JournalTOCs

Turkish Journal of Agricultural and Natural Science / Türk Tarım ve Doğa Bilimleri Dergisi
Number of Followers: 0

This is an Open Access Journal

Open Access journal
ISSN (Print) 2148-3647
Published by DergiPark

[187 journals]

No title
- Authors: Arif SEMERCİ
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Arif SEMERCİ
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Oğuz SOYLU; Nuray ERGÜN, Berna ÇALICI, Pelin ŞENGÜL TORAMAN
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Effects of planting dates on yield, plant nutrient content and quality of
- Authors: Yelderem AKHOUNDNEJAD; Hayriye YILDIZ DAŞGAN, Nevzat SEVGİN
  Abstract: This study was conducted to determine the effects of different planting date son yield and nutrient contents of three melon genotypes under semi-arid climate conditions in 2019. Layout of the experiment was randomized block with 3 replications. Nutrient contents (N, P, K, Ca, Mg, Fe, Cu, Mn and Zn), brix value, chlorophyll (SPAD) content and total yield of three melon genotypes were determined. The results indicated that the effect of planting time on melon yield was significant. The highest total yield (3788 kg da-1)was obtained in May 20 planting treatment with Destari melon genotype. Potassium, Ca, Zn, Cu, Fe, Mn contents and BRIX according to the planting times. The results revealed that nutrient content and yield of melon genotypes planted on May 20were better compared to the other planting dates investigated.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Morphlogical and Molecular Characterization of Rotylenchulus borealis Loof
and Oostenbrink, 1962 from Turkey
- Authors: Faruk AKYAZI; Buğra GÜVERCİN, Onur YILMAZ
  Abstract: Reniform nematodes (Rotylenchulus spp.) have been reported to be associated with a large number of important products all over the world, ranging from important cereals, vegetables and ornamental plants. In this study, morphologic and molecular characters were used to idetify Rotylenchulus population obtained from a soybean field in Adana province of Turkey. Nematodes were extracted from the soil using a modified baermann funnel method. The morphological characters and morphometrics of male and immature females were examined and compared with previous studies. For molecular characterisation, DNA was extracted from immature females and the D2-D3 expansion region of the 28S rRNA gene was amplified using primer pair D2A (5’ACA AGTACCGTGAGGGAAAGTTG 3’) and D3B (5’ TCGGAAGGAACCAGCTACTA 3’). PCR product (780 bp) was sequenced and then compared with sequences of Rotylenchulus species available in the GenBank database. The result obtained from morphologic and molecular studies showed that the reniform nematode population was Rotylenchulus borealis.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Aslı YAVUZ; Abdurrahman ONARAN, Yusuf BAYAR
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Determination of the Effects of Some Additives Added to the Mixture of
Diesel and Safflower Biodiesel on Engine Performance
- Authors: Seda ŞAHİN; Hakan Okyay MENGEŞ
  Abstract: In this study, fuel properties and engine performance values of biodiesel fuel (B100) and alternative blended fuels containing different volumetric amounts of diesel (M100), biodiesel (B100) and n-butanol (BU) or n-pentanol (P) (diesel / biodiesel / n-butanol and diesel / biodiesel / n-pentanol) were evaluated in comparison with the reference diesel fuel (M100). In addition, the effects of EHN on fuel properties and emission values have been examined by adding 2-Ethylhexyl nitrate (EHN) cetane improver additive to mixture fuels at a concentration of 2000 ppm. Engine performance tests of all fuels and mixtures were carried out in a four-cylinder, four-stroke, and direct injection diesel engine at different speeds and full load conditions. Fuel properties of diesel, biodiesel and blended fuels have been determined that in harmony with the biodiesel and diesel fuel standards. When the engine performance results for all fuels and blends were evaluated, the maximum engine power, engine torque, and the minimum specific fuel consumption were realized in M100 fuel with values of respectively 63.3 kW (2100 min-1), 339.65 Nm (1300 min-1), and 256.53 g kWh-1 (1600 min-1). Among the blended fuels, the closest results to M100 fuel in terms of engine performance were obtained from M85B10P5 + EHN fuel. Besides, mixed fuels containing n-pentanol showed better performance results than blended fuels containing n-butanol.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Determination of Straw Quality of Some Grasspea (Lathyrus sativus L.)
