Subjects -> AGRICULTURE (Total: 963 journals)
    - AGRICULTURAL ECONOMICS (93 journals)
    - AGRICULTURE (662 journals)
    - CROP PRODUCTION AND SOIL (120 journals)
    - DAIRYING AND DAIRY PRODUCTS (30 journals)
    - POULTRY AND LIVESTOCK (58 journals)

AGRICULTURE (662 journals)            First | 1 2 3 4     

Showing 201 - 263 of 263 Journals sorted by number of followers
Biodiversity     Hybrid Journal   (Followers: 28)
Agriculture & Food Security     Open Access   (Followers: 22)
Future of Food : Journal on Food, Agriculture and Society     Open Access   (Followers: 21)
Nature Plants     Full-text available via subscription   (Followers: 17)
African Journal of Food, Agriculture, Nutrition and Development     Open Access   (Followers: 17)
Advances in Agriculture     Open Access   (Followers: 16)
Agricultural History Review     Full-text available via subscription   (Followers: 15)
Indian Journal of Agricultural Sciences     Open Access   (Followers: 12)
Advances in Life Science and Technology     Open Access   (Followers: 11)
Biological Agriculture & Horticulture : An International Journal for Sustainable Production Systems     Partially Free   (Followers: 11)
Journal of Land and Rural Studies     Hybrid Journal   (Followers: 11)
Agriculture and Food Sciences Research     Open Access   (Followers: 10)
Agricultural Research     Hybrid Journal   (Followers: 10)
Indian Horticulture     Full-text available via subscription   (Followers: 9)
Culture, Agriculture, Food and Environment     Hybrid Journal   (Followers: 8)
Arboricultural Journal : The International Journal of Urban Forestry     Hybrid Journal   (Followers: 7)
Aceh International Journal of Science and Technology     Open Access   (Followers: 7)
International Journal of Agriculture and Forestry     Open Access   (Followers: 7)
New Journal of Botany     Hybrid Journal   (Followers: 6)
Invertebrate Reproduction & Development     Hybrid Journal   (Followers: 6)
Journal of Agriculture and Sustainability     Open Access   (Followers: 6)
Journal of Agriculture and Social Research (JASR)     Open Access   (Followers: 6)
American Journal of Rural Development     Open Access   (Followers: 6)
Journal of Agriculture, Forestry and the Social Sciences     Full-text available via subscription   (Followers: 6)
Journal of Advances in Agriculture     Open Access   (Followers: 5)
Acta Scientiarum. Animal Sciences     Open Access   (Followers: 5)
EvoDevo     Open Access   (Followers: 5)
Italian Journal of Agronomy     Open Access   (Followers: 4)
Cereal Chemistry     Full-text available via subscription   (Followers: 4)
Studies in Australian Garden History     Full-text available via subscription   (Followers: 4)
Journal of Agricultural Science     Open Access   (Followers: 4)
Journal of Agriculture and Rural Development in the Tropics and Subtropics     Open Access   (Followers: 4)
Tanzania Journal of Agricultural Sciences     Open Access   (Followers: 4)
Journal of Modern Agriculture     Open Access   (Followers: 4)
EU Agrarian Law     Open Access   (Followers: 4)
Journal of Agricultural Extension and Rural Development     Open Access   (Followers: 4)
Acta Agrobotanica     Open Access   (Followers: 4)
Food and Energy Security     Open Access   (Followers: 4)
Journal of the Ghana Science Association     Full-text available via subscription   (Followers: 3)
Journal of Agriculture and Natural Resources Sciences     Open Access   (Followers: 3)
