazole, 1 anidulafungin and liposomal amphotericin B were used in 1 patient each respectively. The predominant MIC from isolations were ≥64 μg/ml for fluconazole, and <0.5 μg/ml for voriconazole, also all of them had MIC equal or <0.75 μg/ml for isavuconazole and 0.015 μg/ml for anidulafungin. A total of 50% of the patients had a CAPA-related death.ConclusionsCAPA is still a difficult entity to think of for diagnosis and treatment in severely ill COVID-19 patients. What predominates like other series were obesity, use of steroids, and ARDS. The contribution of small Mexican series like ours (based on the new guidelines) will allow to understand that CAPA could be no longer a rare fungal infectious disease complication in severely ill COVID-19 patients. An extended consensus must be made for those possible CAPA definition cases.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P155
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P156 Oral Candidiasis among inpatients with COVID‐19 in the North of
           Iran

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesWe aimed to characterize oral candidiasis epidemiology, species distribution, and antifungal susceptibility profiles among COVID-19 patients.MethodsThis observational cross-sectional study enrolled patients ˃18 years old with confirmed oral candidiasis admitted at Razi teaching hospital (a reference infectious disease center in Mazandaran Province). Oral samples from patients with suspected oral candidiasis infection were collected and were confirmed for oral candidiasis by microscopic examination and fungal culture. Fungal isolates were identified using Multiplex polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism. In vitro susceptibility testing for amphotericin B, fluconazole, voriconazole, and micafungin of all identified isolates was performed using broth microdilution according to the Clinical and Laboratory Standards Institute (CLSI) broth microdilution guideline (M27-A3 and M60) standard.ResultsAmong 4133 COVID-19 admitted patients during a year in Razi hospital, 120 patients had confirmed oral candidiasis. Totally 172 Candida isolates causing oral candidiasis isolated from these patients were identified. Most patients were infected with a single Candida species; however, it is notable that mixed Candida species caused oral candidiasis in 46 patients. Candida albicans (60.46%) was the most common species. Among non-albicans Candida species, C. glabrata (17.44%) was the most isolates, followed by C. tropicalis (11.62%), C. kefyr (7.55%), and C. krusei (2.9%). Although non-albicans Candida species, including C. glabrata and C. krusei demonstrated high minimum inhibitory concentration (MIC) against azole drugs, in terms of MIC90 values, all tested drugs exhibited superior activity against C. albicans. In terms of MIC Geometric mean, amphotericin B and micafungin were more potent than all comparator drugs.ConclusionsOur study described the high incidence of oral candidiasis caused by non-albicans Candida species in COVID-19 patients; most of them, including C. glabrata and C. krusei exhibits intrinsic decreased susceptibility to the azole class of antifungals. Further studies should design an appropriate prophylaxis program to prevent oral candidiasis in COVID-19 patients.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P156
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P161 Epidemiological trends of Candida species in urine culture— a
           retrospective study in a tertiary care hospital in Punjab

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesThe presence of Candida species in the urine (Candiduria) is a typical clinical observation, especially in hospitalized patients. It is more common in immunocompromised persons, in bone marrow transplant unit (BMTU) patients, and in those who are in intensive care units (ICUs). Urinary tract infections (UTIs) can be caused by any Candida species. Now, non-albicans Candida species prevail in many locations around the world. Urinary tract instrumentation, past antibiotic usage, lengthy hospital stay, extremes of age, diabetes mellitus, female gender, and immunosuppressive medication are all risk factors for candiduria. Candiduria represents colonization in the majority of adult patients in critical care settings, and antifungal medication is not necessary. The presence of yeast in the urine, on the other hand, can indicate a widespread illness. Candiduria often indicates widespread candidiasis in severely unwell newborns and is followed by blocking fungus ball development in the urinary tract.MethodsA retrospective study was conducted at Christian Medical College and Hospital, Ludhiana from March 1, 2020 to March 31, 2022. The acquired urine samples were promptly processed in the microbiological laboratory using a semi-quantitative culture technique in accordance with normal protocols. All of the yeast isolates were processed further on Corn meal agar (CMA) for further speciation.ResultsOut of the 9729 urine samples received, there was culture growth for Candida species in 511 (5.25%) samples. Amongst the patients who had candiduria, 180 (35.22%) patients were immunocompromised. Out of 511 Candida isolates, 122 (23.87%) were Candida albicans and 389 (76.12%) were non-albicans Candida. Further speciation of non-albicans Candida indicated the prevalence of C. glabrata, C. tropicalis, C. krusei, C. parapsilosis, and C. guielliermondii as 98 (19.17%), 89 (17.41%), 78 (15.26%), 78 (15.26%) and 46 (9%) respectively.ConclusionThe most prevalent healthcare-associated infection is nosocomial UTI. Candida species is becoming a more common cause of nosocomial urinary tract infections. C. albicans was the most common species isolated from the urinary system for many years. Now, non-albicans Candida species have emerged as a result of the introduction and widespread usage of fluconazole. These non-albicans species may be more difficult to remove than C. albicans because they are more adapted to the kidney and collecting system. With controlling underlying diabetes, daily assessment of need of urinary catheterization, early removal of catheter, surgical removal of obstruction of urinary tract and timely de-escalation of antibiotics can prevent candiduria in most of the cases. Thus, we can avoid antifungal therapy which may contribute to the resistance.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P161
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P162 Parinaud's Oculoglandular Syndrome as an atypical manifestation of
           sporotrichosis in Brazil

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesInform the general practitioner about the possibilities of atypical manifestations secondary to sporotrichosis, such as ocular manifestations, unrelated to the classic finding of contiguous lymphocutaneous ulcers.MethodsThis is a single-center, cross-sectional, retrospective study with patients evaluated and seen from June 2018 to April 2022 at the Mycology Outpatient Clinic of Hospital Universitário Oswaldo Cruz, University of Pernambuco.All patients were evaluated by the same infectious disease physician throughout the course, from diagnosis to outpatient discharge.Scrapings and cultures were collected by the institution's specialized Mycology team. Biopsies were sent to the University Pathology Service (CIAP).ResultsDuring the 4-year period, 231 patients started their treatment for sporotrichosis following clinical, laboratory, and histopathological criteria. Of these, 9 (3,8%) had Parinaud's Oculoglandular Syndrome, unilateral granulomatous conjunctivitis associated with ipsilateral preauricular or submandibular lymphadenitis (Fig. 1). Of the 9 reported cases, 8 presented manifestations only in the conjunctiva (88%), and 1 case also presented palpebral involvement (12%).Since most patients had a late diagnosis due to the difficulty in carrying out the specific investigation of the agent by a non-specialized team, the diagnosis by scraping and culture was compromised by early treatment with antifungals, especially itraconazole. It is becoming common in the Northeast of Brazil that the association of sick cats with typical manifestations of sporotrichosis is the main epidemiological factor since our case series for infections caused by soil manipulation is low. Therefore, 55% (5/9) had a clinical-epidemiological diagnosis of sporotrichosis, with an excellent clinical response to itraconazole 200 mg/day, as well as the 4 patients with diagnoses confirmed by culture (Fig. 2). The antifungal was taken after lunch since a fatty diet interferes with improved medication absorption. All patients were instructed not to use medications with known interactions, especially proton pump inhibitors and alcohol use.ConclusionHuman sporotrichosis has become endemic in Latin America in the last two decades, bringing relevant morbidity to those infected. Zoonotic transmission by direct contact with infected sick cats has been gaining ground in Northeast Brazil, creating important epidemiology when typical sporotrichosis lesions appear following contact with these animals. Lymphocutaneous sporotrichosis is known to be the most common manifestation, but there is a need for care teams working in primary and secondary care to identify atypical manifestations and expand the investigation into the possibility of fungal infections. The epidemiology of the neighborhood associated with the presence and contact with sick cats with ulcerative lesions must be considered and taken into account.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P162
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P163 Successful management of COVID-19-associated mucormycosis in state of
           pernambuco, northestearn brazil: 2 case reports