Genotypes
- Authors: Selim ÖZDEMİR; Rıdvan UÇAR, Kağan KÖKTEN, Mahmut KAPLAN
  Abstract: The research was carried out in 2014 and 2015 years in order to determination of straw quality of some grasspea genotypes. In the research; 31 different grasspea genotypes were used as plant material. The experiment was set up in a randomized block design with three replications. In the research; the characteristics such as raw ash ratio, crude protein ratio and yield, acid detergent fiber (ADF), neutral detergent fiber (NDF), digestible dry matter (DDM) and dry matter intake (DMI) ratios, relative feed value (RFV), digestible energy (DE) and metabolic energy (ME) of the straw of the grasspea genotypes harvested for the purpose of seed were investigated. In both years of the research; statistically significant differences were detected between genotypes in terms of all traits examined. According to the result of two years of research; it was determined that the crude ash ratio of straws belonging to the grasspea genotypes varied between 7.12-9.52%, the crude protein ratio between 4.71-7.36%, the crude protein yield between 6.03-11.90 kg da-1, ADF ratio between 39.73-47.42%, NDF ratio between 50.53-62.66%, DDM ratio between 51.96-57.95%, DMI ratio between 1.92-2.38%, RFV between 77.46-106.47, DE value between 2.49-2.75 Mcal kg-1 and ME value between 2.05-2.26 Mcal kg-1. According to the results of the research, it has been determined that Biflorus and Eren grasspea genotypes are superior to other genotypes for straw quality in Elazig and similar ecologies, and it can be recommended to be grown in such ecologies.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: İsmail ALTUN; Turgay ŞENGÜL, Ahmet Yusuf ŞENGÜL
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Betül SUSAM SEREZ; Sait ENGİNDENİZ, Görkem ÖRÜK
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Sam MOKHTARZADEH; Khalid Mahmood KHAWAR
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
The Effects of Different Sowing and Harvest Periods on Herbage Yield and
Some Yield Components of Mountain spinach (Atriplex nitens) Grown in
Rainfed Conditions
- Authors: Bilal KESKİN; Süleyman TEMEL
  Abstract: This research was carried out in order to determine the effects of sowing times (Mid-March, late-March, early-April and mid-April) and harvest periods (end of vegetative period, beginning of flowering and full flowering period) on the herb yield and some yield characteristics of mountain spinach (Atriplex nitens), which was grown in arid conditions in the experimental area of the Faculty of Agriculture of Iğdır University. The experiment was set up according to randomized complete block in split plots with three replications in 2019 and 2020. In the research, plant height, number of branches, main stem thickness, stem rate, leaf rate, fresh herbage yield, dry herbage ratio and dry hay yield of mountain spinach were determined. The effects of the year, sowing times and harvest periods were significant on all the characteristics examined in the study. In the first year of the study, main stem thickness, stem ratio and dry herbage ratio were higher, in the second year, plant height, number of branches, leaf ratio, fresh herbage yield and dry hay yield were found to be higher. It was determined that planting mountain spinach in the middle of March, which is the first planting time, caused increases in plant height, number of branches, main stem thickness, fresh herbage yield and dry hay yield. It was determined that while the plant height and stem rate increased, there was a decrease in the leaf rate in mountain spinach by delaying the harvest period. Main stem thickness, fresh herbage yield, dry herbage ratio and dry hay yield were higher when mountain spinach was harvested during flowering period. According to the year, sowing time and cutting periods, the fresh grass yield ranged between 3146.3 and 9989.3 kg/da, and the dry grass yield ranged between 920.4 and 3602.4 kg/da. As a result, it has been determined that higher fresh and dry hay yield will be obtained in the case of sowing the seeds of mountain spinach in mid-March and harvesting at the beginning of flowering under the rainfed conditions of the region.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Establishment of A Novel Plant Micropropagation System From Mature
Hydroprimed Seeds Of Two Turkish Broad Bean Cultivars
- Authors: Ferzat TURAN; Khalıd Mahmood KHAWAR
  Abstract: Leguminous Broad bean (Vicia faba L.) is an excellent source of minerals, vitamins and proteins that makes it higly valuable food for human and feed for animal consumption. The plant has an important characteristic to fix atmospheric Nitrogen and play an important role to establish a natural balance of N in the atmosphere. It is a highly self-pollinated plant and has problem of low variation with limited genetic pool. Moreover, the previous studies identify problem of recalcitrance in broad bean. Therefore, there is need to establish a repeatable micropropagation protocol that could ensure an increase in genetic variability to overwhelm problems in breeding. This system must also be able for efficient gene delivery and could be integrated with the conventional breeding programs through direct organogenesis. The study aimed to develop a tissue culture protocol on two important Turkish broad bean cultivars Filiz99 and Eresen87 using MS medium containing 0.05, 0.15, 0.25, 0.35, 0.45, 0.55 mg l-1 TDZ using embryonic axis as explant. Maximum number of 5.33 and 3 shoots per explant were noted on cv. Filiz99 and Eresen87 on MS medium containing 0.15 mg l-1 TDZ. The developing shoots were rooted on MS medium containing 1 mg l-1 IAA after three weeks of culture. The rooted plants were transferred to pots containing peat under maintained under controlled greenhouse conditions for acclimatization The acclimatized plants bloomed and set seeds. Present results underscore importance of seed hydropriming before taking of explants to achieve high micropropagation on faba beans to overcome recalcitrance.