Journal of Science and Technology (Ghana)     Open Access   (Followers: 3)
Biocatalysis and Agricultural Biotechnology     Hybrid Journal   (Followers: 3)
Revista Verde de Agroecologia e Desenvolvimento Sustentável     Open Access   (Followers: 3)
Sustainable Agriculture Research     Open Access   (Followers: 3)
International Journal of Agricultural Research, Innovation and Technology     Open Access   (Followers: 3)
International Journal of Applied Agriculture and Apiculture Research     Open Access   (Followers: 3)
Agra Europe     Full-text available via subscription   (Followers: 3)
Journal of Essential Oil Research     Hybrid Journal   (Followers: 3)
Diatom Research     Hybrid Journal   (Followers: 3)
Acta Universitatis Sapientiae, Alimentaria     Open Access   (Followers: 3)
Journal of Food Security     Open Access   (Followers: 3)
Journal of Agricultural Chemistry and Environment     Open Access   (Followers: 3)
Asian Journal of Medical and Biological Research     Open Access   (Followers: 3)
Rural China     Hybrid Journal   (Followers: 2)
Revista Cubana de Ciencia Agrícola     Open Access   (Followers: 2)
Rivista di Studi sulla Sostenibilità     Full-text available via subscription   (Followers: 2)
Nigerian Food Journal     Full-text available via subscription   (Followers: 2)
Tropical Agricultural Research     Open Access   (Followers: 2)
International Journal of Agricultural Management and Development     Open Access   (Followers: 2)
Tropical Agricultural Research and Extension     Open Access   (Followers: 2)
New Zealand Journal of Agricultural Research     Hybrid Journal   (Followers: 2)
International Journal for Parasitology : Parasites and Wildlife     Open Access   (Followers: 2)
Journal of Apicultural Science     Open Access   (Followers: 2)
Ciencia forestal en México     Open Access   (Followers: 2)
Agricultura Tropica et Subtropica     Open Access   (Followers: 2)
Journal of Biology, Agriculture and Healthcare     Open Access   (Followers: 2)
Journal of Sustainable Society     Open Access   (Followers: 2)
Journal of Agricultural Extension     Open Access   (Followers: 2)
Journal of Agriculture and Food Sciences     Full-text available via subscription   (Followers: 2)
Journal of Agricultural Engineering     Open Access   (Followers: 2)
Huria : Journal of the Open University of Tanzania     Full-text available via subscription   (Followers: 2)
Agro-Science     Full-text available via subscription   (Followers: 2)
Rural Sustainability Research     Open Access   (Followers: 2)
Ghana Journal of Agricultural Science     Full-text available via subscription   (Followers: 2)
Journal of Agricultural Studies     Open Access   (Followers: 1)
Berkala Ilmiah Pertanian     Open Access   (Followers: 1)
Journal of Natural Sciences Research     Open Access   (Followers: 1)
Agricultural Commodities     Full-text available via subscription   (Followers: 1)
Progressive Agriculture     Open Access   (Followers: 1)
COCOS : The Journal of the Coconut Research Institute of Sri Lanka     Open Access   (Followers: 1)
Jurnal Veteriner     Open Access   (Followers: 1)
Nigerian Journal of Technological Research     Full-text available via subscription   (Followers: 1)
Science, Technology and Arts Research Journal     Open Access   (Followers: 1)
Revista Brasileira de Higiene e Sanidade Animal     Open Access   (Followers: 1)