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesDuring the COVID-19 pandemic, several cases of mucormycosis related to SARS-CoV-2 were reported. This association is still poorly studied due to its recent emergence and makes diagnosis and treatment challenging. Usually, patients who are affected by this infection are immunocompromised by corticosteroid treatment and uncontrolled diabetes mellitus, being mucormycosis a life-threatening opportunistic invasive fungal infection caused by mucoromycetes, which reaches a mortality rate of about 50%, even with treatment. Thus, this association requires as much information as possible about the pathogenesis and treatment.MethodsHere, we report two cases with conclusive diagnosis and positive evolution to mucormycosis associated with COVID-19 after corticosteroid therapy.ResultsThe first case was a 68-year-old woman, hypertensive and diabetic, who was affected by SARS-CoV-2, with intense ocular pain and paralysis of extrinsic ocular muscles of the right eye and eyelid. The patient underwent CT scan of the sinuses with contrast, which showed signs on maxillary. The patient was submitted to sinusectomy with orbital decompression and the material from the surgery was sent for fungal investigation, which 20% KOH direct exam showed hyaline, sparsely-septate, broad, ribbon-like hyphae with irregular right-angle branching. Rhizopus oryzae was isolated on Sabouraud agar. Mucormycosis was diagnosed in the facial sinuses, and resolution of infection was obtained with liposomal amphotericin B. The second case was a 59-year-old woman, obesity degree 3, asthmatic and history of COVID-19, with history of abscesses in oral mucosa and palate, with drainage of brown secretion after 30 days of COVID-19 resolution. After medical discharge, the patient was evaluated by an oral and maxillofacial surgeon to solve an esthetic problem, when the material was collected for biopsy of the mucosal lesions. Histopathological exam showed aseptic thick mycelial filaments presenting right angle bifurcation, suggestive of Mucorales (mucormycosis). The patient was readmitted to the hospital for mucormycosis treatment based on isavuconazole (200 mg, q8 as attack dose on Day 1 and 2, and 3 toward q24), and treatment evolved positively with no need for surgical intervention. We conclude that the extensive use of steroids associated with diabetes is the main factor for the appearance of mucormycosis after COVID-19, but with a conclusive diagnosis and correct treatment, this infection can have a good evolution, resulting in an improvement in the patient's clinical condition, reducing the risk of death for this infection.ConclusionIsavuconazole appears to be a drug with a safe profile and with curative potential for mucormycosis. The possibility of oral use from the third day at its maintenance dose (200 mg/day) with intravenous use in the first 48 h at a dose of 200 mg every 8 h. Diabetic patients are more prone to infection, but patients infected with SARS CoV 2 using corticosteroids have shown to be a risk group for this fungus.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P163
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P164 Sporotrichosis as an emerging disease in osteomyelitis

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesInform the general practitioner and orthopedists of the possibilities of bone infections secondary to sporotrichosis unrelated to the classic finding of contiguous lymphocutaneous ulcersMethodsThis is a single-center, cross-sectional, retrospective study with patients evaluated and seen from June 2018 to April 2022 at the Mycology Outpatient Clinic of Hospital Universitário Oswaldo Cruz, University of Pernambuco.All patients were evaluated by the same infectious disease physician throughout the course, from diagnosis to outpatient discharge.Scrapings and cultures were collected by the institution's specialized Mycology team. Biopsies were sent to the University Pathology Service (CIAP)ResultsSporotrichosis is a progressively growing endemic disease in the Northeast region of Brazil. The two main forms of contagion have been through feline scratches (all cases in this study) or through contact with contaminated soil. Infections may be restricted to just one bone (contiguous infection) or may affect several without the need for contiguity (hematogenous spread). Reviewing the literature (Pubmed), only 25 cases were described in the literature in the most diverse countries and with different treatments, the vast majority evolving with amputation of the affected bone. Current guidelines do not propose a specific treatment for osteomyelitis, restricting themselves to evaluating case by case and without proposals for treatment completion.During the 4-year period, 231 patients started their treatment for sporotrichosis following clinical, laboratory, and histopathological criteria. Of these, 12 had osteomyelitis (5.2%), and 3 have more than one bone affected.Biopsy (1) and cultures (6) were the most used methods for diagnosis. The remaining cases (5) were diagnosed by scraping the sick cat and visualization of spores suggestive of sporotrichosis or by epidemiological data involving a cat with lesions suggestive of scratching the affected patient.We used amphotericin B lipid complex 5 mg/kg/day for 4 weeks as induction treatment and itraconazole for maintenance at a dose of 400 mg/day. If the patient did not tolerate it or presented side effects, the dose was reduced to 200 mg/day. For patients with more than one bone affected, we performed control with FDG PET SCAN to define cure (SUV ≤5.0).Interestingly, all patients had no reaction to the tuberculin skin test (Mantoux), suggesting a deficiency in the Th1 response, but we do not know whether this was the cause or consequence of the invasive fungal infection.ConclusionSporotrichosis osteomyelitis may be much more common than reported in the literature. Sporotrix braziliensis may have a higher bone tropism compared to other species. This is the largest series described in the literature of a single-center reporting 12 cases and the only one with no amputation of the affected bones. Treatment with lipid complex amphotericin (Abelcet) for 4 weeks added to the prolonged use of itraconazole for 6-12 months may have impacted the result since this amphotericin formulation is described in the literature as having greater bone penetration than the others.Nuclear medicine (FDG PET SCAN and Gallio CTG) has a key role in diagnosis and definition of cure.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P164
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P222 Epidemiology of Candida emia at level-1 trauma care cent er in North
           India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivePatients affected by trauma who get admitted to critical care units experience prolonged hospitalization and thereby acquire several infections. This retrospective observational study was done from 2014 to 2021 to observe Candidaemia affecting this population. A total of 4816 patients admitted with traumatic injuries and hospitalized for treatment at ICU in our 190 bedded Level-1 Trauma center underwent this study.MethodsPaired blood samples were collected from patients showing signs of sepsis and incubated and monitored regularly by the BacT/ALERT system (bioMe´rieux InC., Marcy l'Etoile, France). All the positive signal samples exhibiting budding yeast cells on Gram stain were subcultured on Chrome agar and Sabouraud dextrose agar. Pure growths obtained were subjected for identification and susceptibility by MALDI-TOF and VITEK 2 system.ResultsOut of the 4816 patients, 61 were affected by Candidaemia. Out of 61, the maximum was in the age group of 31-40 years (19.7%). Male preponderance (50/61, 82%) was exhibited compared to females. To ascertain Candidaemia, samples collected were blood (63/66, 95.5%) and CVP tip (3/66, 4.5%). Candidaemia was primarily observed in patients who suffered major orthopedic trauma (14/61, 21.2%). A total of 66 Candida species were isolated from samples of these patients. Out of these, Candida tropicalis (43.9%) was the most common, followed by C. parapsilosis (22.7%), C. albicans (21.2%), C. haemulonii (4.5%), C. glabrata (3%), C. rugosa (3%), and C. guilliermondii (1.5%). Concerning antifungal resistance, fluconazole resistance was 16.6% (11), flucytosine 1.5% (1), amphotericin B 6% (4), and micafungin 3% (2). Voriconazole was resistant to none but intermediate to 12.1% (8), caspofungin was intermediate to 3% (2), and resistant to none. A total of 47% (31/61) of patients succumbed to their injuries which were observed highest in the age group of 61-70 years (8/61, 25.8%). The most common injuries that the deceased suffered were polytrauma (9/61, 29%) and blunt trauma abdomen (9/61, 29%). Maximum mortality was also observed in patients with Candidaemia due to Candida tropicalis (15/61, 48.3%).ConclusionCandidaemia is usually fatal. Mortality due to Candidaemia increases in patients with severe traumatic injuries and added risk factors such as extremes of age, immunocompromised state, and broad-spectrum antibiotics. When compared to a similar study done in our center from 2009 to 2012 (3 years) on Candidaemia in ICU patients, the incidence was lower in our study (12.6% per 1000 ICU admissions vs 14.9% per 1000 ICU admissions), but the mortality rate was higher (47% vs 43.3%). Therefore, a watchful eye on early signs of sepsis, strict hospital infection control measures and antimicrobial stewardship may alter their outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P222
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P223 First case of Candida auris candidemia in Manipur, Northeast India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectiveCandida auris is known as an emerging ‘superbug’ because of its intrinsic resistance to one or more, sometimes to all available antifungal drugs and spreading globally. It has the ability to cause devastating nosocomial infections. In India, C. auris infection is on the rise with reports from north, south, central and eastern India. Here we present the first case of C. auris fungemia from a tertiary care hospital of Manipur in Northeast India.MethodsA 15-year-old Muslim girl was referred from a private hospital to Regional Institute of Medical Sciences (RIMS) hospital on November 19, 2021 with a history of burning epigastrium, headache, loss of appetite, shortness of breath, dry cough, fever, and generalized weakness for last 3 days. At the time of admission she was cyanotic. Family gave history of congenital heart disease and frequent visits to hospital. Echocardiogram revealed congenital cyanotic heart disease (Tetralogy of Fallot) showing large perimembranous VSD with bidirectional shunt. A complete hemogram showed neutrophilic leukocytosis with shift to left with band form, absolute monocytosis, and increased RBC count with mild anisocytosis. On November 24, 2021, 5 days after admission, her condition deteriorated and she was shifted to ICU. However, the condition of the patient deteriorated and she died on November 29, 2021 due to acute decompensated heart failure. Follow-up of other patients admitted in the same ward revealed no candidemia in next the few weeks.ResultsA single blood culture sent on November 29, 2021 was incubated in an automated blood culture system, BacT Alert and showed growth of budding yeast cells. Growth in SDA revealed it to be Candida sps. and Gram-stained smear examination revealed presence of budding yeast cells but no pseudohyphae. Germ tube test was negative. On CHROM agar, it produces pale yellow colonies at 24 h which progresses to light purple colonies around the rim at 48 h. Further processing in VITEK 2 (Biomerieux) identified it as C. auris. The isolate was sent to National Culture Collection of Pathogenic Fungi, WHO collaborating center, PGIMER and the isolate was confirmed as Candida auris by MALDI-TOF assay.ConclusionCandida auris is spreading irrespective of the level of health care. Blood culture before administration of antibiotics and in febrile sick patients cannot be underestimated. Rapid and accurate identification methods for timely diagnosis and stringent infection control measures with an emphasis on hand hygiene are important to prevent and control C. auris outbreaks.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P223
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P224 A challenging case of pyrexia of unknown origin of adrenal mass