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Exploring The Effects of Part-Time Hazelnut Farming on Agricultural Land
Use Characteristics and Its Social Cost
- Authors: Çağatay YILDIRIM; İsmet BOZ
  Abstract: The purposes of the study purpose were (i) to explore the effects of part-time farming on land use characteristics, productivity, and efficiency, and (ii) to estimate the social cost of part-time farming in hazelnut production. The research data were gathered from randomly selected 152 hazelnut farmers in Ordu and Giresun provinces, Turkey. When estimating the part-time farming social cost in hazelnut production, sacrificed production cost, yield losses, and price losses were assessed and combined. The stochastic frontier production function model was used to measure farm-level productive efficiency. The research findings showed that excessive chemical usage, shorter harvesting time, ignoring soil and leaf analysis results when applying fertilizers, lack of investments among farmers were the reasons for inappropriate land use for the part-time farms in the research area. Full-time farmers had a higher technical efficiency score than part-time farmers. The social cost of part-time farming was ₺4424 per hectare and ₺1.47 billion in Black Sea Region. The study suggested using a legislative process to transfer hazelnut orchards to full-time farmers. Facilitating the transfer of unproductive part-time hazelnut orchards to full-time operations may decrease the adverse effects of part-time farming on the sustainability of land use and of externalities. The study also recommended that prescribing part-time farmers to reach direct government support or benefit farmers' education programs may also reduce the social cost of part-time farming. Developing education and extension programs for increasing the qualification of both family and hired labor may positively contribute the sustainable land use in the region.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Mehmet Settar ÜNAL; Cuma UCAŞ
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Murat BÜYÜKFIRAT; Ersin GÜLSOY, Rafet ASLANTAŞ
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Farmers’ Approaches to Drip Irrigation Applications and the Factors
Affecting the Utilization from Drip Irrigation Subsidies: Case of Adana
and Niğde Provinces
- Authors: Hilal YILMAZ; Başak AYDIN, Nigar ANĞIN, Selcan AKKOYUN, Volkan ÇATALKAYA, Cengiz SAĞLAM
  Abstract: In this study, the socio-economic structure of the agricultural enterprises that utilized from the in-field drip irrigation subsidies or not, were determined, a comparative analysis of their knowledge levels and opinions about drip irrigation method was made in Adana and Niğde provinces. Besides, the factors affecting the benefit of the producers from drip irrigation subsidies were determined. A survey was conducted with a total of 26 producers, 10 of which utilized from drip irrigation subsidies in Adana and 16 of which utilized from drip irrigation subsidies in Niğde. In order to make a comparison between the groups, a survey was conducted with the same number of producers who did not utilize from drip irrigation subsidies. In the analysis of the data, basic descriptive statistics such as mean, standard deviation and percentage calculations were used. The continuous data obtained were subjected to the t test and the discrete data to the chi-square test to determine whether there was a difference between the producers who utilized and did not utilize from drip irrigation subsidies. Tendency of the producers to utilize from drip irrigation subsidies was determined using binary logistic regression analysis. It was determined that the age of the producers, the number of family members, their non-agricultural income and the type of activity they were engaged in affected the drip irrigation subsidies negatively, while the education period, the size of the irrigated land and the number of family members working in agriculture had a positive effect. Considering that the purpose of drip irrigation subsidies is to ensure more effective use of limited water, to increase productivity, to reduce labor and production costs, and to increase the prevalence of drip irrigation systems, it is possible to say that drip irrigation subsidies was applied in accordance with its purpose.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Humic substances application for the vegetative development of hybrid
tomato seedlings (Lycopersicon esculentum L.)
