JournalTOCs

Universal Journal of Public Health
Number of Followers: 0

This is an Open Access Journal

Open Access journal
ISSN (Print) 2331-8880 - ISSN (Online) 2331-8945
Published by Horizon Research Publishing

[51 journals]

Risk factors of injury among urban adolescent students
- Authors: Shabnam Imam, Nadira Begum, Farhana Salim, Mohammed Mustafizur Rahman, Meherunnesa Begum
  Pages: 1628Abstract: Background: Injuries are a significant public health issue and a leading cause of morbidity and mortality among adolescents. This study aimed to observe the incidence and risk factors of injury among urban adolescent students. Methods: The study was conducted at Dhanmondi high school in Dhaka, Bangladesh, from January to June 2018. A total of 325 students were purposefully selected for the study. The prevalence of injury, the pattern of injury, the socioeconomic and demographic characteristics, and the proportion of social determinants of injury were estimated. Results: 60% of the participants reported an injury in the last 6 months, with moderate injuries being the most common (63.59%). Seeking care was through visiting a doctor (28.72%) or hospital (33.33%). Most injuries occurred at home (33.33%) or in an institution of education (31.28%). The most common site of injury was the hand (39.49%) and the most common mode was sudden attack or fighting (28.21%). A significant association was found between injury occurrence and sex, grade of students, and age of students, but not with monthly income, education level of the father, occupation of the mother, or number of family members. Conclusions: The most prevalent risk factors for injury were fighting, violating traffic laws, and taking risks while getting into a vehicle. These factors were also statistically significant predictors of injury occurrence. The findings suggest a need for targeted injury prevention programs to address these risk factors among urban adolescent students in Bangladesh.
  PubDate: 2023-04-12
  DOI: 10.18203/2394-6040.ijcmph20231040
  Issue No: Vol. 10, No. 5 (2023)
Knowledge of the Saudi hypertensive individuals towards hypertension: a
cross-sectional analytical study
- Authors: Hamdan M. Al-Shehri
  Pages: 1635Abstract: Background: This cross-sectional study aimed to assess the knowledge of hypertension among adults living in Saudi Arabia. This information will be valuable for healthcare providers, public health organizations, and policy makers in developing effective health education programs and interventions to improve the management and prevention of hypertension in Saudi Arabia Methods: The study was conducted during the period from October 2022 to December 2022 and utilized an online survey with a sample size of 1234 adults with a minimum age of 18 years. The survey consisted of questions regarding sociodemographic characteristics and knowledge of hypertension, including causes, symptoms, risk factors, and management. Results: The results showed that most participants had a general understanding of hypertension, with the majority (79.7%) knowing the normal values of blood pressure and 63.7% understanding that it is a treatable condition. The most common source of knowledge about hypertension was through friends and family (53.1%). Conclusions: The study highlights the need for continued education and awareness about hypertension in Saudi Arabia, particularly for those with limited education and older individuals.
  PubDate: 2023-04-15
  DOI: 10.18203/2394-6040.ijcmph20231052
  Issue No: Vol. 10, No. 5 (2023)
Frequencies, clinicopathological features, and risk factors of type I and
type II endometrial cancer; a retrospective observational study at a
tertiary care hospital in Pakistan
- Authors: Muhammad Talha Nawaz, Ayesha Nasir Hameed , Hassan Tauqeer , Meher Angez, Aliya Begum Aziz
  Pages: 1642Abstract: Background: Endometrial cancer (EC) is the most common gynecological malignancy worldwide. The death rates for EC have increased by more than 100% over the past 2 decades. EC is subdivided into two types based on distinct histological and clinical features: type I and type II. Our study aims to determine the risk factors and clinicopathological features of both type I and type II EC and draw a comparison between the two types based on frequency, risk factors and clinicopathological features. Methods: It was a retrospective observational study including patients of a single tertiary care center. The study included Patients diagnosed, treated, and followed up for type I and type II endometrial cancer at the study center over the past 19 years from 1st January 2000 to 31st December 2018. All the patients with metastatic endometrial cancer were excluded from the study. SPSS version 26 was used for statistical analysis. Results: A total of 376 patients were included in this study. Among these 343 (91.7) patients had endometroid adenocarcinoma (Type I) and 32 (8.3) had serous and clear cell tumor (type II). Type I EC had a mean age of 57.56 (SD±10.42) while patients with type II EC presented with a mean age of64.97 (SD±6.59). Hypertension and Diabetes were the most common comorbid in EC patients. HRT prior to EC was found to have an association with risk of EC. Compared to patients who were on HRT, patients who were not on HRT prior to diagnosis of EC had 80% less chance of developing endometrial cancer. (Confidence interval: 0.056-0.114, p=0.016). Conclusions: In summary our study demonstrates that both sub types of endometrial cancer have many risk factors that are similar to each other. Despite the difference between the population of both subgroups we were able to prove associations between risk factors and endometrial cancer. However further research is needed at provincial and national level with larger and relatively comparable sample sizes for both subgroups to recognize risk factors and numerically associate them to EC for Pakistani population.
  PubDate: 2023-04-15
  DOI: 10.18203/2394-6040.ijcmph20231053
  Issue No: Vol. 10, No. 5 (2023)
Effectiveness of mHealth in improving medication adherence among
hypertensive patients on follow-up in a tertiary hospital in central
Kenya: a randomized controlled trial
- Authors: Ernest Mutua, Bonaventure O. Agina, Isaac Mwanzo
  Pages: 1649Abstract: Background: Non-adherence to medication is documented in the literature as a major barrier to blood pressure control among patients on treatment for hypertension. This study sought to evaluate the potential effectiveness of a mHealth intervention in supporting medication adherence among hypertensive patients on follow up. Methods: We undertook a single blind parallel randomized controlled trial among hypertensive patients undergoing follow up care in Nyeri County Referral Hospital between January and December, 2020. The trial comprised of two arms, with a total of 120 patients randomized on a 1:1 ratio. Patients in the experimental group were put on an educational health intervention comprising of mobile phone delivered SMS messages and interactive voice calls. Patients in the control group were continued on the usual care offered in the hospital’s medical outpatient clinic. The primary endpoint was medication adherence. Data was analyzed through the intention to treat approach at 5% significance level. Results: A total of 112 participants (93.3%) were retained in the study at the end of follow up. The proportion of patients who were adherent to their prescribed medications was higher by 38.3% among participants in the experimental arm compared to those in the control group (p<0.001). The odds of being adherent to medications was 6.1 times higher for patients who had received the study’s intervention compared to those in the control group (95% CI 2.6, 14.3). Conclusions: The mHealth intervention applied in this study was effective in improving medication adherence among patients on treatment for hypertension.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231259
  Issue No: Vol. 10, No. 5 (2023)
Study neonate’s complications in COVID-19 infected pregnant women in
early period of pandemic in Ardabil province, Iran
- Authors: Shahla Farzipour, Samira Shahbazzadegan, Negin Nahanmoghaddam, Faranak Jalilvand, Sepideh Nedaei, Hamed Zandian
  Pages: 1658Abstract: Background: Pregnant women and neonates are considered as high-risk groups of population. Due to higher risk of COVID-19 in pregnant women, the aim of this study was to determine neonates' complications in COVID-19 infected pregnant women in early period of pandemic in Ardabil province. Methods: This prospective cross-sectional study was conducted on 21 infected pregnant women and their neonates from Feb to June 2020 in Alavi Hospital, Ardabil. Mother’s clinical and laboratory findings and their neonates were registered in a checklist. Neonates’ complications were assessed and infants 'growth and developmental disorders followed up at 28 days, 6 months, and 12 months. Collected data were analysed by statistical methods in SPSS version 24. Results: In terms of clinical symptoms, the most prevalence symptoms were shortness of breath, fever, chills and dry cough. 15 infected mothers had a cesarean section and there was no maternal and neonatal mortality in this study. Of the 21 neonates, 13 were boys and 8 girls. Five neonates had respiratory distress and were admitted to the intensive care unit for 1 week. In these 5 neonates, arterial pH was low and neonatal CRP was high and the blood culture was negative for them. Also, all neonates were negative for COVID-19. None of the newborns had problems with feeding and poor reflexes and other symptoms. All newborns had negative PCR. 19 neonates were born over 2500 grams. Conclusions: Results showed that suffering to COVID-19 had not relation with growth disorder in neonates and mother's clinical symptoms had not different with other symptoms. So we can use similar investigations to control of COVID-19 in all pregnant women. Also, COVID-19 infection in newborns was not associated with growth and developmental disorders in 1 year fallow up.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231260
  Issue No: Vol. 10, No. 5 (2023)
Design multiplex PCR primer and probe gen ORF1ab and gen N on COVID-19
- Authors: Hasna Mirda Amazan, Andani Eka Putra, Rauza Sukma Rita
  Pages: 1663Abstract: Background: Coronavirus disease 2019 (COVID-19) is an infectious disease caused by the SARS-CoV-2 virus which is a new strain of the Coronavirus, the primary and probe designs were carried out to find candidate primers and probes to be used as the detection of COVID-19. The purpose of this study was to design multiplex PCR on primers and ORF1ab and N gene probes in COVID-19 examination using the multiplex PCR method and it is expected to have good validity in the examination. Methods: The research design is in the form of explorative descriptive with a cross sectional approach. Starting from April to December 2021. The samples used in this study were 221 COVID-19 gene sequences downloaded from the NCBI and GISAID gene databases. Results: The design results of the ORF1ab gene primer and probe with forward primer: 5'- CGCAATTTACAACACAGAC -3' reverse primer: 5'- GTTCTTTATGCTAGCCACT -3' amplicon length 183 bp, and probe sequence: FAM 5'-AAACACACAACAGCATCGTCA-3' BHQ-1, on the N gene with forward primer: 5'-AATTCAACTCCAGGCAG -3' and reverse primer: 5'- CTCTCTCAAGCTGGTTCAATC -3' amplicon length 111 bp, and probe sequence: HEX 5'-CAGCAAAGCAAGAGCAGCA-3' BHQ-1 primary pair sequence and ORF1ab gene probe and N gene conjecture qualified for q-PCR. Conclusions: The obtained primary and probe pair sequences can be used as COVID-19 detection using the multiplex PCR method.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231261