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMA familiar dictum in tropical countries is to consider the diagnosis of tuberculosis (TB) in a patient with fever of unknown origin until proven otherwise. Often, in resource-limited settings, a response to a trial of empiric anti-tuberculous therapy (ATT) is needed to prove TB. However, chronic granulomatous diseases such as invasive fungal infections and sarcoidosis have clinical features resembling extrapulmonary TB. Thus, the workup for a definitive diagnosis is necessary.A 53-year-old male presented with low grade, intermittent fever, loss of weight and appetite for a duration of 4 months and generalized abdominal pain for the last 2 months. He has lost about 16 kg in the past 6 months. He also reported a mild cough with scanty white mucoid sputum. There was no contact with a case of TB. He developed small oval/circular copper Color patchy lesions in the trunk for the last 1 month (Fig. 1). The general examination of the patient was grossly normal except for hepatomegaly. Routine blood examination, renal and liver function test, and chest X-ray were normal and HIV ELISA was non-reactive.With the strong suspicion of TB, the patient underwent CT scanning of the chest and abdomen was done which showed bilateral heterogeneous adrenal mass with few hypodense areas within measuring right side 3.1 × 1.8 cm and left side 3.1 × 2.5 cm in suprarenal location and liver is enlarged size 19.3 cm with normal attenuation (Fig. 2). There were no clinical features to suggest pheochromocytoma or Cushing's syndrome. The PET-CT revealed metabolically active disease involving bilateral adrenal gland, abdominal and retrosternal lymph node with diffuse hepatomegaly. Transabdominal ultrasound-guided FNA was done from adrenal lesions. The tests for tuberculosis were negative and the cytology reported necrotizing granuloma with intracytoplasmic yeast cells suggestive of histoplasmosis. The adrenal endocrine profile was normal. From skin lesions, a biopsy was done. Direct KOH from skin lesion revealed budding yeast cells while the cultures are awaited. The patient was treated with 3 mg/kg liposomal amphotericin B for 2 weeks followed by daily itraconazole for maintenance. The fever was resolved after 8 days of liposomal amphotericin B and skin lesions softened after 3 weeks of therapy.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P224
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P225 Subcutaneous phaeohyphomycosis by Phaeoacremonium species in a renal
           transplant recipient

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivePhaeohyphomycosis refers to infections due to a large group of heterogenous organisms called ‘dematiaceous’ or ‘melanized’ fungi. The infection exhibits a wide spectrum of presentations such as deep local infections, pulmonary infection, cerebral infection, and disseminated disease, which are associated with high mortality. The incidence of phaeohyphomycosis among solid organ transplant recipients is 0.7%. Hereby, we report a case of phaeohyphomycosis in a post renal transplant patient who presented with a subcutaneous swelling over the right elbow region.MethodA detailed history was obtained from the patient after informed consent. The cystic fluid was subjected to microbiological including bacterial (Gram stain, culture on blood agar incubated at 37°C) and fungal investigations [Calcofluor potassium hydroxide (KOH) mount, culture on Sabouraud dextrose agar (SDA) incubated at 37°C and 25°C and brain heart infusion agar (BHI) incubated at 25°C]. The identification of isolate was done phenotypically by preparing lactophenol cotton blue (LCB) mount from slide culture and molecular technique using Sanger's sequencing.ResultA 61-year-old diabetic and post renal transplant (7 years) male presented with complaints of swelling over the right elbow region for 5 months duration. Swelling was insidious in onset, gradually progressive, painless, cystic, non-pulsatile, non-reducible, ∼9 × 7 cm in size, lobular in shape with irregular surface having normal overlying skin which minimally restricting the movement of the elbow. There was no history of trauma over the elbow region. Reddish purulent pus was received for mycological investigation. Calcofluor KOH mount demonstrated septate hyphae. Culture on SDA incubated at 37°C and 25°C grew cream-colored colonies, turning grayish beige to olive-brown and developed clusters of aerial hyphae with reverse tan to brown in color after 2 weeks of incubation. LCB mount showed hyaline to brownish hyphae, cylindrical phialides growing along the hyphae with slightly tapering towards the apex, hyaline, oblong, conidia, gathering in clusters at end of phialide. Phenotypically, the fungus was identified as Phaeoacremonium species and molecular identification and antifungal susceptibility are awaited. Patient was advised for surgical excision but he left against medical advice. Currently, he is not receiving any antifungals.ConclusionPhaeohyphomycosis is a rare and unique entity among fungal infections. Cutaneous phaeohyphomycosis predominantly occurs on the extremities with a localized solitary nodule or abscess. A high index of suspicion and the surgical approach including excision or debridement are mainly chosen.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P225
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P284 A rare case of post covid bilateral renal mucormycosis