- Authors: Bruna Aline VACELİK; Marcelle Michelotti BETTONİ, Tefide KIZILDENİZ
  Abstract: It is known that the use of resistant cultivars and mineral nutrition associated with humic substances, such as humic and fulvic acids, can favor plant development, promoting aerial parts and roots growth, being a viable technique for better vegetative development of plants in general, and, consequently, for better final productivity. The aim of this work was to evaluate the effect of the fertilizer Bio Humate®, based on humic substances, in the vegetative development of Justyne® hybrid tomatoes. The experiment was conducted in greenhouses of University of Tuiuti do Paraná/Brazil with a completely randomized experimental design, arranged in a 4 x 2 factorial scheme with three doses of the commercial product’s application (1.5, 2, and 2.5 mL L-1 of Bio Humate®) on three repetitions Justyne® hybrid tomato seedlings that were subjected to samplings at 42nd and 56th days after transplanting (DAT)). The treatments were applied every 14 days, starting at 7 DAT at 42 and 56 DAT. The soil application of the Bio Humate® fertilizer showed better results at 2 mL L-1 of doses for the biometric and biochemical parameters evaluated in the vegetative development of Justyne® hybrid tomatoes, even though the chlorophyll content at 56 DAT is the lowest.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Comparative Study of The Chemical Composition and Nutritional Value of
Pumpkin Seed (Cucurbita pepo L.) Grown In The Different Ecological
Conditions of Turkey
- Authors: Sıtkı ERMİŞ; Ruhsar YANMAZ
  Abstract: The present work has been carried out to examine the effect of ecology on pumpkin seeds’ chemical composition among seven pumpkin lines (Cucurbita pepo L.) selected as a result of breeding studies. Kırklareli has been chosen to represent Thrace Region and Nevsehir and Ankara have been chosen to represent Central Anatolian Region where pumpkin production in Turkey is intensified. The data obtained for the seven pumpkin seeds (seed moisture content, total oil content, the composition of fatty acids, protein, vitamin E and amounts of essential minerals (Fe, Mn, Mg, K, P) were found considerable variation between lines and different environment locations. It has been concluded for the pumpkin seeds that total oil ratio was high (35%-48%), that oleic acid (40%-58%) and linoleic acid (30%-40%) are dominant oil acids, that it contains 35%-40 % of protein. Pumpkin seeds are a good source of vitamin E. The results of vitamin E contents were found between 2.68 -4.47 mg/100g. The pumpkin seeds were found to have considerable amounts of essential minerals (K, Mg, and P). According to the findings, it was determined how the chemical properties of pumpkin lines grown under three different ecologies were affected.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: İlke KARAKAŞ; Mustafa AY, Furkan ÖZTÜRK, Selen KAYA, Nurcihan HACIOĞLU
  Abstract: Plant growth promoting rhizobacteria (PGPR) contribute to sustainable agriculture systems because they play an important role in making the plant resistant to diseases. In this study, the plant growth promoting potential of bacterial isolates obtained from soil samples taken from plant roots of Alyssum pinifolium (Nyar, T.R. Dudley) spreading on serpentine slopes 6 km north of Ezine district of Çanakkale province was investigated. It was determined that 21 isolates obtained belong to Bacillus, Priestia and Brachybacterium genera in the identifications made by 16S rDNA analysis. Nitrogen fixation, phosphorus dissolving abilities, indole-3-acetic acid (IAA), and siderophore production capacities of 21 isolates were determined in vitro to reveal their potential to become PGPR. It was determined that all isolates used in the study had the ability to dissolve phosphorus. Phosphorus dissolution ratios of the isolates were found between 2.047 µg/mL and 2.600 µg/mL, and the highest value was obtained from Bacillus toyonensis NMCC-157. Nitrogen fixation properties could not be determined for 21 isolates. IAA production ability was measured between 51.4 µg/mL and 278.5 µg/mL, and the highest IAA production was achieved by Brachybacterium nesterenkovii NY-3. While it was determined that 47.6% of the isolates had siderophore production ability, the highest siderophore production was obtained from B. toyonensis NMCC-157. The results of the research showed that Bacillus strains, which have plant growth promoting marker properties such as high amounts of siderophore, IAA production and phosphorus solubilization, have the potential to be used as biofertilizers in the cultivation of economically valuable crop plants.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Asuman KAPLAN EVLİCE