  Issue No: Vol. 10, No. 5 (2023)
Prevalence of depression among secondary level students in Harion
Municipality, Sarlahi
- Authors: Pabitra Balampaki, Janak Kumar Thapa, Pramodh Chaudhjary, Raj Kumar Sangroula, Arati Dhoju Shrestha, Sumitra Pyakurel, Salina Thapa
  Pages: 1670Abstract: Background: Depression is a common mental disorder with a depressed mood, loss of interest or pleasure, decreased energy, feelings of guilt or low self-worth, disturbed sleep or appetite, and poor concentration. Globally the prevalence of depression among (15-19 years) males and females are 3.1% and 4.5% respectively. According to WHO, the prevalence of depression in Nepal is 3.2% and the prevalence of depression in (15-19 years) is 7.6%. This research was conducted to determine the prevalence of depression among the secondary-level adolescents of Harion municipality and to examine the variances according to socio-demographic factors, socio-economic factors, etc. Methods: Analytical cross-sectional study design was used in this research. Schools were selected through Simple Random Sampling. Participants were students of 9 and 10 selected schools. The PHQ9 (Patient Health questionnaire) was used to ascertain the prevalence of depression at various levels. Results: Out of 168 students, 97 (57.7%) students had depression. The mean age of the students was 16. Family type of students (p-value=0.036, 95% CI=0.261-0.959 and OR =0.5), students education level (p-value=0.044, 95% CI=0.273-0.986 and OR= 0.519) and physical activities (p-value=0.015, 95% CI=0.248-0.865 and OR=0.463) were found to be statistically significant. Conclusions: The prevalence of depression was seen higher among school-going adolescents in two schools in Harion municipality. There is a need for early identification of depression which can prevent other psychiatric disorders in teen-age.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231262
  Issue No: Vol. 10, No. 5 (2023)
Factors associated with depression among street vendors inside Kathmandu
valley
- Authors: Roja Thapaliya, Pramodh Chaudhary, Luna Adhikari, Raj Kumar Sangroula, Janak Thapa
  Pages: 1676Abstract: Background: Depression is considered a common mental disorder and a major contributor to the global burden of disease. Depression is estimated to affect 3.8% of the population including 5% of adults and 5.7% among adults older than 60 years, and approximately 280 million people in the world (WHO 2021). Major symptoms of depression include depressed mood, loss of concentration, feeling of excessive guilt, dying thoughts, disrupted sleep, changes in appetite etc. Street vending is informal work that has been contributing in millions of people living status and supporting country’s economy. Methods: A cross-sectional analytical study was conducted among street vendors inside Kathmandu Valley with sample size 316. The study period was from August 2018 to April 2019. Data was collected using standard semi- structured tools using Kobo Toolbox. Data analysis was done in SPSS. Mendeley desktop and statistical package of social science software was used. Results: Out of 316 respondents, higher number were male i.e., 52.2% whereas females were 47.8%. Respondent with age group 25-35 years was high in number. Respondents engaged in street vending for 8-16 years were found high in number. 32.6% respondents had depressive symptoms while measuring with PHQ and the prevalence of depression was 55.4% which was measured using MDI. Conclusions: This cross-sectional study was conducted among the street vendors of Kathmandu valley. Among the respondents with low economic status, lack of physical activity, habit of alcohol and smoking had higher prevalence of depression. Respondent with basic and non- formal education, lack of job and income satisfaction showed a positive association with depression.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231263
  Issue No: Vol. 10, No. 5 (2023)
Nutritional knowledge of mothers, children’s food consumption, and
stunting prevalence: a study of indigenous community in Kasepuhan of
Ciptagelar and Sinar Resmi, West Java, Indonesia
- Authors: Rita Patriasih, Ali Khomsan, Hadi Riyadi, Isma Widiaty, Faisal Anwar, Winati Wigna, Alya Firdausi
  Pages: 1686Abstract: Background: The indigenous community of Kasepuhan of Ciptagelar lives in villages that still hold the local traditions firmly. In contrast, the indigenous community of Kasepuhan of Sinar Resmi geographically live in more open villages, so they can easily interact with people from other villages. Culture contributes social values to food consumption and nutritional status. Methods: This cross-sectional study was conducted on the two indigenous communities from January 2015 until June 2016. The study involved selecting samples using stratified random sampling. The total sample was as many as 200 households. Results: The study found that 70.3% of mothers in Kasepuhan of Ciptagelar and 48.6% in Kasepuhan of Sinar Resmi have low nutritional knowledge (score <60). The households living in both Kasepuhans had high dietary consumption diversity. However, a household in Ciptagelar had a higher dietary diversity score (6.4±1.4) than in Sinar Resmi (5.7±2.0) (p=0.032). The foods taboo for pregnant mothers were meatballs, Reundeu leaves, durian, pineapple, and Ambon banana. The foods taboo for children under five were meat, chicken feet, chicken tail, chicken liver, chicken gizzard, and seafish. The stunting prevalence of children in Ciptagelar was 44.3%, while Sukaresmi was 22.9%. Conclusions: Based on those findings, the mother’s nutritional knowledge in Kasepuhan of Sinar Resmi was better than in Kasepuhan of Ciptagelar. The diversity of household food consumption in Kasepuhan of Ciptagelar was higher. However, there was a possibility that the nutritional intake of children in Kasepuhan of Ciptagelar was lower. Consequently, the stunting prevalence was higher in Kasepuhan of Ciptagelar than in the Kasepuhan of Sinar Resmi.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231264
  Issue No: Vol. 10, No. 5 (2023)
Awareness of lung cancer and its risk factors among population of Bisha
region
- Authors: Abdullah H. Alhalafi, Hanan B. Eltahir, Shehab M. Almalki, Abdulazez M. Alghuthaymi, Abdullah M. Almaawi, Abdullah Hajlaa, Abdulrhman A. Alshamrani, Faisal A. Alghamdi, Khalid F. Almuawi, Khalid Z. Alharthi, Saeed N. Alshahrani
  Pages: 1693Abstract: Background: Regarding to its case fatality rate in 2020, lung cancer is the leading cause of death among all types of cancers globally. Most of the risk factors that led to lung cancer were avoidable. The awareness of lung cancer among population of Bisha region were not explored before. This study aimed to assess the awareness of lung cancer and its risk factors, and its association with sociodemographic factors among Bisha population. Methods: A cross-sectional study was conducted between January 16, and February 15, 2022 among 376 Saudi adults living in Bisha region. The data were collected by using a self-administered questionnaire which was developed by using Google forms and distributed online. Data analysis was conducted using SPSS version 26. The descriptive statistics were represented with frequencies, and percentages. Chi-square (χ2) analysis and fisher exact test were used to compare categorical variables between the subgroups. Results: This study shows high level of awareness of lung cancer and its risk factors among the participants (93.4%). Analysis of sociodemographic factors associated with high level of awareness showed the awareness among females was better than in males (p=0.006), and the awareness among those who never smoked was higher than those who did smoke before (p=0.001). Conclusions: The level of community awareness was high about lung cancer and its risk factors. Health promotion programs significantly influence the level of awareness, and we recommend these programs to be continued.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231265
  Issue No: Vol. 10, No. 5 (2023)
Adherence to HIV pre-exposure prophylaxis (PrEP) among key populations
(KPs): an analytical cross-sectional study in Matayos Sub County, Busia
County, Kenya
- Authors: Joseph Wanyama Barasa, Atei Kerochi, Dominic Mogere
  Pages: 1697Abstract: Background: A large percentage of the new cases of HIV/AIDs in Kenya are attributed to Key Populations (KPs). In Kenya, KPs contribute 33% of all new infections of HIV. It is with this realization that in 2017 the government of Kenya launched The Pre-Exposure Prophylaxis (PrEP) for HIV. The study aimed at assessing the factors influencing adherence to PrEP by KPs in Matayos sub-county, Busia County, Kenya. Methods: An analytical cross-sectional study that utilized a mixed-method data collection approach (n=343) was used to assessing the factors influencing adherence to PrEP by KPs in Matayos sub-county, Busia County, Kenya. Results: The level of adherence to PrEP using the Morisky Medical Adherence Scale-4 was established to be 37% among all KPs and 36%, 37% and 52% among CSWs, MSMs and PWIDs respectively. Chi-square analysis revealed significant relationship between Level of education (p=0.05), marital status (p=0.001), KP category (p=0.034), occupation (p=0.014), stigma (p=0.00), the perceptions of side effects (p=0.011), facility accessibility (P= 0.00), side effects (p=0.001) and adherence to PrEP. Among the MSMs condom use was established to have association to PrEP adherence (p=0.00). Conclusions: The study concluded that socio-demographic, individual characteristics, and clinical factors influence adherence to pre-exposure prophylaxis among key populations. The study recommended that key populations need more information on how to use pre-exposure prophylaxis, how it works, the side effects, what to do in case they experience the side effects and why adherence to pre-exposure prophylaxis is important.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231266
  Issue No: Vol. 10, No. 5 (2023)
Differential of physical activities and its association with hypertension
and diabetes in Myanmar
- Authors: Hla Hla Win, Aye Sandar Mon, Win Pa Sandar, Martin Rusnak, Poppy Walton, Anil Krishna, Khin Hnin Swe, Jaap J. A. R. Koot
  Pages: 1705Abstract: Background: Myanmar has been facing a high and growing burden of NCDs. Since regular physical activity has been recognized as one of the effective strategies in prevention and control of NCDs, promotion of physically active lifestyle might help in combatting a number of NCDs. This study was conducted to assess the sociodemographic differentials of physical activity and to identify the association between the insufficient physical activity and occurrence of hypertension and diabetes using data extracted from Myanmar STEP-2014-data. Methods: This study was further data analysis on 2014 STEP survey and included (5791) 40-64-year-aged participants, a subsample of STEP survey. Binary logistic regression with clustered robust standard error method was applied to estimate the effect of insufficient physical activity on occurrence of hypertension and diabetes. Results: The findings revealed that 17.5% [95%CI: 16.5%, 18.5%] of participants had the insufficient physical activity, 41.9% [95%CI: 40.6%, 43.2%] had raised blood pressure and 16.9% [95%CI: 15.9%, 17.9%] had raised blood glucose. After adjusting other covariates, the significant association between insufficient physical activity and raised blood pressure was not found; whereas insufficient physical activity was significantly contributed to occurrence of raised blood glucose. Conclusions: The present study highlighted the importance of physical activity in occurrence of raised blood glucose. The proportions of insufficient physical activity, raised blood pressure and raised blood glucose were observed as a rising pattern with increasing in age. Community-based health promotion program targeted at promoting physically active lifestyle should be adapted to interventions that are appropriate to different age structures.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231267