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjective: The most commonly reported sites of COVID-associated invasive mucormycosis till now have been rhino-cerebral-orbital followed by pulmonary. This is a rare instance where an apparently healthy male, who had recovered completely from COVID-19, presented with fulminant isolated bilateral renal mucormycosis.Method: A 60-year-old male was presented with low-grade fever and increased CRP. He had a known history of diabetes, hypertension, and ischemic heart disease since 2007. On examination, he was tachypneic and afebrile; blood pressure and oxygen saturation were within normal limits.He was also double vaccinated. Also had a history of moderate COVID (Omicron) in January, 2022. His CT score was 18/25. He got admitted for 10 days because of COVID and was treated with oxygen, antibiotics, remdesivir, and steroids.Later on, patient developed fatigue, anorexia, abdominal discomfort, and pain in lower back. Also vomiting and nausea for 3 months. So patient was treated with tablets Zifi CV for 5 days bd followed by; IV meropenem 1 g tds for 5 days followed/by; tablets faropenem 200 md bd for 3 weeks followed by; tablets nitrilofurantoin 100 mg bd.Ultrasonography remains the first line of investigation and can show the enlarged echogenic kidneys with hypoechoic areas of abscesses, perinephric fluid collections, hydronephrosis, and cystitis. Cortical thickness appeared normal with raised cortical echo. An unenhanced computed tomography (CT) of his abdomen and pelvis was performed and suggested of mild changes of acute bilateral pyelonephritis. CT features include diffuse patchy nephrogram, inhomogeneous enhancement with areas of low attenuation, perinephric fluid collections, and no contrast excretion.Fungal culture sensitivity report was done and Candida albicans organism was isolated and it was found to be all drug-sensitive. Later on, a biopsy of the urethra was performed and a biopsy specimen revealed a fungal ball composed of thin septate and branching thick abroad aseptate hyphae. And also, which resembled morphologically mucor. spp and Aspergillus. A bacterial culture and sensitivity report were suggestive of E.coli.The patient underwent surgical interventions, ie, cystoscopy with B/L RGP with B/L DJ stenting done under SA with a calculated risk of diabetes, hypertension, age, nature of illness, and high creatinine.Patient started treatment with sulbacin 1.5gm injection with 100 ml sodium chloride 0.9% 6 hourly. As patient's creatinine is not stable so Liposomal Amphotericin B was not given. Later on, as creatinine stabilized patient he began receiving liposomal amphotericin B at a beginning dosage of 300 mg with 25% dextrose 250 ml over 5 h. Also, posaconazole started with a loading dose of 600 mg, and then, 300 mg OD was given to patient.Result: Patient gradually recovered and a dose of liposomal amphotericin was completed for 4 weeks.ConclusionIn conclusion, this paper describes that COVID-associated mucormycosis is a known entity, however, Renal Mucormycosis is a rare disease. Especially, bilateral involvement with limited drug penetration into a urogenital system of the agents which are active in mucormycosis. Its management involves, team approach of diabetologists, infectious disease physicians, urologists, radiologists, and microbiologists. Treatment of mucormycosis is challenging as anti-fungal penetration in renal tissue is difficult. High index of suspicion should be there to make the diagnosis. Early detection and aggressive management may have a favorable outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P284
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P285 Predominance of Trichophyton tonsurans causing tinea capitis: a
           12-years retrospective study in north of Iran

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackground: Tinea capitis is a common and endemic fungal infection of the scalp that Trichophyton spp. and Microsporum spp. usually cause. This study aimed to investigate tinea capitis and its etiologic agents for 12 years in northern Iran.Material Methods: The study is a retrospective analysis involving 11 095 patients referred to the Reference Laboratory of Medical Mycology at Sari, Iran, from July 2009 to April 2022. The skin scraping and hair samples were assessed based on direct microscopy and culture, and causative agents were identified based on macroscopic, and microscopic morphology.ResultsTinea capitis was confirmed in 209 patients: 157 (75.1%) male and 52 (24.9%) female out of 921 suspected patients with a scalp lesion. The prevalence of tinea capitis in patients who refer to the Reference Laboratory of Medical Mycology varied from 6.1 to 37.5%. In both sexes, a higher rate of tinea capitis was observed in patients younger than 20 years of age. Trichophyton tonsurans (146/209; 69.9%) was the most etiological agent, followed by T. mentagrophytes (13/209; 6.2), T. violaseum (9/209; 4.3), Microsporum canis (3/209; 1.4%), T. verrucosum (2/209; 1%), and T. rubrum (1/209; 0.5%). On direct microscopy examination, endothrix hair invasion in 77.0% cases, ectothrix in 2.3%, septate hyphae in 10.5%, and ecto-endothrix in one case were observed.ConclusionIn recent decades, the prevalence of tinea capitis caused by anthropophilic fungi has remained high, particularly in younger children. Therefore, it is essential to focus on public and personal health education in this age group to prevent and control the disease.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P285
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P286 Histoplasmosis in Sri Lanka

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackground: Histoplasmosis is a systemic mycosis caused by Histoplasma capsulatum, a dimorphic fungus. More severe disease has been observed in immunocompromised individuals. Most cases occur in certain endemic regions of the world however it seems to have a much wider global distribution. Histoplasmosis is infrequently recognized in Sri Lanka and the dispersion of information on cases is fragmented.Method: The comprehensive search of medical literature in the English language through databases from any time to February 2022. Either, culture-proven or histopathologically proven cases were selected as diagnostically confirmed histoplasmosis. Duplicate reports were excluded. All available data on demography, clinical presentation, diagnostic method, management, and clinical outcome were appraised for the reported cases.Result: One survey of histoplasmin skin sensitivity testing and ten cases of histoplasmosis across Sri Lanka were observed during the above period. A total of 5.7% of histoplasmin positivity had been observed in the survey of histoplasmin sensitivity among 1366 Sri Lankan volunteers of the Western and the Central Provinces in 1969. Most of the patients were reported from the Central province which had the positive histoplasmin test previously. In addition, cases were observed in Southern Province, the Sabragamuwa Province, and the Eastern Province. The majority of affected individuals were adult males (90%) and pediatric patients were not observed. The clinical presentation stretched from oral lesions (the most common presentation), skin lesions, and fever of unknown origin, to adrenal crisis. Disseminated histoplasmosis was diagnosed in 50% of the patients however asymptomatic, acute pulmonary, and chronic pulmonary histoplasmosis was not observed. Both diabetes and betel chewing are likely to be linked with oral histoplasmosis and none of the patients were positive for HIV. Both histopathology and fungal culture methods were used for the diagnosis while the use of antigen and antibody testing were not popular. Both itraconazole and amphotericin B were used for the treatment of the patients with variable outcomes.ConclusionHistoplasmosis exists in Sri Lanka. The number of cases could be expected to be much higher than reported along with the increase in at-risk populations. These mandates enhance laboratory diagnostic facilities and increase the awareness of medical professionals in Sri Lanka.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P286
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P287 A case of cerebral aspergillosis in Sri Lanka

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroduction: Cerebral aspergillosis is a rare disease entity that is usually associated with high mortality. In accordance with most systemic fungal infections, immunocompromised patients are the predominant victims affected. Nonspecific clinical and radiological features may contribute to difficulty and delay in diagnosis, further contributing to the poor prognosis of cerebral aspergillosis. Obtainment of proper specimens for laboratory diagnosis is a key to make a timely diagnosis that may be lifesaving.Case Report: A 74-year-old female presented with a frontal headache for 2 weeks’ duration. She had been diagnosed with a low-grade lymphoma and had completed the chemotherapy and high-dose prednisolone 4 weeks prior to this presentation. Other than the frontal headache, which progressed slowly over 2 weeks, she did not disclose any associated symptoms. Physical examination was normal, with neither sign of raised intracranial pressure nor of a CNS infection. Basic investigations revealed no abnormalities, and the white cell count was 7.5 × 109/l and the CRP was 7 mg/l.An MRI of the brain indicated right frontal sinusitis with a secondary small abscess in the right frontal lobe inferiorly. Therefore, she was treated with parenteral antibiotics for a bacterial infection and was discharged.The patient presented with a headache again after 3 months. A repeat MRI of the brain revealed an increase in the size of the lesion in the right frontal lobe and the possibility of a cerebral tumor was suggested. A diagnostic biopsy was performed, and the specimen was subjected to fungal studies. The direct microscopic examination revealed fungal filaments and the culture yielded a pure growth of Aspergillus fumigatus.She was started on intravenous amphotericin B, followed by oral voriconazole. Her headache gradually subsided with antifungal therapy. The duration of therapy was guided by serial radiological imaging, and the patient achieved a complete recovery at the end of 1-year of treatment. She remains asymptomatic to date, after 2 years of treatment completion.Discussion: Immunocompromised patients with cerebral aspergillosis may present with minimal clinical symptoms and signs. Obtaining a proper specimen for laboratory testing is vital to arrive at a definitive diagnosis. Radiological investigations may play an important role in the diagnosis as well as during the follow-up of a patient with cerebral aspergillosis. Appropriate antifungal treatment for a prolonged duration, with or without neurosurgical intervention and reversal or reduction of immunosuppressive therapy leads to a good prognosis.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P287
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P300 Importance of direct microscopy in respiratory mold infection: a
           diagnostic dilemma