Wartazoa. Indonesian Bulletin of Animal and Veterinary Sciences     Open Access   (Followers: 1)
Archivos de Zootecnia     Open Access   (Followers: 1)
Folia Horticulturae     Open Access   (Followers: 1)
Acta Technologica Agriculturae     Open Access   (Followers: 1)
International Journal of Agricultural Extension     Open Access   (Followers: 1)
Frontiers in Science     Open Access   (Followers: 1)
Emirates Journal of Food and Agriculture     Open Access   (Followers: 1)
Research in Agriculture, Livestock and Fisheries     Open Access   (Followers: 1)
Journal of Agricultural Engineering     Full-text available via subscription   (Followers: 1)
Buletin Peternakan : Bulletin of Animal Science     Open Access   (Followers: 1)
RIA. Revista de Investigaciones Agropecuarias     Open Access   (Followers: 1)
Bulletin of University of Agricultural Sciences and Veterinary Medicine Cluj-Napoca : Food Science and Technology     Open Access   (Followers: 1)
Journal of Degraded and Mining Lands Management     Open Access   (Followers: 1)
Global Approaches to Extension Practice : A Journal of Agricultural Extension     Full-text available via subscription   (Followers: 1)
Plant Knowledge Journal     Open Access   (Followers: 1)
Iranian Journal of Applied Animal Science     Open Access   (Followers: 1)
Agrociencia Uruguay     Open Access   (Followers: 1)
Chemical and Biological Technologies for Agriculture     Open Access   (Followers: 1)
International Journal of Recycling of Organic Waste in Agriculture     Open Access   (Followers: 1)
Journal of Science Foundation     Open Access   (Followers: 1)
Annals of Agricultural Sciences     Open Access   (Followers: 1)
Avances en Investigacion Agropecuaria     Open Access   (Followers: 1)
International Journal of Sustainable Agricultural Management and Informatics     Hybrid Journal   (Followers: 1)
Bangladesh Journal of Agricultural Research     Open Access   (Followers: 1)
Journal of Agricultural Sciences     Open Access   (Followers: 1)
Jurnal Ilmu dan Kesehatan Hewan (Veterinary Science and Medicine Journal)     Open Access   (Followers: 1)
Innovare Journal of Agricultural Science     Open Access   (Followers: 1)
Arquivos do Instituto Biológico     Open Access   (Followers: 1)
Social and Natural Sciences Journal     Open Access  
Jurnal Agroteknologi     Open Access  
Perspectivas Rurales Nueva Época     Open Access  
Organic Farming     Open Access  
Research Ideas and Outcomes     Open Access  
Jurnal Udayana Mengabdi     Open Access  
Landtechnik : Agricultural Engineering     Open Access  
International Letters of Natural Sciences     Open Access  
International Journal of Agriculture System     Open Access  
Heliyon     Open Access  
Ciência e Técnica Vitivinícola     Open Access  
Oilseeds and fats, Crops and Lipids     Open Access  
Annals of Silvicultural Research     Open Access  
Pastura : Journal Of Tropical Forage Science     Open Access  
Journal of Citrus Pathology     Open Access  
Revista Iberoamericana de las Ciencias Biológicas y Agropecuarias     Open Access  
Kansas Agricultural Experiment Station Research Reports     Open Access  
International Journal of Secondary Metabolite     Open Access  
Scientia Agropecuaria     Open Access  
Pelita Perkebunan (Coffee and Cocoa Research Journal)     Open Access  
Revista de Agricultura Neotropical     Open Access  
Cogent Food & Agriculture     Open Access  
Fave : Sección ciencias agrarias     Open Access  