  Issue No: Vol. 10, No. 5 (2023)
Relationship between spontaneous excretion of lower ureter stones with
stone size and serum level of C-reactive protein
- Authors: Hamid Deldadeh-Moghaddam, Sama Nasrollahi
  Pages: 1715Abstract: Background: According to the recent studies on patients with stones in the urinary system, the CRP serum levels can be useful in predicting the possibility of success in expectant treatment and spontaneous excretion of stone and thus, selecting the appropriate patient for this treatment approach; however the studies conducted in this field are inadequate and the results obtained are slightly contradictory. The aim of this study was to investigate the relationship between spontaneous excretion of lower ureter stones with stone size and serum level of C-reactive protein. Methods: This cross-sectional study has been done on 95 patients with lower ureter stone during 2020-2021. Information including gender, age, body mass index, stone size, spontaneous excretion of stone, and CRP serum level were extracted from the files of patients. The existence of stone and its characteristics have been confirmed using ultrasound. Results: The mean CRP serum level was 8.74±‏5.06 mg/l and the frequency of spontaneous stone excretion was 72.6% (n=69). CRP serum level was significantly lower in patients with spontaneous stone excretion (7.42 vs. 12.23 mg/l and p=0.001). The cut-off point of CRP serum level was 13.5 mg/l for patients with ureter stone size of 4-7 (with 84% sensitivity and 58% specificity) and for patients with ureter stone size of 7-10, it was 12.5 mg/l (with 83% sensitivity and 56% specificity). Conclusions: The results showed that there is a significant relationship between the CRP serum levels, along with stone size with spontaneous excretion of lower ureter stones.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231268
  Issue No: Vol. 10, No. 5 (2023)
Workplace barriers experienced by nurses in a tertiary level hospital
during COVID-19 pandemic
- Authors: Mina Akter, M. Ali Reza Mondol, Hafiza Sultana
  Pages: 1720Abstract: Background: Nurses as frontline workers are experiencing barriers while discharging their duties. So, identifying workplace barriers experienced by nurses during COVID-19 is important because they are the most vital component of medical care. The present study aimed to identify the workplace barriers experienced by nurses in a tertiary-level hospital during the COVID-19 pandemic. Methods: This descriptive type of cross-sectional study was conducted among 200 nurses who were working in the non-COVID unit at Dhaka Medical College Hospital, Dhaka. Sampling was done by convenience sampling method. A semi-structured questionnaire was administered to the respondents to obtain information. Data were collected through a face-to-face interview. Results: The study found that 83% of respondents were females, and the mean age was 31.8±5.5. 52.5% completed a diploma in nursing, 61.5% of their working experience was 1-5 years, and 53% were working in the inpatient department. The major barriers identified were lack of guidelines, shortage of PPE, inadequate training coverage, lack of area for doffing and donning, and inadequate social distancing. Statistical analysis showed that different departments of work had a significant association (p<0.05) with inadequate training coverage. Conclusions: The barriers identified in this study should be overcome to improve nurses’ experiences in the workplace and in turn the quality of patient care during the COVID-19 pandemic.
  PubDate: 2023-04-12
  DOI: 10.18203/2394-6040.ijcmph20231042
  Issue No: Vol. 10, No. 5 (2023)
Incidence and severity of COVID-19 infection among health care workers
following vaccination: a cross sectional survey in Maharashtra
- Authors: Aditya Kataria, Priyanka Kataria, Pradeep Suryawanshi
  Pages: 1726Abstract: Background: Despite the vaccines against COVID-19 being proven to be effective, there is the possibility of infection despite vaccination. Such risk may be potentially greater in healthcare workers (HCWs), because of enhanced rates of exposure to the virus at the workplace. The present study was executed to estimate the incidence of COVID-19 infection post vaccination as well as to assess its severity. Methods: A cross-sectional study was initiated in field practice area of one of the tertiary health care institutes in Pune district of Maharashtra. All 700 HCWs were investigated through questionnaire method and detailed data was collected about their vaccination status and related details. Data analysed using Jeffreys's amazing statistics program (JASP), version 0.17.1.0. Results: In the study, 29.23% of the participants showed COVID-19 infection after vaccination. The majority of clinical illnesses were of mild type. Vaccinated participants with pre-existing illnesses had more incidence of COVID-19 infection following vaccination and also the participants with complete doses had a significantly lesser rate of COVID-19 infection post vaccination compared to those with partial doses of the concerned vaccine. Conclusions: Vaccinated individuals pose less risk of severe COVID-19 infections following vaccination than those who are unvaccinated against COVID-19. Pre-existing disease is one of the major risk factors for enhanced incidence and severity of breakthrough infections.
  PubDate: 2023-04-12
  DOI: 10.18203/2394-6040.ijcmph20231041
  Issue No: Vol. 10, No. 5 (2023)
Risk factors for breast cancer among adult women residing in rural South
Karnataka: a cross sectional study
- Authors: Samantha Swaroop Komal, Srividya V.
  Pages: 1731Abstract: Background: There’s a steady increase in breast cancer incidence among rural women since rural women are increasingly adopting urban lifestyles, reproductive habits and are also increasingly exposed to similar environmental factors as urban women due to economic development. Objectives was to assess the prevalence of risk factors of breast cancer among women aged 30 years and above residing in a rural South Karnataka Methods: This cross-sectional study was conducted from June 2016 to January 2017 in villages under Ittamadu primary health centre area, Ramanagara Taluk, Ramnagara district. A total of 600 women aged 30 years or above participated in the study. A semi structured questionnaire was administered by interview method after getting written consent. Descriptive statistics and Chi-square test was used. Results: This study revealed that the prevalence of risk factors (reproductive and non-reproductive) of breast cancer among adult women aged 30 years and above was between the least prevalence of 0.7% for family history of breast cancer to highest prevalence of 37.5% for age at menarche at less than 13 years of age. Conclusions: Indian breast cancer patients present with advanced disease stage and have numerous poor prognostic factors, hence knowledge regarding the prevalence of risk factors is necessary to identify how many women are at risk of developing breast cancer as per the established risk factors to promote early detection and timely treatment for improved survival and quality of life of breast cancer patients.
  PubDate: 2023-04-12
  DOI: 10.18203/2394-6040.ijcmph20231043
  Issue No: Vol. 10, No. 5 (2023)
A cross sectional study on prevalence of hypertension and associated risk
factors among bus drivers of Metropolitan Transport Corporation Limited,
Chennai
- Authors: Sasikaladevi S. Singaravel, Elayaraja K. Kandaswamy
  Pages: 1740Abstract: Background: The job of bus driving is not only risky due to probable accidents and incidents but also risky due to probable health risk factors associated with the nature of bus driving. Sedentary work was done by many professional drivers and they were found to be physically inactive during their leisure time which lead to an increase in risk for obesity and hypertension. Therefore, this study was done with the aim to detect the prevalence of hypertension and its associated risk factors among metropolitan transport corporation bus drivers. Methods: A cross sectional descriptive study was conducted among bus drivers of metropolitan transport corporation Limited, Chennai. The sample size obtained was 422. A multistage sampling method was used. A Validated semi-structured questionnaire containing questions on basic socio demographic particulars, lifestyle factors, past and family history and anthropometric and blood pressure measurement was done and was analyzed using SPSS 21. Results: The prevalence of hypertension was found to be 49.5%. Smoking was found in 23.2% of the respondents, tobacco and betel nut chewing in 14.7% of the respondents and 45.5% were found to consume alcohol. It was found that as age increases the prevalence of hypertension also increases which was statistically significant (p=0.001). Conclusions: This rampant disease can be prevented and managed through lifestyle modifications and medication therapy. The risk factors may be avoided by maintaining a regular physical activity, focussing on dynamic exercise, having medical checkups.
  PubDate: 2023-04-12
  DOI: 10.18203/2394-6040.ijcmph20231045
  Issue No: Vol. 10, No. 5 (2023)
A cross-sectional survey on violation of cigarettes and other tobacco
products act around education institutions in Puducherry
- Authors: Lalithambigai Chellamuthu, Jenifer Florence Mary J., Kiruba Shankar G.
  Pages: 1745Abstract: Background: India is the second-largest tobacco consumer in the world and is responsible for around 1.3 million deaths every year. To achieve tobacco control amongst youth, it is essential that there should be strict enforcement of cigarettes and other tobacco products act (COTPA) in the vicinity of educational institutions. Objectives were to measure the violation of COTPA section 4 and 6 in Puducherry. Methods: An observational survey on COTPA violation was conducted over a period of three months in Puducherry among 300 educational institutions and tobacco point of sale (PoS). Two-stage sampling technique was used. Epicollectv5 incorporating the observational checklist was employed for data capturing and analysis was done with SPSSv24. The institute’s ethics committee approval was obtained. Results: 145 (48.3%) violated section 6b. Violation of section 6a was observed in the form of tobacco products sale by minors in 1 (0.7%) and tobacco products sale to minors in 58 (40%) amongst those 145 tobacco PoSs. Only 32 (10.7%) educational institutions complied to statutory display of “No smoking signage” board at the entrance of the educational institutions as per COTPA section 4. Active smoking was noticed within 100 meters radius in in nearly half of the institutions i.e., 133 (44.3%). Conclusions: This study showed that implementation of COTPA sections 4 and 6 in Puducherry to be deficient. It will need a concerted effort from all parties involved, including the police, educational institutions, and the local community to enforce strict implementation of the legislation for tobacco control.