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMIntroduction: Opportunistic fungal infections are on the rise due to a changing healthcare paradigm worldwide. India is the second most populated country in the world and is experiencing an upward trend in fungal lung diseases.Objective: Rapid diagnosis of respiratory mold infections by direct microscopy.Material and Methods: We retrospectively analyzed the mycology of the received respiratory samples; sputum, BAL, or ETT secretion between January 1, 2021 to March 31, 2022. All the samples were processed as per standard mycological procedures. For each sample, two KOH wet mounts were prepared and examined. Samples were inoculated over SDA and blood agar and incubated at 28°0C and 37°C in BOD. Once there was growth, it was processed as per standard protocol.ResultsWe received a total of 109 respiratory samples from suspected respiratory fungal infections of which early morning sputum samples 84 (77%) were the predominant followed by BAL samples 25 (23%). Most of the enrolled patients were male 73(67%) with a mean age of 48 years. Among 109 samples, 83 (76%) were shown to be fungal elements by KOH wet mount while 26 (24%) were KOH negative. A total of 53 (48.6%) samples were culture-positive Aspergillus flavus30(27%), was found to be the most common species isolated followed by A. fumigatus 16 (14.6%), miscellaneous11(10%), Aspergillus. species 5 (4.5%), and A. terreus 2 (1.8%).ConclusionConsidering the findings of KOH mount in our study, we would like to emphasize that this is a very simple, rapid, and cost-effective laboratory method with high diagnostic sensitivity when correlated with clinical findings, radiological findings, and host factors.Further, it has been found to be very dependable for making decisions to start empirical antifungal therapy early by clinicians.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P300
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P302 Disseminated histoplasmosis: Rare entity in immunocompromised
           individuals in India

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMInvasive mycoses kill more than one million people every year. The disease burden of mycoses has increased over the last 20 years and the importance of fungal disease is expected to keep increasing in the years to come. One of these mycoses, histoplasmosis, a disease caused by species of dimorphic genera, Histoplasma and is endemic in the USA, Asia, and Africa with sporadic cases reported from India. In the United States alone, 3.4 cases/100 000 people occur yearly. In India, prevalence of histoplasmosis is seen in the eastern part of the country and few cases are reported from north India. Here, we present four cases of classic progressive disseminated histoplasmosis from non-endemic central and northern parts of India.Cases I and II: Two cases, firstly a 51-year-old male resident of Delhi, came with complaints of fever, generalized weakness and weight loss for the past 6 months, and another a 55-year-old in an apparently immunocompetent female from a non-endemic state in central India. The disease was diagnosed by bone marrow aspirate incidentally.Cases III and IV: A 25-year-old female and a 29-year-old HIV-infected female, with chief complaints of multiple skins colored swellings on her face, neck, chest, and back and also on both limbs. Physical examination revealed multiple skin-colored papules and nodules coalescing to form large plaques on the face, neck, upper back, and chest which had overlying yellowish-brown crusting (Fig.1). Her entire face was involved with depression of the nasal bridge and madarosis. Multiple discrete 0.1-0.5 mm papules and nodules on bilateral upper and lower limbs. Patient was started on the treatment of cutaneous histoplasmosis with injection of liposomal amphotericin-B 100 mg intravenous (around 3 mg/kg/day) after pre-medication for 10 days. For both cases, capsule itraconazole 200 mg BD started for 4 days. Patient responded well to the treatment and follow-up showed improvement in the condition of the patient.ResultsIn all the cases, fine needle aspirate cytology of the lesions showed plenty of inflammatory cells and macrophages in pathological microscopic examination. Microscopic examination of skin tissue revealed that macrophages comprising of yeast forms of Histoplasma have pericellular halo around them. Moreover, on long incubation of biopsy sample on SDA media plate at 27˚C, white/buff colonies with yellow-tan on the back were observed. Furthermore, microscopic examination of grown fungal culture showed mycelial septate hyphae bearing round to pear-shaped, smooth-walled broadly elliptical microconidia, or tuberculate macroconidia. In all the cases, clinical suspicion, histopathological and mycological findings (microscopy, culture and post-culture sequencing) led to a confirmatory diagnosis of progressive disseminated Histoplasmosis by H. capsulatum var. capsulatum was made.ConclusionIn all, 3 of these cases are of progressive disseminated histoplasmosis in apparently immunocompetent patients from the non-endemic states of north India. On the contrary, one of the cases was HIV positive with mucocutaneous lesions. Disseminated histoplasmosis in immunocompetent individuals is not a rare entity, in India. High clinical suspicion and awareness regarding the pathogen are required. From the point of good patient care, an accurate diagnosis, and timely management in cases of histoplasmosis are warranted.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P302
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P303 An unusual case of isolated gluteal abscess

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMBackground: Mucormycosis is an invasive infection caused by fungi belonging to the order Mucorales. The angioinvasive disease caused by these fungi can prove to be fatal despite appropriate treatment. We report an unusual case of a gluteal abscess caused by a probable mucormycosis in an apparently immunocompetent individual.Case Description: A 68-year-old gentleman hailing from a rural area of Bihar, India presented with a painful swelling over the left buttock region for 4 weeks. He was a known hypertensive and had ischemic heart disease. He denied any history of fever. The lump had gradually increased in size. He was a retired school teacher with a farmland and reared livestock at home. He was a non-vegetarian and denied any addictions. He had a history of intermittent lower backache for which he used to take occasional intramuscular analgesic injections over his buttocks from a local medical practitioner.On examination, the swelling was about 4 cm X 4 cm in size, fluctuant, with ill-defined margins over the lateral region of the left buttock. The swelling was tender, warm, and not fixed to underlying structures. Systemic examination was unremarkable. Ultrasound examination revealed an ∼7.2 × 4.2 × 7.8 cm cystic lesion with a volume of 126cC. It was located predominantly in subcutaneous fat extending into muscular plane with septa and solid components in the left gluteal region (Fig. 1). It had thick walls and fine internal echoes within. Other investigations were unremarkable except for glycosylated Hb, which was 6.2%. Incision and drainage were done.During the procedure, it was seen as a cyst with a thick wall that was removed in toto. The contents were explored after removal and were found to be yellowish black with mucoid consistency. Histopathological examination revealed numerous broad, ribbon-like, aseptate fungal hyphae with right-angled branching infiltrating the inflamed tissue (Fig.2). There were numerous epithelioid granulomas surrounding the fungal elements in the soft tissue of the wall. The findings were consistent with a fungal abscess caused by mucormycosis. Culture of the fluid/pus was negative. Thus, a diagnosis of mucormycotic gluteal abscess was made and patient was commenced on 50 mg of amphotericin B deoxycholate in view of financial restraints. High resolution computed tomography of chest was done which was unremarkable.He developed an acute kidney injury after 2 doses of amphotericin B deoxycholate which was then stopped. Oral posaconazole was started. He has developed bilateral leg swelling post-oral posaconazole and is commenced on oral spironolactone for the same. The postoperative wound has healed well and there is no new swelling or tenderness over the area. He is planned for further follow-up.Conclusions:Isolated gluteal abscess caused by mucormycosis is rare in an apparently immunocompetent host.We assume that repeated intramuscular injections might have caused traumatic inoculation of fungus into the host which led to this outcome.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P303
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P304 Epidemiological and clinical characteristics of patients with
           onychomycosis caused due to Neoscytalidium spp. in two reference centers
           in Bogotá D.C.