Revista de Ciências Agrárias     Open Access  
Review of Agrarian Studies     Open Access  
Nigerian Journal of Biotechnology     Open Access  
Nigeria Agricultural Journal     Full-text available via subscription  
Annales des Sciences Agronomiques     Full-text available via subscription  
Journal of the Bangladesh Agricultural University     Open Access  
Journal of Buffalo Science     Hybrid Journal  
Revista de Ciências Agroveterinárias     Open Access  
Tropical Grasslands - Forrajes Tropicales     Open Access  
Research in Plant Sciences     Open Access  
World Journal of Agricultural Research     Open Access  
Universal Journal of Agricultural Research     Open Access  
Research & Reviews : Journal of Agriculture Science and Technology     Full-text available via subscription  
Revue Marocaine des Sciences Agronomiques et Vétérinaires     Open Access  
Nativa     Open Access  
SAARC Journal of Agriculture     Open Access  
West African Journal of Applied Ecology     Open Access  
Journal of Agricultural Research and Development     Full-text available via subscription  
Journal de la Recherche Scientifique de l'Universite de Lome     Full-text available via subscription  
Global Journal of Agricultural Sciences     Full-text available via subscription  
Agrosearch     Open Access  
Agronomie Africaine     Full-text available via subscription  
Professional Agricultural Workers Journal     Open Access  
Interciencia     Open Access  
Nepal Journal of Science and Technology     Open Access  
Journal of the Saudi Society of Agricultural Sciences     Open Access  
Information Processing in Agriculture     Open Access  
Sabaragamuwa University Journal     Open Access  
Ceiba     Open Access  
Research in Sierra Leone Studies : Weave     Open Access  
The Agriculturists     Open Access  
La Calera     Open Access  
Selçuk Tarım ve Gıda Bilimleri Dergisi     Open Access  
Revista de la Universidad del Zulia     Open Access  
Journal of Arid Land     Hybrid Journal  
Rangifer     Open Access  
Encuentro     Open Access  
Journal Of Agrobiotechnology     Open Access  
Coffee Science     Open Access  
Bangladesh Journal of Scientific Research     Open Access  
Landbohistorisk Tidsskrift     Open Access  
Biotecnología en el Sector Agropecuario y Agroindustrial     Open Access  
Walailak Journal of Science and Technology     Open Access  
Universidad y Ciencia     Open Access  
Tropical and Subtropical Agroecosystems     Open Access  
Terra Latinoamericana     Open Access  
Revista Iberoamericana de Tecnologia Postcosecha     Open Access  
Revista Brasileira de Ciências Agrárias     Open Access  
Multiciencias     Open Access  
Ensaios e Ciência : Ciências Biológicas, Agrárias e da Saúde     Open Access  
Bioagro     Open Access  
Agroalimentaria     Open Access  
Revista Mexicana de Ciencias Agrícolas     Open Access  
Revista U.D.C.A Actualidad & Divulgación Científica     Open Access  
Revista Ciencias Técnicas Agropecuarias     Open Access  
Revista Chapingo. Serie horticultura     Open Access  
Pastos y Forrajes     Open Access  
Fitosanidad     Open Access  
Cultivos Tropicales     Open Access  
Cuadernos de Desarrollo Rural     Open Access  
Ciencia e Investigación Agraria     Open Access  
Agronomía Mesoamericana     Open Access  
Agronomía Costarricense     Open Access  
Agrociencia     Open Access  
Agrivita : Journal of Agricultural Science     Open Access  