  PubDate: 2023-04-12
  DOI: 10.18203/2394-6040.ijcmph20231046
  Issue No: Vol. 10, No. 5 (2023)
Knowledge, attitude and practices regarding financial markets and
management among the healthcare professionals
- Authors: Hafiza Khan, Shivayogi M. Hugar, Neha Kohli
  Pages: 1751Abstract: Background: The aim of the study was to assess the levels of knowledge, attitude and practices regarding the financial markets and financial management prevailing among the healthcare professionals. Methods: A cross-sectional study was conducted among 328 participants from health care profession which included different specialisations like Ayurveda, Homeopathy, Dental, Physiotherapy, Nursing and MBBS. A set of questionnaire divided into demographic data, knowledge, attitude and practices consisting of 17 questions was distributed among the participants. Software used for this descriptive analysis was IBM SPSS software (version 20.0 Chicago IL, USA). Results: Our study showed that the participants were more financially knowledgeable and had a positive attitude with older age and the participants from the Ayurveda had very poor financial knowledge and attitude. The correlation between Knowledge, Attitude and Practice was found to be highly statistically significant (‘p’=0.0001). Conclusions: The participants with older age had good levels of knowledge, practices and attitude but the younger participants had to be more educated regarding the importance of investments in the tools of financial markets and the importance of managing their finances to gain financial freedom must also be taught. Overall, financial literacy is supposed to be provided among healthcare professionals.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231269
  Issue No: Vol. 10, No. 5 (2023)
Outbreak of scrub typhus in western part of India: containment and lessons
learnt
- Authors: Barun Bhai Patel, Pranaya Gurmeet, Vipul Dutt, Harpreet Singh, Amit Sharma, Vivek Gupta, Kapil H. Pandya, Ganesh Madne, Indrakhi Bhattacharya, Paridhi Gupta
  Pages: 1759Abstract: Background: Scrub typhus is one of the most covert diseases of present era. Diagnosis is often missed, and tools for confirming diagnosis are often not available in resource-poor setups. The aim of the study was to investigate an outbreak investigation and suggests methods of containment. Methods: An epidemiological investigation of Scrub typhus outbreak though active and passive surveillance. Time, Place and person distribution, mean, median stand deviation were used during analysis. Results: Cases presented with high grade fever (100%), bodyache (91%) and headache (81%). Nearly, 22% cases presented with Eschar, 16% of blood samples were positive for OX-19 antigens, 9% blood samples were sent for enzyme linked immunosorbent assay (ELISA) and were positive for IgM antibodies. Conclusions: An outbreak of Scrub Typhus infection was successfully contained without any mortality by effectively using Chemoprophylaxis, judicial use of chemicals and personal protective measures.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231270
  Issue No: Vol. 10, No. 5 (2023)
A cross sectional study, for risk assessment of non-communicable disease
in urban slum of South India
- Authors: Snigdha Pattnaik, Pavani Varma, Sravya Mundla, Saba Syed, Neeta Mathur, Birinchi Narayan Das, Anu Mohandas
  Pages: 1764Abstract: Background: Non communicable diseases (NCDs) contribute to around 5.87 million deaths that account for 60% of all deaths in India. India shares more than two-third of the total deaths due to NCDs in the south-east Asia region (SEAR) of WHO. Objective was to monitor the trends and determinants of non-communicable diseases (NCDs) in the study population in slum of Telangana. Methods: The cross-sectional community-based study, was conducted in the urban field practice area of Apollo Institute of Medical Sciences and Research, Hyderabad. Sample size was estimated, data was collected in WHO STEPS questionnaire (STEP 1 and STEP 2) after obtaining informed consent from the participants. The performa included anthropometric measurements, blood pressure and questions related to tobacco use, alcohol consumption, dietary pattern, physical exercise. Microsoft Excel 2007 was used for data entry, SPSS version 24 for data analysis. Results: Tobacco smoking use in any form was seen in 22.1% males of the study population and 1.8% of females. The means waist hip ratio amongst male is 0.92 cm. The mean waist hip ratio amongst 113 voluntary participants was 0.89. Conclusions: NCDs in the urban slum that requires appropriate early actions to prevent risk factors, reducing the disease burden. Health education among households through behaviour change, formulation and implementation of health policy for urban slums will go a long way in lessening the burden.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231271
  Issue No: Vol. 10, No. 5 (2023)
Adoption and standardization of attitude scale for polio framed on
oversees population from underdeveloped area of West Bengal
- Authors: Taniya Sen Gupta, Atrayee Malik, M. Afsar Ali, Deb Prasad Sikdar
  Pages: 1768Abstract: Background: Study revealed fear from polio vaccination programme yet not completely has eradicated from the minds of immigrated communities resides in backward areas of Bengal. Due that, pre-established attitude tool was adopted for the formation of new tool for targeted population. Methods: Interestingly, attitude tool found almost similar result after 5 years of its first administration (on minorities). Foundation of tool was set on 3-point Likert type scaling style. Classical test theory (CTT) was followed in which popularity index and discrimination index were taken for item-analysis for pilot study. Results: CTT rejects 6 items and test-retest reliability with high r value 0.94 suggests the tool has excellent reliability. Standardized tool finally comes in 31 items with 9 different dimensions. Conclusions: CTT method as handy method for small sample item-analysis where popularity index and discrimination index used to refine values on which item-total correlation was administered on Pearson’s correlation at 99% confidence interval. Application of the same tool after some years in CTT method in constructing attitude tool have successfully applied.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231272
  Issue No: Vol. 10, No. 5 (2023)
A cross sectional study on perceptions and promoting factors for eye
donation among undergraduate medical students
- Authors: Priyanka Khatwani, Deepa Raghunath, Salil Sakalle
  Pages: 1775Abstract: Background: It is realized that voluntary corneal donation rate depends upon the level of awareness of various stakeholders in our society. the aim of the current study was to evaluate the characteristics that encourage eye donation among medical students. Methods: This study was carried out using a pretested self-administered questionnaire, in the month of February 2022 among 350 undergraduate medical students of a medical college in central India. After classes ended, authors delivered questionnaires to students in the classrooms, explaining the nature and aim of the study and requesting them to participate in the study. Results: 80% (280/350) of study subjects knew about eye donation. 54.8% (192/350) of study subjects were willing to donate their eyes. 89.1% knew that a big proportion of blindness is preventable. 98.6% of the study participants opined that vitamin A plays a significant role in preventing childhood blindness. three most important such factors as perceived by study participants were noble cause (44%, n=154), pleasure to support the blind people (36.3%, N=127) and inspiration from advertisement on TV by favorite actor (30%, N=105). 67.7% subjects said that blind religious beliefs are significant obstacle in eye donation. Conclusions: Majority of students support active participation in the dissemination of knowledge, lack of awareness is the primary impediment to cornea donation. The course curriculum should include both fundamental eye care and other preventive and promotive elements of corneal blindness.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231273
  Issue No: Vol. 10, No. 5 (2023)
A study to assess the pattern of alcohol and tobacco usage in the rural
field practice area of a medical college in Tamil Nadu
- Authors: S. Karthikeyan, T. Palanivel Rajan, J. E. Jeffin Shanu, S. Pandi
  Pages: 1779Abstract: Background: Tobacco usage and alcohol consumption is a serious health issue to the society for ages. The consumption of alcohol and tobacco usage leads to medical and societal issues. An assessment of the pattern of tobacco usage and alcohol consumption in adult population is important to estimate the burden, and the risk factors associated with the same on the rural communities. There is a strong impact on the prevalence of NCDs by reduction in the usage of tobacco and alcohol products in the forthcoming decades. Methods: A community based cross-sectional study was conducted in the rural field practice area of a medical college, using pre-validated, semi-structured questionnaire amongst 275 study participants a rural area. The adults aged 18 years and above who were currently using tobacco products and consuming alcohol were selected by simple random sampling using the tobacco assessment and AUDIT questionnaire for alcohol consumption. Results: The results showed a significant association between all the socio-demographic variables (except for gender) in the usage of tobacco products; the study found higher literacy levels in using the products more frequently. The age distribution, family arrangement and socio-economic status were associated with alcohol consumption as well. In the multivariate regression the socio-economic class were associated with alcohol consumption. Conclusions: The interventions should be targeted at the family and community level. There is a need for health education programs and de-addiction camps.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231274
  Issue No: Vol. 10, No. 5 (2023)
Coping up mechanism and financial aid scheme for cancer treatment at a
tertiary care hospital in Lucknow
- Authors: Rahul Verma, Naim Ahmad, Vijay Kumar Singh, Naseem Akhtar
  Pages: 1788Abstract: Background: Cancer treatment has one of most expensive disease treatment due to its chronicity and expertise. In a region where per capita income of persons/ annual income of household is low, they have to depend on some coping up mechanism or financial aid schemes for successful completion of treatment. But awareness and proportion of utilization of the financial benefit for cancer patient is doubtful. The present study aims to study coping up mechanism and financial benefits availed by cancer patients at a tertiary care hospital in Lucknow. Methods: The study was done in a tertiary care hospital in Lucknow. 120 cancer patients who had undergone treatment and come for follow-up were taken from surgical oncology OPD. Data was collected using an interview-based pre-tested, self-administered questionnaire and analyzed using MS excel 2017 and SPSS v 23. Results: About 64 % of participants borrowed money from social net, 3% took loans, 10% mortgage assets, and 20% sold their assets to cope up with high expenditure on cancer treatment. Financial benefit of schemes was availed by about 1/3rd of participants and 20% availed concessions in rail/road travel fare and 16% availed concessions in income tax. Conclusions: Large number of people had to use some of the coping up mechanism for treatment of cancer this further pushes them into viscous cycle of poverty And at same time they are unable to avail benefits of financial aid schemes by government and others for cancer patients. Thus, an increase in utilization and coverage of government financial aids or insurance is needed.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231275