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjective: To describe the sociodemographic and clinical characteristics, diagnostic methods, and therapies received in patients with onychomycosis confirmed due to Neoscytalidium spp, who attended the San José Hospital and the Medical Mycology Laboratory for 1 year, in order to get a better perspective of the disease in our field, enhance its detection and increase early prevention.MethodsA descriptive cross-sectional observational study was carried out in two centers: San José Hospital and Medical Mycology Laboratory from November 2019 to November 2020; patients of all ages with a confirmed diagnosis of onychomycosis due to Neoscytalidium spp. were included. The cases were identified based on ICD-10 codes and the information was collected from the clinical history, questionnaires, clinical photographs, and additional documents.ResultsA total of 465 cases of onychomycosis were confirmed in the chosen period of time, of which 60 cases were caused due to Neoscytalidium spp. Affecting 31 women and 29 men, with an average age of 48.5 years in both sexes; 85% of these patients lived in Bogota D. C. The mean duration between the onset of the disease and its diagnosis was 3 years, 13% of the patients had a history of chronic disease including thyroid disorders, arterial hypertension, and diabetes mellitus. A total of 98% of the patients had toenail involvement, 88% had 1 to 5 nails involved, 33% of the cases showed mild nail involvement, 20% moderate, and 6% severe. Likewise, 35% of the cases presented dermatomycosis. 43% of the patients reported having received topic and systemic treatment, where there was no improvement in the major of the cases (78%).Conclusions: Our results support what is reported in the literature regarding risk factors, sociodemographic findings, and difficulty in therapeutic response to the pharmacological measures available to treat this infection; as well as the opinion of certain authors, onychomycosis caused due to non-dermatophyte mold is clinically indistinguishable from that caused by dermatophytes. Therefore, a complete mycological study (direct examination/KOH and culture) should always be performed to identify the causative agent before starting any treatment, since as our study showed, infections due to Neoscytalidium spp. are, in general frequency, the third most common cause of infection in onychomycosis and the first by non-dermatophyte molds.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P304
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P305 Cirrhosis and fungal infections-a cocktail for catastrophe: a
           systematic review and meta-analysis with machine learning

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesWe evaluated the magnitude and factors contributing to poor outcomes among cirrhosis patients with fungal infections (FIs).MethodsWe searched PubMed, Embase, Ovid, and WOS and included articles reporting mortality in cirrhosis with FIs. We pooled the point and relative-risk (RR) estimates of mortality on random-effects meta-analysis and explored their heterogeneity (I2) on subgroups, meta-regression, and machine learning (ML). We assessed the study quality through New-Castle-Ottawa-Scale and estimate-asymmetry through Eggers regression (CRD42019142782).ResultsOf 4345, 34 studies (2134 patients) were included (good/fair/poor quality: 12/21/1). Pooled mortality of FIs was 64.1% (95%CI: 55.4-72.0, 12: 87%, P <.01), which was 2.1 times higher than controls (95%CI: 1.8-2.5, 12:89%, P <.01). Higher CTP (MD: +0.52, 95%CI: 0.27-0.77), MELD (MD: +2.75, 95% CI: 1.21-4.28), organ failures, and increased hospital stay (30 vs. 19 days) was reported among cases with FIs. Patients with ACLF (76.6%, RR: 2.3), and ICU-admission (70.4%, RR: 1.6) had the highest mortality. The risk was maximum for pulmonary-FIs (79.4%, RR: 1.8), followed by peritoneal-FIs (68.3%, RR: 1.7) and fungemia (55%, RR: 1.7). The mortality was higher in FIs than bacterial (RR: 1.7) or no-infections (RR: 2.9). Estimate-asymmetry was evident (P <.05). Up to 8 clusters and 5 outlier studies were identified on ML, and the estimate-heterogeneity was eliminated on excluding such studies.Conclusions: A substantially worse prognosis, poorer than bacterial infections in cirrhosis patients with FIs indicates an unmet need for improving fungal diagnostics and therapeutics in this population. ACLF and ICU admission should be included in host criteria for defining IFIs.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P305
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P306 Scedosporium spp. and Lomentospora prolificans, fungal agents with
           unexpected vascular tropism

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjectivesInvasive scedosporiosis and lomentosporiosis are deadly fungal infections due to Scedosporium spp. and Lomentospora prolificans. The Scedosporiosis/lomentosporiosis Observational Study (S.O.S.) highlighted for the first time a frequent vascular involvement in these infections including aortitis and peripheral arteritis (PA). We here describe the clinical, microbiological, radiological and anatomopathological characteristics of these vascular infections.MethodsWe retrospectively reviewed cases of arteritis (with the exception of central nervous system arteritis) from the S.O.S. cohort and from the literature.ResultsSeven cases of vascular infections were identified from the S.O.S. cohort representing 24% (7/29) of the disseminated scedosporiosis/lomentosporiosis. Four cases had both aortitis and PA, 2 patients were diagnosed with PA and one patient with aortitis. A total of 9 aortitis and 4 PA cases were identified from the literature. All 20 cases were proven scedosporiosis/lomentosporiosis. The main species was S. apiospermum [60% of cases (12/20)] followed by L. prolificans [35% of cases (7/20)]. One infection was caused by both species. An underlying immunosuppression was present in 70% of the cases (14/20, with 10 cases of solid organ transplantation and 3 cases of hematologic malignancies). The main risk factor in immunocompetent patients was a previous cutaneous trauma (4/6). Interestingly, vascular involvement was identified at diagnosis of the scedosporiosis/lomentosporiosis in only half of the cases. Aortitis was mainly abdominal (8/13). Various PA localizations were reported with frequent iliac or femoral involvement (4/10). Arteritis was the only localization in only 10% (2/20) of the scedosporiosis/lomentosporiosis, other sites involved being mainly osteoarticular (10/20), and pulmonary (9/20) followed by central nervous system (5/20), cutaneous localizations (4/20), and endocarditis (4/20). Of note, three-quarters of the cases were disseminated. Aneurysmal lesion was the most frequent imaging aspect (8/11 of aortitis and 6/10 of PA) which was complicated by a rupture in half of the aortitis (4/8) and only one PA (1/6). Vascular wall thickening (2/11 of aortitis and 1/10 of PA) and perivascular abscess (1/11 and 1/10, respectively) were more rarely described. Hypermetabolism was constant on PET-CT scan when performed (6/6). When available (11/20), pathological analysis showed an invasion of the artery wall by fungal hyphae (10/11), particularly in the media and the adventice. A total of 3-months of mortality related to infection was 44% (8/18), rising to 71% (5/7) in case of fungemia.ConclusionThe vascular tropism of Scedosporium spp. and L. prolificans underlies the necessity of vascular imaging in the management of these infections, especially in case of dissemination seeking in particular aneurysmal lesions of the abdominal aorta and iliofemoral arteries.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P306
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P307 Clinical profile of fusarium infections: case series from a tertiary
           care hospital