  First | 1 2 3 4     

Similar Journals
Journal Cover
Journal of Citrus Pathology
Number of Followers: 0  

  This is an Open Access Journal Open Access journal
ISSN (Online) 2313-5131
Published by eScholarship Homepage  [73 journals]
  • Economic Impact of California’s Citrus Industry in 2020

    • Abstract: The value of California citrus production in the 2020-21 marketing year was $3.63 billion. The total economic impact of the industry on California’s economy in 2020-21 was $7.6 billion. The California citrus industry added $1.9 billion to California’s state GDP in 2020. Estimated full time equivalent jobs in the California citrus industry in 2020-21 totaled 24,247. Estimated wages paid by the California citrus industry income in 2020-21 totaled $759 million. A 20% reduction in California citrus acreage would cause a loss of 8,213 jobs, $214 million in employee income, and reduce state GDP by $569 million.
      PubDate: Thu, 10 Feb 2022 00:00:00 +000
       
  • Huanglongbing in Bangladesh: A Pilot Study for Disease Incidence, Pathogen
           Detection, and its Genetic Diversity

    • Abstract: Huanglongbing (HLB), also known as citrus greening, is the most serious disease affecting citrus production in Asia, Africa, the Americas, and the Arabian Peninsula. HLB is associated with the α-Proteobacteria “CandidatusLiberibacter asiaticus” (CLas), “Ca. L. africanus” (CLaf), and “Ca. L. americanus” (CLam). The Bangladesh citrus industry comprises mandarins, sweet oranges, pummelos, limes, and lemons. In 2017-2018, a survey was conducted for two consecutive years in 18 sweet orange growing areas of Bangladesh, and the presence of CLas in these areas was confirmed by polymerase chain reaction. HLB incidence and severity were assessed based on leaf symptoms. The results unveiled a widespread prevalence of HLB with incidence ranging between 0.08 and 56% and severity between 1.80 and 28.33. Information on the genetic diversity of CLas Bangladeshi isolates was obtained based on the presence or absence of...
      PubDate: Sat, 1 Jan 2022 00:00:00 +0000
       
  • Investigating the Impact of Huanglongbing in Citrus in Southern Lao PDR

    • Abstract: Citrus has been promoted in the Lao People’s Democratic Republic (Lao PDR) as a poverty reduction strategy for at least two decades. However, citrus trees have been in widespread decline for no less than ten years. Since 2010, the authors have observed symptoms on citrus trees consistent with the bacterial disease huanglongbing (HLB). These symptoms included asymmetric leaf mottle, small lopsided fruit, poor fruit production and tree decline. The authors then initiated a long-term study on the occurrence of HLB in southern Lao PDR. Samples of leaf mid-ribs were collected from citrus trees in orchards, nurseries, and backyards across four provinces: Champasak, Sekong, Salavan, and Savannakhet. The presence of ‘Candidatus Liberibacter asiaticus’, the putative causal agent of the Asiatic form of HLB, was confirmed in 59 of 109 samples collected in all four provinces. The Asian citrus psyllid, the vector of ‘Ca. L. asiaticus’, was also observed on citrus trees...
      PubDate: Sat, 1 Jan 2022 00:00:00 +0000
       
  • Vegetative shoot flush dynamics of ‘Pera’ sweet orange on
           three rootstock cultivars

    • Abstract: The dynamics and intensity of new shoot flushes of ‘Pera’ sweet orange scions [Citrus × sinensis (L.) Osbeck] grafted onto ‘Rough’ lemon (Citrus × limonia var. jambhiri Lush.), ‘Swingle’ citrumelo [Citrus × aurantium var. paradisi x Poncirus trifoliata (L.) Raf.] and ‘Sunki’ mandarin (Citrus reticulata ‘Sunki’) rootstocks were evaluated in the field at a citrus farm located in a northern region of the state of Sao Paulo, Brazil. Every 20 days for 16 months, new shoots were counted within a square frame of 0.25 m2 set on the central portion of the canopy and classified based on their phenological stages. Trees on ‘Swingle’ rootstock produced a lower area under the flush shoot dynamics curve (AUFSD) and mean number of new shoots than trees on ‘Rough’ lemon or ‘Sunki’ mandarin. For trees on all three rootstocks, new shoot intensities varied...
      PubDate: Sat, 1 Jan 2022 00:00:00 +0000
       
  • First Report of Citrus Bent Leaf Viroid and Citrus Dwarfing Viroid in
           Argentina

    • Abstract: Citrus Bent Leaf Viroid (CBLVd) and Citrus Dwarfing Viroid (CDVd), from genus Apscaviroid, are two of the widely distributed citrus viroids among the eight reported to date. They have been found to induce reduction in canopy volume and fruit production in citrus trees on trifoliate and trifoliate orange hybrids rootstocks. Moreover, citrus trees infected only with CBLVd or in combinations with Citrus Exocortis Viroid (CEVd), Hop Stunt Viroid (HSVd) and CDVd have been associated with a poor development of the root system. Samples of citrus trees showing viroid symptoms collected from citrus orchards in Tucumán, Salta, and Jujuy provinces (NW region in Argentina) were initially indexed on citron (Citrus medica) and then analyzed by s-PAGE. These samples were found to be infected with different viroid species, among them, CEVd and HSVd have been already identified. In order to determine the presence of other viroids, we performed a RT-PCR assay using specific primers...
      PubDate: Sat, 1 Jan 2022 00:00:00 +0000
       