  Issue No: Vol. 10, No. 5 (2023)
Contemporary image of nursing profession: an explorative study of Bihar
state
- Authors: Dolly ., R. Krishnaveni , Rathish Nair, Merlin Monica
  Pages: 1796Abstract: Background: Nurses currently contributing more than half of the manpower in the health sector and play a significant role in it, that is why the health sector is largely dependent on them but still they are largely invisible among people and their capabilities are limited in the field of their work that under-represents them. It has also been observed that many people have positive perception towards image of nursing profession which has become widely evident during COVID-19. The study aimed to determine the college students’ perception towards the contemporary image of the nursing profession. Methods: A quantitative research approach and descriptive cross-sectional research design were used. By adopting the purposive sampling technique, 420 college students were selected from the colleges and universities of Bihar. Data collected via online Based-Google form and analysed by using descriptive and inferential statistics. Results: Out of 420 student participants, 97.4% have positive perception and 2.6% students have negative perception towards contemporary image of nursing profession. Most of the responses were in positive feedback such as, nurses are hardworking, knowledgeable, they are vital to health care delivery system whereas few were in contrary. There was a statistically significant association found between socio-demographic variables and perceived image of nursing profession as depicted in domiciliary (p= 0.010) and educational status of father (p= 0.058), at the p-value <0.05 (typically ≤0.05). Conclusions: The study concluded that there is a positive perception among college students towards contemporary image of nursing profession.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231276
  Issue No: Vol. 10, No. 5 (2023)
Study to estimate impact of sudden lockdown due to COVID-19 pandemic at
the household level: findings of cross-sectional study in Tamil Nadu
- Authors: Vani Srinivas, V. Murugan
  Pages: 1803Abstract: Background: In response to contain the spread of coronavirus disease 2019 (COVID-19) in India, the entire country was declared to be under lockdown from the midnight of 24 March 2020. In this study, we determined the economic impact and availability of health services during sudden lockdown. Methods: A cross sectional study was done in rural and urban health and training centres attached to rural medical college of Chengalpattu district of Tamil Nadu. Sample size was 424. Study participants were out patients, seeking health care services. Data was collected by trained medical social workers (MSW), using field tested semi-structured questionnaire. Percentages were calculated and for assessing difference between proportions, Pearson’s chi-square test was used as a test of significance. Results: Out of 424 study participants, 223 (52.6%) were male and mean age of participants was 44 years. Socio economically, majority of them belonged to lower and lower middle-class families. 297 (70%) of households reported to have financial loss and 71.2% reported difference due to lockdown. In univariant analysis, the significant risk factors for difference in income were found to be type of house (0.029), loss of job (0.0001), loss of wages (0.0001), having bank loan (0.019) and issues in managing household expenses (0.0001), per capita income (0.008), farming business (0.018) and household with members having non-communicable diseases (0.013). Conclusions: Lockdown has huge economic cost. Underprivileged households were economically impacted. Most of the essential health services were available and accessible to the household even during the strict lockdown.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231277
  Issue No: Vol. 10, No. 5 (2023)
Assessment of knowledge of hypertension and its risk factors among urban
school children of Belagavi: a cross sectional study
- Authors: Praveena Gunagi, Disha Rama Harikanth
  Pages: 1811Abstract: Background: Hypertension has not just remained the disease of adults, but the prevalence is also increasing in children and adolescents. Knowledge of the predisposing risk factors of hypertension is an important step in the modification of lifestyle behaviours to prevent further morbidity and mortality. Methods: This cross sectional study was conducted among 270 students of 10th standard, belonging to 3 urban schools of Belagavi in 2016 using a structured questionnaire with an intention to assess their knowledge regarding hypertension and its risk factors. Results: Majority students (69.26%) belonged to class II and III of B.G Prasad socio-economic status and 70.37% came from nuclear family. While headache (80%) was the most answered symptom, heart diseases (67%) was the commonly answered complication. Most students had good knowledge regarding prevention and risk factors like unhealthy diet, physical inactivity etc. Majority had fair knowledge about general factors (54.81%), symptoms (41.11%) and complications (34.11%). Knowledge about stress factors (46.67%) and preventive measures (62.22%) was very good. All these differences were statistically significant (p<0.001). Conclusions: The overall knowledge about hypertension and its risk factors among the school students was good (68.52%) and there was significant association between the overall knowledge levels with the mothers education and family history of chronic diseases.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231278
  Issue No: Vol. 10, No. 5 (2023)
A study to assess the quality of sleep among medical students of Mysuru,
Karnataka, India
- Authors: Rachana K. Nair, Mansoor Ahmed
  Pages: 1817Abstract: Background: Every individual requires a period of rest to enhance and empower his/her work ability. Adequate quality of sleep is a prerequisite for optimal functioning of the students’ mind and body. Sleep problems are common in the general population. Medical students are one subgroup who are more vulnerable to poor sleep quality owing to multiple factors in their lifestyle. To assess the quality of sleep in a population of medical students of Mysore Medical College and Research Institute, Mysuru and to study the determinants affecting it. Methods: An institution-based cross-sectional study was conducted using convenience sampling among 132 medical students of Mysore Medical College and Research Institute. A pre-designed and pre-tested structured questionnaire developed using the Pittsburgh quality of sleep index (PQSI) Score and Epworth daytime sleepiness scale (EDSS) was used. The data collected was compiled in MS- Excel and analysed using statistical package of social sciences (SPSS)Version 20.0. Results: Out of 132 medical students who were enrolled in the study, 55.3% (73/132) had an abnormal PSQI score. Males had better quality of sleep compared to females. Abnormal PSQI scores were associated with stress, alcohol and smoking. Conclusions: Sleep quality plays a major role in maintaining a medical student’s physical, mental and working capacity.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231279
  Issue No: Vol. 10, No. 5 (2023)
Perceptions and practice of breast self-examination among adult women
residing in rural South Karnataka
- Authors: Samantha Swaroop Komal, Srividya Venkatakrishna
  Pages: 1822Abstract: Background: Breast cancer is the most common cancer in women and is the leading cause of death among women with 40-45 years old. The only way to manage this disease is early diagnosis through screening which helps in detecting breast cancer in 90% of women that it can be treated in about 90% of women. The best accessible and affordable way to screening is breast self-examination (BSE). The main objective of the study is to assess the awareness (knowledge, attitude and practice) regarding breast self-examination among women aged 30 years and above residing in a rural area. Methods: This cross-sectional study was conducted from June 2016 to January 2017 in villages under Ittamadu Primary Health Centre area, Ramnagara District. A total of 600 women aged 30 years or above who gave written informed consent participated in the study. A semi structured questionnaire was administered by interview method. Descriptive statistics was used for analysis. Results: This study revealed that the awareness regarding breast cancer among adult women aged 30 years and above was 4%. Majority of the study participants had poor knowledge regarding BSE, however they had favourable attitude towards BSE. With regard to practice of BSE, only 4% of the study participants practiced BSE. Conclusions: Breast self-examination is one of the most appropriate, convenient and cost-effective method that can be done by every woman for early detection of breast cancer and all women after the age of 18 years should be trained to do BSE correctly and regularly by healthcare workers and doctors.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231280
  Issue No: Vol. 10, No. 5 (2023)
Tobacco, alcohol use and underlying comorbidities in symptomatic COVID-19
cases versus asymptomatic COVID-19 cases: a case control study in Mumbai
city
- Authors: Ayushi R. Thaker, Anjali S. Mall, Annapoorani V. Iyer
  Pages: 1831Abstract: Background: Coronavirus disease-2019 belonging to Corona virus family, was first reported in Wuhan, China in November 2019 which is an ongoing Pandemic. The apparent vulnerable group more susceptible to the symptomatic infection are the elderly population, tobacco and alcohol users and people having underlying comorbid conditions. Methods: An unmatched case-control study was conducted in March 2021 through purposive sampling amongst the Covid-19 infected population. The socio-demographic details, use of tobacco, alcohol and underlying comorbid conditions were studied to show the association with symptomatic Covid-19 infection, in the population more than 18 years of age in Mumbai City. Results: Out of the total 528 Covid-19 infected individuals, 38.8% were symptomatic and 61.2% were asymptomatic. The elderly population and the underlying comorbid conditions were not found to be associated with symptomatic Covid-19 infection. Alcohol consumption (OR 0.87 (95% CI -0.39, 1.92)), and both alcohol consumption and smoking (OR 0.94[95% CI 0.45, 1.97) association with symptomatic Covid-19 infection were found to be insignificant at 95% CI in the present study whereas significant negative association was observed in smoking (OR 0.21 (95% CI 0.08, 0.53)) with symptomatic covid-19 infection. Conclusions: Covid-19, addiction and the non-communicable diseases together is a major public health concern in India. Since no significant association was found, study on other unknown factors like the genetics, race, ongoing treatment for underlying comorbid disease and other should be conducted to understand the actual risk factors of the novel disease.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231281
  Issue No: Vol. 10, No. 5 (2023)
The prevalence of musculoskeletal disorders among computer related
professionals of Dahod City, Gujarat: a cross sectional study
- Authors: Sanjay Kumar, Kishor N. Chinchodkar, Jayashri Bute