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Determination of in Vitro Gas Production of Some Forages and Concentrate
Used in Ruminant Nutrition
- Authors: Özer KURT; Adem KAMALAK, Ali İhsan ATALAY, Emrah KAYA, Ayşe Nida KURT
  Abstract: The aim of this study to determined the nutrient content, in vitro gas production (IVGP), metabolic energy (ME) and organic matter digestion (OMD) of some roughage and concentrate used in ruminant nutrition in Muş province. Feed materials consist of roughage such as alfalfa hay, corn silage, wheat straw, and concentrated feeds such as wheat, barley, corn grain forages, wheat bran, sunflower meal, cotton seed meal. Significant differences were determined in the chemical composition, gas production (GP), ME and OMD of forages and concentrates (p
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Affectıon Of Addıtıonal Dıfferent Dose Enzyme (Grındazym Gp 5000) To
Ratıons On Feedıng And Carcass Characterıstıcs Of Broıler
- Authors: Ahmet AYDIN
  Abstract: In this study, the effects of enzyme preperation (Xylanase: 12.000 un/g , b-glukanase: 5.000 un/g and Pectinase: 7 un/g) added to broiler diets based maize on fattening performance were examined. In this study, 162 broiler chickens were used.Chickens were fed for 6 weeks on 3 different diets containing maize with enzyme preperations by 0, 0.5 and 1kg / tons. Live weights gains were found not significant in the all weeks. Body weights gains increased when 1 kg/ton enzyme is added at groups, but this increasing wasn’t significant. Feed intake and feed efficiency was not significant at the all groups..Carcass charasteristics weights significantly increased (P
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Spatial Noise Modeling in Dairy Operations
- Authors: Ünal KIZIL; Sefa AKSU, A. Cumhur KINACI, Ertuğrul BİLGÜCÜ, Songül ŞENTÜRKLÜ
  Abstract: A prototype sound monitoring and evaluation system was used to measure the noise level in a medium-sized dairy barn. In addition, the distribution of noise from the shelter was also modeled in order to determine how much the barn, where only the animals, mechanical tools and working workers in the barn were the sound source, affect the neighboring operations in terms of sound intensity. Considering that the intensity of the sound fluctuates according to the activities during the day, the equal noise level (Leq), which is a cumulative indicator, was used. The data recorded by 7 sensors placed inside the barn were modeled separately for day and night conditions in CadnaA software, and the distribution of Leq values both inside and outside the barn was modeled numerically and visually. As a result of the modeling study, Leq levels in the shelter were determined by averaging the values of 7 sensors. Accordingly, the Leq values for day and night in the barn were calculated as 69.0 and 64.2 dB, respectively. It was determined that these values were considerably lower than the maximum allowable values for dairy cattle. In addition, the spatial distribution modeling of the sound emitted from this establishment was at levels that would not cause disturbance for the neighboring operations.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
Evaluation of Rainwater Harvest Potential of a Site With Garden Area in
İzmir Province Conditions
- Authors: Handan ÇAKAR
  Abstract: With the increasing demand for water, the pressure on water resources is also increasing. In today's world where we seriously need water saving, the conscious use of water, which is a natural and limited resource, by people is possible with the sustainable management of water resources. Within the framework of sustainable water use, it is of great importance to ensure that even a single drop of water is used effectively in harmony with the environment without wasting it. In this study, some information on rainwater harvesting was given, and the potential for use of rainwater to be collected from roofs in the research area in meeting non-residential water needs was investigated. In this direction, the roof areas in the research area were calculated, and the annual rainwater yield to be obtained from the roofs in the research area was calculated by using the annual average rainfall data of İzmir province. The amount of green space in the site and the water requirements of these areas, as well as the amount of water required for cleaning the site, were calculated and the potential of the rain water to be collected to meet the requirements was determined.
  PubDate: Sat, 23 Apr 2022 00:00:00 +030
No title
- Authors: Fadime ATES
  PubDate: Sat, 23 Apr 2022 00:00:00 +030