  • A survey of Florida citrus viruses and viroids

    • Abstract: Efficient disease management is critical in the production of citrus; a crop that is susceptible to several plant pathogens. The ongoing battle with citrus greening has led to a shift in cultural practices, which could lead to a resurgence of previously controlled diseases. Here we investigated the presence of several common citrus-infecting viruses and viroids (Citrus leaf blotch virus, Apple stem grooving virus (synonym: Citrus tatter leaf virus), Citrus exocortis viroid, Hop stunt viroid (synonym: Citrus viroid II), and Citrus dwarfing viroid (synonym: Citrus viroid III) in Florida citrus groves. All five viruses and viroids are still present, with varying incidence. It would be prudent to take them into consideration when developing citrus disease management strategies.
      PubDate: Tue, 21 Aug 2018 00:00:00 +000
       
  • Overexpression of the Arabidopsis NPR1 protein in citrus confers tolerance
           to Huanglongbing

    • Abstract: Huanglongbing (HLB), also known as citrus greening, is one of the most destructive diseases of citrus worldwide.  It is caused by unculturable phloem-limited bacteria that belong to the Candidatus Liberibacter genus including Ca. L. asiaticus (CLas), Ca. L. africanus, and Ca. L. americanus.  Currently, there is no effective control strategy for HLB and no known cure for the disease.  We have previously generated transgenic ‘Duncan’ grapefruit and ‘Hamlin’ sweet orange expressing the Arabidopsis NPR1 (AtNPR1) gene, which encodes a master regulator of systemic acquired resistance.  Characterization of the transgenic lines indicated that overexpression of AtNPR1 confers resistance to citrus canker, another serious bacterial disease in citrus.  In this study, we intensively screened these transgenic lines for resistance or tolerance to HLB under greenhouse conditions.  Three independent transgenic lines (one...
      PubDate: Sun, 6 May 2018 00:00:00 +0000
       
  • Graft-transmissible citrus diseases in P. R. China-research developments

    • Abstract: In the P.R. China, ten graft-transmissible pathogens have been identified towards citrus, including Candidatus Liberibacter asiaticus, Citrus tristeza virus (CTV), Citrus tatter-leaf virus (CTLV), Citrus exocortis viroid (CEVd), Citrus yellow vein clearing virus (CYVCV),Satsuma dwarf virus (SDV), Citrus vein enation virus (CVED), Citrus psorosis virus (CPsV), Citrus cachexia viroid (CCaVd) and Citrus chlorotic dwarf virus (CCDV). Of these pathogens, the first five cause damage in field citrus trees, whereas the latter five were occasionally detected from the imported citrus materials or field trees. The research progresses about HLB, CTV, CYVCV etc. within recent three years have briefly been reviewed.
      PubDate: Tue, 24 Apr 2018 00:00:00 +000
       
  • Construction and application of infectious citrus viroids for biological
           indexing

    • Abstract: Viroid species identified in citrus induce a range of symptoms in this host as well as in non-citrus hosts. Currently, 7 citrus viroid species are recognized including Citrus bent leaf viroid (CBLVd), Hop stunt viroid (HSVd), Citrus dwarfing viroid (CDVd), Citrus bark cracking viroid (CBCVd), Citrus viroid V (CVd-V), Citrus viroid VI (CVd-VI) and Citrus exocortis viroid (CEVd). Cachexia-inducing variants of HSVd and CEVd, which causes exocortis, are considered severe pathogens of citrus, whereas other viroid species induce less severe symptoms such as stunting, either singly or in combination. Some viroid species, such as CDVd, have previously been used to deliberately induce stunting for high density planting of citrus, but studies on the effects of commercial orchards are limited. Research on the effect of viroid species requires the isolation of single viroid species. Biological isolation of single species from...
      PubDate: Mon, 20 Nov 2017 00:00:00 +000
       