  Pages: 1836Abstract: Background: Use of any gadgets like Laptops/Desktops etc. on daily basis generates disorders in body. The term use to denote this disorder as ‘Musculoskeletal Disorder’ (MSD). Methods: Observational cross-sectional study was conducted by a random sampling method. A total 350 study subjects taken from Dahod city, Gujarat of various professionals like offices, institutions etc., who were working minimum one year with laptops/desktops at least four hours in a day with age 18-60 years. With the help of Neck Disability Index (NDI), Cornell Hand Discomfort Questionnaire (CHDQ) proforma data were collected. Descriptive statistics, Spearman’s correlation, Chi-square test and Binary logistic regression was used to find role of predictors with an increased risk of pain. Results: The mean±SD age of participants was 31.03±10.031 while males were higher than females (69.1% vs 30.9%). 53% subjects reported pain in hand, neck and/or back due to prolonged use of laptops/desktops. There exists positive correlation between NDI with CHDQ (r=0.57, p<0.001), significant association between working time (hours) and pain intensity (χ2=6.94, p<0.001). Computer use, age, gender, education were statistically significant predictors (p<0.05), with an increased risk of pain. Conclusions: The results of this study showed MSD at different areas of hand and neck, back site of the body. To prevent MSD’s some exercises, ideal posture at time of working on computers are recommended, for eye safety, professionals should regular check their eyes. Proper diet plan is proposed. With the help of these suggestions, one can increase work efficiency without MSD.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231282
  Issue No: Vol. 10, No. 5 (2023)
Community based cross-sectional survey to assess the conditions of
refractive error by eye-screening program in remote area of Saifai, Etawah
- Authors: Gaurav Dubey, Jamshed Ali, Zeba Hayat, R. K. Manik, Simi Afroz, Prasenjit Das, Sunil Kumar
  Pages: 1841Abstract: Background: Refractive error is a state where an optical system of the eye fails to bring parallel light rays on a point focus at the fovea, due to increase or decrease of the size of the eyeball through any reasons, changes in the refractive index of the component of the eyes or the age related factors. Methods: A community-based cross-sectional survey was conducted in the systemic random sampling without repetitions (SRSWOR) method at the circumference area of 5 km of the Saifai Medical University UPUMS Saifai, Etawah (Uttar Pradesh). The data was collected through the rural program for the control of blindness. Among 1032 samples, for the refractive error, total 237 individuals were registered for the study through the screening programme. Results: The age group 0-19 years concludes 22 (9.28%), for 20-39 concludes 71 (22.95%), for 40-59 years concludes 101 (18.14%) and for the age group above 60, it was 43(48.94%) respectively. Among all the age groups a total of 22.96% responders were diagnosed for the prevalence of refractive error and it was observed more for females 50.63% as compared to males 49.36%. Conclusions: The prevalence of refractive errors refers to the age group of 40-59 years, so for early diagnosis eye care must be included at a particular time difference at a community level through an eye screening program for all the age groups with the main intention to give special cover to the age group of 40-59 years.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231283
  Issue No: Vol. 10, No. 5 (2023)
Comparative evaluation of effectiveness of calibrated inter-dental brushes
in maintaining oral hygiene and periodontal health: a randomized
controlled clinical trial
- Authors: Shweta S. Hugar, Abhirami Sureshbabu, Tanay Misra, Vinayak Kumbhojkar
  Pages: 1846Abstract: Background: Effective oral hygiene is a crucial factor in maintaining good oral health, which is associated with overall health and health-related quality of life. The control of biofilm is the common pillar of the prevention and control of periodontal disease. The interdental brush (IDB) currently represents the primary and most effective method available for interproximal cleaning compared with brushing alone or the combined use of tooth brushing and dental floss. Methods: A total of 40 participants, with 10 each in control and test group, participated in the study. Clinical examination of gingival index, full mouth bleeding scores and plaque index were recorded supra gingival scaling was performed. Test group- interdental brushes were given and oral hygiene instructions were given through Touch-to Teach method (TOP). At 4 week and 6 week follow up oral hygiene instructions were repeated to respective groups. After 3 months, clinical examination was done and exit survey on patient-reported outcome measures was administered. Results: Intergroup comparison of gingival index, plaque index and pocket probing depth showed statistically significant difference between test and control group. Conclusions: Within the limitations of the study, we concluded that the appropriate use of interdental brushes along with effective oral hygiene maintenance using TOP permitted proper cleaning of the area with a significant reduction in plaque and gingivitis.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231284
  Issue No: Vol. 10, No. 5 (2023)
Organising free health camp: insight into the approach of public and
private sectors hospitals
- Authors: Mukunda Chandra Sahoo, Siddharth Mishra, Manish Taywade, Ramkrishna Mondal
  Pages: 1851Abstract: Background: World Health Organization in the year 2019, World Health Day has focused on Universal Health Coverage, with the theme Health for all - everyone, everywhere. It is essential to provide basic primary care to every stratum of society. This article discussed organizing a mega health camp by an institute of national importance in eastern India and the insight into the approaches. Methods: Community-based mega health camp organized at the satellite center to address the medical and surgical problems and their effective management. The organizers are interviewed based on structured questionnaires. A few Marketing personnel were interviewed, and a focused group discussion was made for the beneficiaries to understand their feedback. Results: Total number of patients who availed of the consultation is 2485. The maximum number of patients reported to the specialties like Dermatology (487), Neurology (332), General Medicine (273), Orthopaedics (270), Eye (266), Endocrinology (191), Gastroenterology (188), ENT (153). Conclusions: Meticulous planning within a brief span of time, statutory compliance, event awareness, support of opinion leaders, collaborative efforts, and community involvement are some of the crucial factors contributing to the massive success of a camp. A divergent approach towards health camps by public and private sector hospitals is essential.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231285
  Issue No: Vol. 10, No. 5 (2023)
Trend of mosquito larval indices over a year in a rural area of Thrissur
district, Kerala
- Authors: Mohamed Rafi M., Jose Vincent, Saju C. R., Franco Johny V.
  Pages: 1856Abstract: Background: Dengue is the most widely distributed viral disease in the world. Outbreak are usually seasonal, peaking during and after rainy seasons. Entomological surveillance is important in determining the factors related to disease transmission in order to prioritize areas and seasons for vector control. The objectives of the study were to determine the larval indices of aedes, assess the seasonal trend in larval indices and determine the major breeding site of Aedes mosquitoes. Methods: A longitudinal study was conducted over a period of 12 months from January to December in Thrikkur panchayath area. From the total of seventeen wards, 4 wards are randomly selected and from these, 75 houses are randomly selected. Results: From the surveyed houses 959 wet containers were examined of these 180 were found positive. Wet containers, positive containers and positive houses were more identified during rainy season. The most common site for vector breeding as per the survey was identified to be plastic containers. Aedes albopictus was the major species identified. Since the breteau index is between 5 -50, the area studied is considered as moderate risk for epidemics. Conclusions: Results of the study indicated that the vector indices were more during monsoon period. So, control measures need to be adopted with much vigour even during the pre-monsoon and need to continue during the monsoon season also. Plastic containers were a major source of vector breeding and Aedes albopictus was the commonest species identified.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231286
  Issue No: Vol. 10, No. 5 (2023)
Prevalence of musculoskeletal disorders in delivery personnel
- Authors: Revathi Srinivasan, Ahsan Reza, A. K. Vijay Krishna Kumar
  Pages: 1861Abstract: Background: Musculoskeletal problems are widespread in the elderly, but they are also becoming more common in the younger population as a result of changes in lifestyle and employment. In this study we will be assessing the musculoskeletal disorders in delivery personnel. Methods: 200 delivery personnel took part in an offline survey at several e-commerce companies’ delivery hubs as part of this observational study, based on inclusion and exclusion criteria. In addition to questions from the Nordic Questionnaire, the form included basic demographic information. Results: The current study showed that the musculoskeletal pain in the last 12 months showed the prevalence was higher for lower back 60(30%) followed by 18(9%) for neck. The seven days prevalence showed 43(21.5%) for lower back followed by 11(5.5%) for neck. Prevention to do the work due to the pain in last 12 months showed highest percentage of the respondents experienced it due to lower back pain. The statistics further showed majority of people who had musculoskeletal pain from last 12 months were working for more than 8 hours per day (52.3%). Conclusions: We can conclude that MSDs are common in all three groups, namely pain in the past year, pain in the past week, and activity prevention. This incidence demonstrates that MSDs can impact delivery personnel even at younger ages, which can be avoided by reducing workload and observing adequate safety procedures while working.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231287
  Issue No: Vol. 10, No. 5 (2023)
Changing morbidity-free life expectancy in India by gender and place of
residence
- Authors: Shewli Shabnam
  Pages: 1867Abstract: Background: With declining fertility and increasing life expectancy, India faces a growing burden of chronic diseases. Therefore, research in morbidity-free life expectancies (MFLE) is gaining importance in India. This study explores the changes in MFLE among males and females and rural and urban residents in India between 2004 and 2017-18. Methods: The Sullivan method was used for estimating MFLE. Age-specific morbidity rates were computed from the 60th and the 75th round of the National Sample Survey (NSS) data. The information on mortality was collected from the Sample Registration System life tables of India for the periods 2002-06 and 2014-18. Results: In India, the morbidity-free life expectancy of both genders improved between 2004 and 2017-18, except for the population 80 years and above. Life expectancy (LE) and MFLE were higher among women in India, but the proportion of MFLE to total LE was higher among men in most age groups in 2004 and 2017-18. This contradiction is known as the gender health paradox. The study found that LE was higher in urban areas, but MFLE was lower among the urban population except for infancy and early childhood. Conclusions: The gender health paradox prevails in India for most age groups. As the proportion of MFLE to total LE can be viewed as an indicator of the quality of life, it is crucial to set the target of lowering the morbidity rates among women and the urban population.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231288
  Issue No: Vol. 10, No. 5 (2023)
Body image perception and body image satisfaction among female medical
students of Mysuru
- Authors: Rakesh M., Sunil Kumar D., Mythily M. R. , Annaram Ravali, Hari Prakash G.