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMObjective: To study the clinical profile of patients with Fusarium infections diagnosed at our tertiary care center during the study period from February 2017 to March 2022.MethodsWe conducted a retrospective case study wherein all consecutive patients with Fusarium infections between February 2017 to March 2022 were accessed. The diagnosis was categorized based on either fungal culture alone or fungal culture with histopathology findings.ResultsA total of 12 patients with Fusarium infections were encountered during this period. The mean age was 49. In all, 5 were females and 7 were males, and 5 patients had diabetes as a risk factor. Other risk factors included were chemotherapy for multiple myeloma (1) and lymphoma (1), polytrauma (1), and surgery after pituitary macroadenoma. A total of 8 (66.7%) patients were on antifungal prophylaxis at the time of diagnosis.A total of 6 (50%) had localized infections whereas, remainder 6 (50%) had disseminated infection, and 25% presented with onychomycosis. Seven patients were diagnosed based on fungal culture and five were diagnosed based on histopathology findings collaborated with a fungal culture. There was one patient with Fusarium blood stream infection, who expired within 2 weeks of hospitalization.A total of 10 patients had F. solani whereas, 2 had F. oxysporum isolated in fungal cultures. In all, 42% of patients in the study had high Beta- D-Glucan (BDG) and 67% of the patients underwent source control of the involved region. A total of 9 patients (75%) received voriconazole as antifungal treatment and 3 patients received Amphotericin B. Four patients expired, three were lost to follow up and five did not develop relapse on follow-up.ConclusionFusarium is an opportunistic human pathogen severely affecting immunocompromised patients, especially patients with hematological malignancies, prolonged neutropenia, and post-hematopoietic stem cell transplantation. Our study records a notable number of Fusarium infections among diabetics and onychomycosis was a common presentation. A high index of suspicion is of utmost importance in patients with risk factors and serum BDG may help in suspicion of invasive Fusarium infections. The 33% mortality in our study stresses the need for early diagnosis and treatment.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P307
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P308 Jorge lobo's disease in brazil: a new recognized reservoir'

    • Abstract: Abstract Poster session 2, September 22, 2022, 12:30 PM - 1:30 PMLobomycosis (lacaziosis) is a chronic subcutaneous disease caused by the uncultivated fungus Lacazia loboi. The disease was first described in 1931 by Jorge Lobo in Brazil and has been reported in South and Central America. Lobomycosis is a rare disease that affects certain geographic regions, mainly in countries of low socioeconomic status, but its prevalence among indigenous people in Brazil is exceptionally high. The state of Maranhão is located in the northeast region of the country and there are rare clinical reports of imported cases of the disease in our region. This is the first published series of autochthonous cases of lacaziosis in Maranhão.Objective: To describe seven cases of Lacazia loboi infections in immunocompetent patients in an endemic area for other subcutaneous mycoses.MethodsWe retrospectively reviewed the medical records of all patients who developed Jorge Lobo's diseases in a new area recognized as a potential environment reservoir. An incident case was defined as a patient who developed proven lacaziosis based on the presence of topical fungal elements in the tissue on histopathology or mycologic direct exam. Epidemiological and clinical data of all cases of lacaziosis were collected using a standard clinical form.ResultsIn the period from 2000 to 2021, seven patients were identified. All cases were diagnosed by histopathology and direct mycological examination of the lesions. A total of 6 out of 7 (85.7%) patients were men and the mean age was 57 years (52-70 years). The median time between onset of infection symptoms and diagnosis was ˃2 years in 6 patients, with 15 years of symptoms duration in patient 7. All patients reported having worked with agricultural activities before. A total of 50% of patients were diagnosed with localized lesions and the other half with disseminated lesions. Subcutaneous lesions involved the upper limbs (4/6; 66.6%), ears (2/6; 33.3%), lower limbs (1/6; 16.6%), and trunk (1/6; 16.6%). All patients exhibited nodules as a dominant pattern of skin lesion, sometimes coalescing with the tumor's appearance. Regarding treatment, a combination of itraconazole and clofazimine therapy was added to all patients. Surgical excision was possible only in 2 episodes due to the limited availability of this procedure at the site. Cure was documented in 2 cases, with no recurrence to date.ConclusionThe present series represents the first and largest collection of case studies of lacaziosis in Maranhão state, with all cases classified as autochthonous. Lacaziosis involves mainly adult males with different occupational risks such as agricultural labor, and other workers exposed to contaminated soil and plant materials. Few data are available to support suggested therapy with itraconazole and clofazime. Excision surgery is important for treatment due to the absence of clinical trials in the medical literature. Epidemiological surveillance studies of new cases of lacasiozis in Maranhão are important for mapping this new reservoir and developing public policies for diagnosis and treatment.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P308
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P431 Tip to correct the variation position error in applying long-read
           high-throughput sequencing technology for fungal identification

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMPresently, long-read high-throughput sequencing technology has been started applying in the medical mycology field instead of common Sanger sequencing. With its capability to sequence nucleic acid among the large region compared to Sanger sequencing, this technology can detect and analyze both inter- and intra-species sequence variation in internal transcribed spacer (ITS), a fungal house-keeping region, resulting in high accurate fungal identification. However, to set up the long-read high-throughput sequencing technology for fungal identification is quite challenging because of several factors related to the accuracy including the variation position error. So, in this study, we summarize the tip to correct the variation position error in applying long-read high-throughput sequencing technology for fungal identification that we have learnt in the preliminary laboratory setting using the 8 clinical isolates of yeast: Candida albicans (n = 2), C. tropicalis (n = 1), C. glabrata (n = 1), Trichosporon asahii (n = 2), Pichia kudriavzevii (n = 1), Cryptococcus neoformans var. grubii (n = 1). Based on the recruited strains, we found that self-assembling reference sequence generated from raw data of reading by using an auto-program named Canu causes the size-inflated sequence, a larger size calculated as 22.83 ± 7.56% than it should be, resulting in the shift of variation position. This error can be corrected by the alignment process of the reference sequence with the known sequence, both size and position, prior to doing the raw read alignment. The advantage of this process could correct not only for position shifting caused by the analysis process but also the random error generated from nanopore system. To validate this correction protocol, more samples are needed for further study.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P431
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P432 Detection of erg11 gene mutation in fluconazole resistant Candida
           albicans isolates

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjective: To determine the profile of fluconazole-resistant Candida isolates (FRCS) and the proportion of erg11 gene mutation in fluconazole-resistant C. albicans (FRCA) isolatesMethodsAfter getting approval from ethics the study was conducted on 150 isolates of FRCS obtained from patients admitted to our tertiary care hospital from September 2019 to December 2021. All the isolates were revived onto Sabouraud dextrose agar (SDA) and identified by Matrix-Assisted Laser Desorption/Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS). Fluconazole-resistance was detected by VITEK 2 automated system. Deoxyribonucleic acid (DNA) of FRCA isolates were extracted by QIAamp DNA Mini kit (Qiagen-51 304, Hilden, Germany) as per manufacturer's instruction. A single primer pair targeting the nucleotide sequence from 1067 to 1576 bp region of erg11 gene was used for amplification as per Xu et al. with minor modification and 500 bp polymerase chain reaction (PCR) products were observed by gel electrophoresis. A positive clinical isolate of FRCA was used as a positive control. The PCR products were purified and subjected to Sanger sequencing with an ABI PRISM DNA analyzer (Applied Biosystems) and mutations were detected by using Mega (version 7) software by comparing with the published GenBank sequence AF153844.1 of C. albicans strain ATCC 28516. Categorical variables were expressed in percentages and continuous variables were expressed in mean (average).ResultsOut of the total of 150 FRCS, the most common fluconazole-resistant agent of candidiasis was C. auris, which was isolated from 60 (40%) cases followed by 24 (16%) isolates of C. glabrata, 19 (12.7%) isolates of C. krusei, 18 (12%) isolates of C. parapsilosis, 17 (11.3%) isolates of C. albicans, 10 (6.7%) isolates of C. tropicalis, and only two (1.3%) isolates of C. guilliermondii. Among these 17 FRCA isolates, 9 isolates were obtained from genital swabs, 5 from blood, and a single isolate each from the perianal swab, ear swab, and sputum. A total of 12 (70.6%) out of 17 FRCA isolates yielded 500 bp region in erg11 gene. Gel electrophoresis image of PCR products of erg11 gene is depicted in Figure 1. Sequencing of these products detected a single missense mutation A1309G (V437I) in one FRCA isolate. Most of the FRCA isolates had an average of 4 silent mutations (observed in 6 isolates) and a single isolate had 6 silent mutations. A total of 8 different silent mutations were observed among FRCA isolates T1296C (83.3%), C1203T (66.7%), A1440G (66.7%), C1302T (50%), T1470C (50%), T1140C (25%), T1110C (16.7%), and T1284C (8.3%).ConclusionC. auris was the most common fluconazole resistant isolate observed, followed by C. glabrata, C. krusei, C. parapsilosis, C. albicans, C. tropicalis, and C. guilliermondii. There were many silent mutations observed in erg11 gene of FRCA isolates and detected only a single missense mutation (V437I). Fluconazole-resistant in FRCA isolates may be due to mechanisms other than the studied one in our region.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P432
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P433 Identification of Candida species isolated from hospitalized patients
           with candiduria