  • Huanglongbing solutions and the need for anti-conventional thought

    • Abstract: Citrus huanglongbing (HLB) has been recognized for a century yet control and management remain elusive despite over 90 years of intensive research. The bacterial pathogen is an insect endosymbiont that was most likely inadvertently introduced into citrus where it found a compatible environment for growth in citrus phloem cells and therefore jumped from the animal to plant kingdom. Because the genus citrus did not coevolve with the bacteria it has no resistance and little tolerance to it and the resulting vascular disease is severe. The winged insect vector of the bacteria, the Asian citrus psyllid (ACP), is an exotic introduced species in its own right, prolific, and difficult to control even on a regional spatial scale. The resulting disease has a long latent period prior to symptom expression and a challenging cryptic period during which detection by convention PCR and other methods can be elusive. The result is an unusually rapid increase and spread of the resulting disease....
      PubDate: Fri, 3 Nov 2017 00:00:00 +0000
       
  • Interaction between Phytophthora nicotianae and Candidatus Liberibacter
           asiaticus damage to citrus fibrous roots

    • Abstract: Huanglongbing (HLB) is associated with the phloem-limited bacterium, Candidatus Liberibacter asiaticus (Las). Phytophthora nicotianae (P.n.) causes root rot of citrus, which reduces water and nutrient uptake by citrus fibrous roots. The discovery that Las damage to fibrous roots occurs before tree canopy symptoms develop led to the prediction that Las root infection directly damages roots and may interact with soil-borne pathogens to cause further damage. Hence, comparison of root damage by Las and P.n. alone or in combination was carried out on seedlings of Cleopatra mandarin (Citrus reticulata Blanco) rootstock to evaluate the possible interaction of Las and P.n. and their relative contribution to fibrous root loss. The results demonstrated that i) roots of seedlings have a similar level of damage when inoculated with Las or P.n., and coinoculation causes comparable damage as each pathogen alone; and ii) Las infection increases and decreases P.n. infection incidence overtime...
      PubDate: Mon, 24 Jul 2017 00:00:00 +000
       
  • Keynote Summary: Black swans, dragons and the phoenix: rebuilding citrus
           after HLB

    • Abstract: Keynote Summary: Black swans, dragons and the phoenix: rebuilding citrus after HLB
      PubDate: Tue, 6 Jun 2017 00:00:00 +0000
       
  • Keynote Address: The social side of pest and disease biosecurity:
           reflections from Australia

    • Abstract: Keynote Address: The social side of pest and disease biosecurity: reflections from Australia
      PubDate: Wed, 24 May 2017 00:00:00 +000
       
  • Tribute to Prof. Dr. Joseph Bové

    • Abstract: Tribute to Prof. Dr. Joseph Bové
      PubDate: Thu, 11 May 2017 00:00:00 +000
       
  • Joseph (Josy) M. Bové - Selected Photos

    • Abstract: Joseph (Josy) M. Bové - Selected Photos
      PubDate: Thu, 11 May 2017 00:00:00 +000
       
  • Agenda

    • Abstract: Agenda
      PubDate: Tue, 9 May 2017 00:00:00 +0000
       
  • Joseph (Josy) M. Bové Dedication

    • Abstract: Joseph (Josy) M. Bové Dedication
      PubDate: Tue, 9 May 2017 00:00:00 +0000
       
  • Abstracts from the 5th International Research Conference on Huanglongbing

    • Abstract: Abstracts from the 5th International Research Conference on Huanglongbing
      PubDate: Fri, 28 Apr 2017 00:00:00 +000
       
  • IOCV-XX-Abstracts of Presentations at the 20th Conference of the
           International Organization of Citrus Virologists, China, 2016