  Pages: 1877Abstract: Background: Concerning one's appearance too much can result in sadness, anxiety disorders, disrupted eating habits, and nutritional deficiencies. In India, the idea of body image has received less attention, particularly among young females. The objective of the study is to assess the body image perception and satisfaction among female medical students of Private Medical College, Mysuru. Methods: This cross-sectional study was conducted among 210 female medical students of a Private Medical College in Mysuru using a self-administered questionnaire containing details of sociodemographic information and a validated visual analogue scale. Anthropometric measurements were taken using calibrated instruments. Data was analysed using SPSS version 26. The percentage was calculated for descriptive variables. The chi-square test was applied for analysing categorical variables. Results: The majority of the participants (37.1%) had a neutral perception regarding their body image followed by 33.8% are satisfied and 24.2% are unsatisfied regarding their body image. Body image perception showed that the majority (52.3%) of them had normal weight. Unhealthy weight-changing patterns like skipping meals (24%), and increasing the quantity and frequency of meals (17%) were reported among study participants. Conclusions: From the present study, it can be concluded that 37% had a neutral perception and 24% are unsatisfied with their body image. Psychological parameters like feeling anxious, lack of confidence, and attempts to change their body weight are associated with body image perception which may further result in affecting their mental health.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231289
  Issue No: Vol. 10, No. 5 (2023)
Incidence and probable risk factors of post COVID syndrome among COVID-19
patients in urban population of North Kerala: a 6 months cohort study
- Authors: Deepa K. R., Bindu Mohandas, Jayakrishnan Thayyil, Meera S. Nair, Rosh P., Durgesh Kumar
  Pages: 1882Abstract: Background: Post-COVID condition is an important health burden all over world. This study was conducted to determine incidence, symptoms and risk factors of post COVID syndrome. Methods: Cohort study was done on COVID-19 patients of Mukkam Municipality tested from Mukkam Community Health Centre. Baseline data was collected using pre-tested semi-structured questionnaire by direct interview method after obtaining their consent. Subjects were followed up weekly for 6 months to know occurrence of post COVID syndrome, its course and outcome if any. Incidence and relative risk for age, gender, COVID-19 vaccination status, comorbidities and severity of COVID-19 illness were assessed for post COVID syndrome. Chi-square test was used for statistical association between severity of COVID-19 and occurrence of post COVID syndrome. Results: Among 800 persons tested for COVID-19, 28.75% were tested positive. Incidence of post COVID syndrome among study subjects was 42.2%. Relative risk for post COVID was high among participants having age more than 60 years (RR-1.76), females (RR-1.07), with comorbidities like diabetes (RR-1.28), hypertension (RR-1.06) and cardiac illness (RR-1.05), unvaccinated status (RR-1.21) and in severe COVID-19 infection (1.20). There is a significant statistical association between occurrence of post COVID syndrome and degree of severity of COVID-19 disease (p=0.0046). Conclusions: Post-COVID syndrome was found more often in older people who had severe COVID-19 illness, also incidence increases with severe COVID-19 illness.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231290
  Issue No: Vol. 10, No. 5 (2023)
Impact of COVID-19 on community medicine education and
training-postgraduates’ perspective: a qualitative exploration
- Authors: Makineedi Rama Lakshmi, Devi Madhavi Bhimarasetty, K. V. Phani Madhavi
  Pages: 1889Abstract: Background: World Health Organization on March 11, 2020 announced, the coronavirus disease 2019 (COVID-19) as pandemic. It has affected nearly every nation with remarkable alterations on everyday life. COVID-19 has had heartfelt impact on the medical education worldwide. Closure of the medical schools and universities has disturbed the education of future health professionals. During this pandemic, most educational institutions have opted for online education to protect their students. Online education has been gaining encouragement in almost all countries around the world. This coincides with the recently introduced competency-based medical education in India which has adopted online education. This created a new challenge for the institutions involved, the instructors and the students since they must adapt quickly to this new mode of learning. Methods: A Qualitative approach using Systematic methods (Free listing and Pile sorting) was done among postgraduate students during the month of September 2021. A total of 32 postgraduates were included in the study. Results: A total of 32 postgraduates were included. Among them 23 (72%) were females and 9 (28%) were males. According to salience score, effects of COVID on medical education in postgraduates’ perspective in decreasing order are loss of academics, reduced clinical exposure, less student teacher interaction. One positive effect is new era of E-learning. Pile sorting resulted into two piles academic loss and technical issues. Conclusion: COVID-19 has created a lot of impact on medical education creating psychological stress more due to online education and academics are hampered due to COVID duties.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231291
  Issue No: Vol. 10, No. 5 (2023)
Perception about substance abuse among the medical students in
Visakhapatnam, India: a qualitative research
- Authors: Pissey Saikiran Santosh, Nivetha Arvind, Devi Madhavi Bhimarasetty, Jalakam Venkata Sivapriya
  Pages: 1893Abstract: Background: Substance abuse is an emerging disorder of global concern. In India about 14.6% of the population (between 10 and 75 year of age) uses alcohol. Also, 28.6 percent (266.8 million) of adults in India, aged 15 and above currently use tobacco in some form. Youth period is an important transition period where students may begin to consume alcohol, tobacco, and other substances. Methods: A Qualitative approach using systematic methods i.e., Free listing & Pile sorting, Conducted among third professional year students in a Medical College of North coast Andhra Pradesh. Analysed by Cultural domain analysis using Visual Anthropac Pile sort version1.0.1.36 based on salience scores. Results: A total of 13 medical students were included. Among them 9 (69%) were females and 4(31%) were males. Stress was found to be the major cause for substance abuse with salience score of 0.418, followed by peer pressure (0.402). The solutions for among them parental guidance is the best solution for substance abuse with highest salience score of 0.412, followed by awareness about consequences (0.409). Conclusions: Our study reveals that it is necessary to bring positive behavioural changes through adoption of comprehensive interventions, counselling methods and health education in medical universities.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231292
  Issue No: Vol. 10, No. 5 (2023)
Prevalence and pattern of alcohol consumption among women of reproductive
age group in urban settings of Sikkim: a cross sectional study
- Authors: Bemma Konthoujam, Sumit Kar, Vijay Kumar Mehta, Sanjiba Dutta
  Pages: 1897Abstract: Background: Alcohol consumption by women of reproductive age group not only affects their health but can also cause multiple adverse birth outcomes. The objectives of the study were to assess the prevalence and pattern of alcohol consumption among women of reproductive age group in urban field practice areas of Sikkim Manipal Institute of Medical Sciences (SMIMS) by using a structured questionnaire and WHO tool, AUDIT (Alcohol Use Disorder Identification Test). Methods: The study was a cross sectional study. A total of 284 women of reproductive age group (15-49 years) were interviewed using a structured questionnaire and AUDIT. Results: The overall prevalence of alcohol consumption was 36.6%. Proportion of alcohol users was more among women of 25-34 years. Almost 95% of the women are current users (alcohol use in past 12 months). Beer was mostly preferred over other types of alcoholic beverages. Social customs (36.5%) and stress (25%) were the main reasons for consumption of alcohol. Based on AUDIT score, low risk drinking 68.6% was the predominant drinking pattern reported. However, one fourth of the women fall into hazardous pattern of drinking and 3 out of every 100 women had harmful and dependent pattern of drinking respectively. Conclusions: The present study highlights the prevalence of alcohol consumption among women of reproductive age group in urban field practice areas of SMIMS. Socio-cultural factors and stressful life plays an influential role in consumption of alcohol. Although low risk drinking is the predominant pattern of alcohol use, an alarming 31% of women consuming alcohol are at risk of developing alcohol related harm.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231293
  Issue No: Vol. 10, No. 5 (2023)
Barriers and facilitators to seeking care for persons with acute brain
infections: a cross sectional study
- Authors: Vasundharaa S. Nair, Priya Treesa Thomas, Kasi Sekar, M. Netravathi
  Pages: 1905Abstract: Background: Acute brain infections including encephalitis are less common but serious conditions characterized by the inflammation of the brain requiring immediate accurate diagnosis and management. For many infections appropriate therapies exist, but the outcome is often less desirable because of failure to receive appropriate treatment on time due to multiple factors. The aim of the study was to understand the barriers and facilitators towards receiving care for persons with acute brain infections in a low resource setting. Methods: The study design was cross sectional exploratory study. Consecutive patients presenting to neurology department of a tertiary referral care center for Neuropsychiatry in South India from July 2020 to September 2020 with the diagnosis of acute brain infections were assessed using the modified Kuppuswamy scale, Glasgow coma scale, the pathway scale: encounter form, patient centered health services in India and client socio-demographic and service receipt inventory. Results: A total of 110 participants, both male and female, were recruited for the study. The average age was 39.64±16.5 years, with more female (65.45%) representation. 29% of individuals reported continued use of traditional practices while seeking care for the brain infections. Costs associated with care increased with the increase in duration of infection. There are major barriers and facilitators which either prohibit or facilitate care for persons with acute brain infections. Conclusions: Acute brain infections continuing to be a public health challenge in developing country context, and the recognition that the delay in treatment causes significant disability, it becomes imperative to focus on the social, cultural, economic, environmental factors to understand the barriers and facilitators to health seeking among this population.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231294
  Issue No: Vol. 10, No. 5 (2023)
Burden of stigma among tuberculosis patients: a cross-sectional study
- Authors: Swarna S. K. Kallepalli, Sridevi Garapati, Devimadhavi Bhimarasetty, Sujatha Pethala
  Pages: 1911Abstract: Background: Tuberculosis (TB) is a significant public health problem in populous countries like India. Despite having effective treatment, social stigma still exists and it manifest as social exclusion (enacted stigma) or perception of it (felt stigma). The main causes of stigma are fear of TB and the terrible effects the disease will have on affected people and their family’s health, finances, personal lives, and social standing. Delay in diagnosis and treatment are brought on by stigma, resulting in adverse treatment outcomes and thus prevent TB from being eliminated. The objectives of the study were to (a) estimate the burden of stigma experienced by tuberculosis patients; and (b) identify the factors associated with stigma. Methods: A cross-sectional analytical observational study was carried out among 100 TB patients above 18 years of age in the months of September - November 2022. Multistage random sampling was used to select the study participants from different peripheral health institutes. Data was collected using predesigned, pretested proforma from explanatory model interview catalogue developed by WHO. Data was collected after obtaining informed consent and analysed by using SPSS 21. Results: Majority of patients (59%) perceived stigma. Many (73%) revealed that they desire to keep others from knowing about their condition, felt that others would think less of patient’s family (66%) and avoided them (69%) due to disease. Conclusions: Patients with TB still experience greater stigma at home, among friends, and at work. Sensitization of family and awareness among the public is essential to combat stigma.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231295
  Issue No: Vol. 10, No. 5 (2023)
Health status and health seeking behaviour in transgenders in Kakinada: a