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground and objectives: The incidence of candiduria caused by Candida spp. has increased in recent years, particularly in hospitalized patients. Candiduria is most commonly caused by C. albicans; however, an increase in the prevalence of non-albicans species has been observed during last decades. This study aimed at molecular identification of Candida species isolated from candiduria in hospitalized patients.MethodsThis cross-sectional study was conducted on 530 hospitalized patients in two hospitals in the Mazandaran Province, Iran. Midstream urine specimens were collected and then cultured on CHROMagar Candida medium. Molecular identification of common Candida species was carried out using the polymerase chain reaction-restriction fragment length polymorphism method after enzymatic digestion with MspI. C. albicans and Candida parapsilosis species complexes were identified by amplification of the HWP1 and intein-containing vacuolar ATPase precursor genes, respectively.ResultsThe frequency of candiduria was estimated at 14% among hospitalized patients. Of 74 samples positive for candiduria, 65 (87.8%) were isolated from females. The most common predisposing factor to candiduria was diabetes (n = 36; 48.6%). The most frequent isolates were C. albicans complex (n = 44; 59.4%), followed by C. glabrata (n = 16; 21.6%), C. tropicalis (n = 10; 13.5%), C. krusei (n = 3; 4%), and C. parapsilosis (n = 1; 1.3%).ConclusionBased on the results, the conventional and molecular methods produced similar results for the identification of Candida species. However, accurate identification of Candida spp. requires the use of molecular techniques such as PCR-RFLP, HWP1, and intein-containing vacuolar ATPase precursor genes. Nevertheless, chromogenic methods such as CHROMagar Candida can be used for the diagnosis of Candida spp. in laboratories with limited resources.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P433
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P434 Anti fungal susceptibility of Malassezia to azoles by broth
           microdilution method and their phylogenetic relationship based on
           multi-locus sequence analysis

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMObjectivesTo analyze the epidemiological pattern of disease with regards to age, sex, and site of predilection of skin infection.To identify the species of Malassezia causing infection by phenotypic methods.To conclude with the most effective anti-fungal drugs (azoles) to treat infections caused by the Malassezia by obtaining the MIC (Minimum inhibitory concentration) values in terms of MIC 50 and MIC 90.Molecular identification of the species of Malassezia by Sangers Sequencing.Comparison between phenotypic and genotypic methods of Identification.To do phylogenetic analysis to know the strain relatedness among Malassezia species isolated globally using Bio-informatics tools.Method: Part 1—Epidemiological pattern, phenotypic Identification, and anti-fungal susceptibility pattern by broth microdilution methodType of study—cross-sectional studyPeriod of study—August 2016-October2018Sample size—151 samplesAfter obtaining Institutional Ethical Clearance, skin scrappings were collected from patients and microscopic examination was done with 10% KOHSamples were cultured and Phenotypic Identification was done based on colony growth characteristics, gram staining, urease test, and catalase test, bile esculin with tween 60 hydrolysis and tween assimilation.AFST was performed by the broth microdilution method, according to the Clinical and Laboratory Standard Institute (CLSI) guidelines M27-A3Systemic antifungals used—fluconazole, itraconazole, and voriconazoleTopical antifungals used—clotrimazole, miconazole, sertaconazole, and luliconazolePart 2-Molecular Identification, Sangers Sequencing, Phylogenetic Analysis and DendogramMolecular IdentificationExtraction of DNA by in-house Phenol: Chloroform methodAmplification of extracted DNA—using Internal Transcribed Spacer (ITS) region and Malassezia -specific nested primersAgarose Gel ElectrophoresisNucleic acid sequencing (Sanger's Sequencing)—The results were obtained as trimmed FASTA files and Chromatogram filesSpecies Identification—The sequenced product was blasted in NCBI (National Centre for Biotechnology Information, USA) blastPhylogenetic analysis—DNA sequences were aligned using ClustalW in MEGA11 software.The obtained sequences were concatenated using bioEdit software.Phylogenetic analysis was done using maximum likelihood ratio and maximum parsimony analysis.Phylogenetic Tree/Dendrogram drawn using the bootstrap methodResultsFigure 1 Epidemiological pattern, phenotypic Identification, and AFST by broth microdilutionFigure 2 Molecular Identification, Sangers Sequencing, Phylogenetic Analysis, and DendrogramConclusions:The most effective systemic anti-fungal with the least MIC values were itraconazole and voriconazole. Fluconazole shows resistant pattern with high MIC values.The most effective topical antifungals were clotrimazole with low MIC values compared with miconazole, sertaconazole, and lulliconazole.Malassezia sympodialis responded to antifungals better than other four species isolated. Speciation of Malassezia is important because of variation in resistant pattern to antifungals among different species.Phenotypic speciation showed M. sympodialis as the predominant speciesGenotypic speciation showed M. furfur as the predominant speciesGenotypic speciation is more confirmatory than phenotypic method of speciation in case of MalasseziaAmong the primers used, NCBI blasting results were better with Pan fungal ITS primers than the Malassezia specific primersDendogram showed very good strain relatedness among other strains obtained from India placing them in same clade.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P434
      Issue No: Vol. 60, No. Supplement_1 (2022)
       
  • P435 Evaluation of remote triazole capillary blood testing to facilitate
           remote therapeutic drug monitoring (TDM): A validation study

    • Abstract: Abstract Poster session 3, September 23, 2022, 12:30 PM - 1:30 PMBackground: The advent of COVID-19 has meant that patients with chronic diseases needed to shield, however, investigations were needed to guide continual management of their disease. Remote monitoring options were evaluated to ensure the standard of care is not compromised.Purpose and Hypothesis: The aim was to validate remote (return-posted) capillary triazole blood testing and evaluate the potential role of remote TDM in chronic antifungal therapy.Materials and Methods: A single-center prospective cross-sectional study of remote finger prick capillary blood testing compared with gold standard venesection was performed. Remote finger prick capillary blood testing was validated compared to local standard venesection using comparative statistical analysis Comparative statistical analysis: Paired t-test, correlation and Bland-Altman were used to determine if there was agreement or association between the sampling methods.ResultsA total of 66 patients receiving triazole therapy were recruited and 57 pooled pairs of remote capillary and venous triazole concentrations and metabolites were prospectively analyzed, with the rest of the blood samples not being analyzed due to insufficient sample, hemolysis, or undetectable triazole level of <0.2 mg/l. There was a significant difference in the comparison of the two methods of sampling with paired t-test at P <.0001. Bland-Altman analysis yielded wide bias (−49.07%) and wide limits of agreement (−85.5% to −12.64%). On average capillary triazole, concentrations were 37% lower than venous concentrations (Fig. 1). There was however a very strong correlation between capillary and venous tests (Pearson's correlation coefficient r = 0.9219, P <.0001, Fig. 2).Conclusions: Remote capillary triazole sampling does not appear interchangeable with venous sampling, but being strongly correlated and on average 2/3rd of the venous value, could be a predictor of venous triazole level, or be useful for intra-patient longitudinal monitoring. When incorporated into an outpatient clinical pathway it can improve shared decision-making and patient experience. Further research is required to determine appropriate target reference ranges if the new lower capillary levels can be used routinely, especially in the climate of COVID-19 where social distancing measures limit patient access to hospitals and clinics for routine investigations.
      PubDate: Tue, 20 Sep 2022 00:00:00 GMT
      DOI: 10.1093/mmy/myac072.P435
      Issue No: Vol. 60, No. Supplement_1 (2022)