community based cross-sectional study
- Authors: Anantha Prakash Veesam, Devi Madhavi Bhimarasetty , Suhasini Vasireddy
  Pages: 1917Abstract: Background: Transgender (TG) is a term used to define individuals with a gender identity that is incongruent with the gender identity accorded to them at birth. Over the last two decades, health research on TGs has focused mainly on their sexual practices, leading to lack of information on their health problems and healthcare-seeking behaviour beyond STDs /HIV. The current study aimed to gain insight into the health status of TGs. Methods: A community based cross-sectional descriptive study was carried out in transgenders living in an urban area from December 2022 to January 2023 with a sample size of 160. Snowball sampling technique was used till the sample size was achieved. Data was collected using a pretested semi-structured questionnaire. Data was entered and analysed in MS Excel with descriptive statistics. Results: Majority of the study subjects belonged to 20-30 years of age. 43% were illiterates, 87% were living in rented houses. 89% screened for HIV in last 6 months, 57% underwent gender reassignment surgery. All study subjects gave history of suffering from STIs at least once, 11.9% were experienced STDs in past 1 year. 6.9% were tested positive for HIV and were on regular ART. 23.1% were diagnosed with anyone of NCD. First point care is contacting outreach worker in 58.8% of TGs. Conclusions: A more receptive attitude from the entire healthcare system is essential for improving the health status of this community. The inclusiveness promoted by universal health coverage will help each of these people's health statuses improve.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231296
  Issue No: Vol. 10, No. 5 (2023)
A retrospective study on newly diagnosed Hansen’s disease and its
spectrum in a tertiary care hospital
- Authors: Siddabathuni Nageswaramma, Sampath Priyakumar Talamala, Swathiga S. P., Vani Talluru
  Pages: 1922Abstract: Background: Leprosy, a well known ancient disease caused by the pathogen Mycobacterium leprae. Leprosy became curable with the introduction of multi drug therapy (MDT). But the burden of the disease still continues to make an impact in the present society. India is one of the major contributors to the global leprosy case load even after elimination. The main aim of this study was to assess the clinical pattern of newly diagnosed leprosy patients and to emphasize the need of timely intervention. Methods: This was a hospital based retrospective observational study. The medical records of all the newly diagnosed leprosy patients during the period of January 2022 to December 2022 were collected and various clinical and demographic factors were analyzed. Results: Total 139 newly diagnosed leprosy cases were reported. The most common age group affected was 45-60 years. Males were predominantly affected than females. 128 cases were multibacillary leprosy and 11 were paucibacillary. Borderline tuberculoid (48.2%) was the most common spectrum noted. About 19.4% patients presented with lepra reactions and 25.17% patients presented with deformities. Conclusions: Newly diagnosed leprosy cases show that leprosy is active in the society. Active case detection by household contact survey and timely referral &treatment initiation and follow up by the field staff of health facility will prevent disability and stigma.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231297
  Issue No: Vol. 10, No. 5 (2023)
Adverse events with COVID-19 vaccination (precaution dose) among the
elderly population aged 60 years and above in South India
- Authors: Anju Damu Ade, Chandrashekhar Vallepalli, Visweswara Rao Guthi, T. V. D. Prathyusha, K. Nagraj
  Pages: 1926Abstract: Background: India started administering the precaution dose or the Booster dose of COVID vaccine from 10 January 2022 to comorbid people aged 60 and above. To identify the adverse events with COVID-19 vaccination (precaution dose) among the elderly population aged 60 years and above. To determine the association between adverse reactions and sociodemographic factors, morbidity profile and previous history of COVID 19. Methods: This cross-sectional study was undertaken at COVID- 19 vaccination centre, of SVIMS, Tirupati. AP from January 2022 to July 2022. Data was collected by interviewing the study subjects. Study respondents who received COVID-19 vaccine were observed for a period of 30 minutes and after 48 hours, study participants were contacted through telephone to find out any vaccine related adverse effects. Results: Overall, 676 of 60 years or older received their precaution dose. Majority of the respondents were in 60-70 years age group (60.8%) males (n=397, 58.7%) were higher than females (n=279,41.3%). Out of 676, 34 (5.0 %) participants reported adverse effects after 1st or 2nd dose. With regard to precaution dose, only 43 (6.4%) reported adverse events within the 30 minutes of receiving COVID-19 vaccine. While 54 (8.0%) reported adverse events in last 48 hours after receiving COVID-19 vaccine (precaution dose). Spectrum of symptoms reported were fever, anxiety, dizziness/giddiness, body pains, headache, nausea, pain at injection site, pain in abdomen, swelling at injection site, rash. Conclusions: Only 43 (6.4%) reported adverse events within the 30 minutes of receiving COVID-19 vaccine while 54 (8.0%) reported adverse events in last 48 hours after receiving COVID-19 vaccine(precaution dose).There were no reports of serious adverse effects.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231298
  Issue No: Vol. 10, No. 5 (2023)
Awareness regarding oral health among women with polycystic ovary
syndrome: a qualitative study
- Authors: Nivedha K., Aparna S., Parangimalai Diwakar Madankumar
  Pages: 1933Abstract: Polycystic ovary syndrome (PCOS) is a common endocrine disorder among women of reproductive age. The PCOS primarily affects the reproductive system, with substantial collateral negatively health effects on metabolic, psychologic, and cardiovascular functions. Women with PCOS have increased pro-inflammatory cytokine levels, and this inflammation can lead to several “oral health problems” which are often ignored by patients. This qualitative study aims to explore the knowledge and the impact of oral health in women with PCOS. An in-depth interview was conducted among women with PCOS (aged between 18-35 years) who were diagnosed based on the Rotterdam’s criteria, within the time period of July 2021 to August 2021. Sampling was purposive and continued until data saturation was reached. Data were analysed using the thematic analysis technique with NVIVO 10.0 software (Numerical Analytics Instruments). The analysis of the data helped to extract the main theme of the research as “PCOS impact on oral health” under 3 main category themes and 8 sub-category themes. There is a need for education at the community level to increase general awareness and to understand the condition. Better awareness could also help women to recognise possible symptoms and prompt them to seek help, leading to more timely diagnoses.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231299
  Issue No: Vol. 10, No. 5 (2023)
Association of hypertension with consumption of energy drinks in an
adolescent male
- Authors: Kanuja ., Vineet Kumar Pathak, Sunil Kumar Chamola
  Pages: 1939Abstract: Use of energy drinks has dramatically increased in recent times. Athletes, teenagers and students being the most common population who consume it. Users believe that they are a source of instant energy but are unaware of its high Caffeine content resulting in severe adverse effects on health. We reported the case of a young boy who presented with palpitations and high blood pressure after a recent start of energy drink consumption. He had been consuming ‘monster’ energy drink on regular basis as his annual sports meet was round the corner and he had to practise for hours for an upcoming football match. His medical examination revealed Sinus tachycardia and high blood pressure on more than 3 occasions. Rest of the physical examination and lab workup was within normal limits. His pulse and blood pressure returned to normal range after discontinuing ‘monster’ energy drink usage and he was counselled on adverse effects of such products. Several studies have reported numerous health hazards including cardiac effects associated with energy drinks. Labels should be made on these drinks and Caffeine content should be mentioned along with adverse effects on health. Caution for use in children and pregnant or expecting patients should also be mentioned.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231300
  Issue No: Vol. 10, No. 5 (2023)
A global perspective on cervical cancer screening: a literature review
- Authors: Lubna Rauf, Ahmed Eid, Ehab Hamed
  Pages: 1942Abstract: Cervical cancer is a significant health issue for women globally, with over 600,000 new cases and 342,000 deaths in 2020. Effective cervical screening programs, including primary screening methods such as Pap tests, human papillomaviruses (HPV) deoxyribonucleic acid (DNA) testing, and liquid-based cytology, can prevent and detect early cancer cases, improving morbidity and mortality rates. However, screening uptake varies widely across countries, with high-income countries have achieved over 70% uptake but low- and middle-income countries lagging due to a lack of recommendations and centralised screening systems. Even in high-income countries in the Middle East, uptake remains low, requiring further investigation. This review explores barriers to screening programme delivery and highlights centralised and multi-level interventions that have proven effective worldwide. Future research should focus on culturally sensitive approaches, healthcare infrastructure strengthening, and community education and outreach programs to address uptake disparities and barriers.
  PubDate: 2023-04-12
  DOI: 10.18203/2394-6040.ijcmph20231044
  Issue No: Vol. 10, No. 5 (2023)
Road to universal health coverage: unique model of Karnataka, India
- Authors: Pooja Sancheti, Suresh G. Shastri, Pujari K. Srinivas , Gagana G. Dayananda, Murugesh Jayaprakash, Shivashankara N. Ninge Gowda, Sudha Chandrashekar, Sushil K. Ichini, Mohamed Asif, Sangeetha M. R., Randeep Devendiran
  Pages: 1947Abstract: With the goal of achieving universal health coverage (UHC), Karnataka, a national leader in healthcare, launched the Arogya Karnataka scheme in March 2018. It was later integrated with the government of India's national health protection scheme Ayushman Bharat Pradhan Mantri Jan Arogya Yojana (AB-PMJAY) to help with financial protection for accessing curative care at the secondary and tertiary levels through collaboration with the public and private sectors. The AB-PMJAY is a rare opportunity to enhance the health of hundreds of millions of Indians and get rid of a significant cause of the country's poverty. The study intends to define the State's distinctive characteristics with relation to AB-PMJAY-ArK and to highlight the State's top initiatives through the scheme. Karnataka has a unique scheme even if it is integrated due to various striking features. The country has an opportunity to address persistent and deeply ingrained issues with governance, quality assurance, and stewardship owing to AB-PMJAY-ArK. The complete approach used by the AB-PMJAY-ArK cell of the department of health and family welfare, government of Karnataka has enhanced the performance of public health institutions and can be adopted as a model by all the Indian States. Access to care, compliance, and timely assistance have all drastically enhanced. This has improved national health indices, but more crucially, it has led to the development of a bigger and stronger public health system, leading the road to UHC.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231301
  Issue No: Vol. 10, No. 5 (2023)
Artificial intelligence in dental practice: a review
- Authors: Reemitha P. Prasannam, Priyanka A. Arul Murugan, Rajesh L. Narayanan, Mahesh Jagadeson, Vishnu Prasad S., Indrapriyadharshini K.
  Pages: 1955Abstract: The human brain is a distinctly complex structure with several interlinked neurons that transmit signals all over the body. The search for an excellent model mimicking the human mind has led to a sophisticated breakthrough in what's referred to as artificial intelligence (AI). AI methodologies have determined programs in numerous disciplines ranging from telecommunication, aerospace, robotics, medical analysis, alternate marketplace, law, science, or entertainment to name some. Medical clinical decision support system (CDSS), a factor of AI is being carried out in dentistry which includes Artificial neural networks (ANN), genetic algorithms (GA) and Fuzzy logic. Various fields of drugs such as diagnostic systems, biomedical analysis, image analysis, and drug development have utilized this complicated and tremendously advanced detail of AI. The AI systems along with virtual reality have been used now not handiest to lessen dental anxiety but also to appear as an effective tool for the non-pharmacological manipulation of pain. Ordinary, AI offers us a glimpse of the destiny tool to be able to assist dentists in an inconceivable manner.
  PubDate: 2023-04-28
  DOI: 10.18203/2394-6040.ijcmph20231302
  Issue No: Vol. 10, No. 5 (2023)