    • Abstract: IOCV-XX-Abstracts of Presentations at the 20th Conference of the International Organization of Citrus Virologists, China, 2016
      PubDate: Thu, 15 Sep 2016 00:00:00 +000
       
  • The past and present status of Citrus tristeza virus in Florida

    • Abstract: The Citrus tristeza virus (CTV) strains present in an area can determine the type and severity of disease produced. Using real time RT-qPCR, we screened a series of representative samples collected throughout Florida from 1964 to 2002 for CTV strain presence. We found that contrary to previous reports, the historical samples were infected with both the T30 and T36 strains, the latter often at low titer. The VT strain was rare, with a scattered distribution. We compared this to samples collected in 2014 and 2015, and found that T30 and T36 are prevalent in nearly all commercial groves; VT strain incidence has increased markedly. With changing cultural practices, such as an increase in sour orange rootstock use, tristeza disease continues to be a significant threat to the Florida citrus industry.
      PubDate: Thu, 8 Sep 2016 00:00:00 +0000
       
  • Bacillus subtilis QST 713, copper hydroxide, and their tank mixes for
           control of bacterial citrus canker in Saudi Arabia

    • Abstract: Citrus Bacterial Canker (CBC) is a serious disease that affects production of almost all commercial citrus cultivars in subtropical citrus growing regions worldwide. In this study, the effectiveness of monthly foliar sprays of wettable powder formulation Serenade MAX of Bacillus subtilis QST 713, alone or as tank mixes with copper hydroxide on CBC disease development was evaluated under greenhouse and uncovered nursery conditions. The QST 713 as a tank mix with copper hydroxide reduced significantly the disease severity and incidence, followed by the copper hydroxide treatment, compared to the control. The disease incidence on leaves of inoculated trees treated with a combination of copper with QST 713 was never higher than 19%, whereas, the disease incidence reached 43% for non-sprayed trees. It was possible to reduce the number of copper sprays up to 6 sprays per season when it was mixed with the bio-fungicide QST 713 to effectively control CBC compared with 8 sprays...
      PubDate: Sat, 21 May 2016 00:00:00 +000
       
  • Half a century on huanglongbing: learning about the disease, trying to
           control it

    • Abstract: Half a century on huanglongbing: learning about the disease, trying to control it
      PubDate: Mon, 2 May 2016 00:00:00 +0000
       
  • Comparison of gene expression changes in susceptible, tolerant and
           resistant hosts in response to infection with Citrus tristeza virus and
           huanglongbing

    • Abstract: The pathogens Candidatus Liberibacter asiaticus (Las) and Citrus tristeza virus (CTV) are both phloem limited and have significant economic impact on citrus production wherever they are found. Studies of host resistance have indicated that Poncirus trifoliata has tolerance or resistance to both pathogens, suggesting that there may be some common factors in the 2 kinds of resistance. We have conducted studies of host gene expression changes that occur in response to infection to gain further insight. Controlled inoculation by grafting infected budwood was used to infect potted greenhouse plants of Cleopatra mandarin (Citrus reticulata), US-897 (C. reticulata x P. trifoliata), and US-942 (C. reticulata x P. trifoliata) with CTV and with Las, the pathogen associated with the disease huanglongbing (HLB). Stem and leaf tissue was collected at 10, 20, and 30 weeks after inoculation, DNA and RNA were extracted and subjected to qPCR...
      PubDate: Wed, 23 Mar 2016 00:00:00 +000
       
  • IRCHLB-IV-Abstracts of Presentations at the 4th International Research
           Conference on Huanglongbing

    • Abstract: IRCHLB-IV-Abstracts of Presentations at the 4th International Research Conference on Huanglongbing
      PubDate: Mon, 29 Feb 2016 00:00:00 +000
       
  • Mapping sequences involved in induction of decline by Citrus tristeza
           virus T36 on the sour orange rootstock.

    • Abstract: Historically, decline (or tristeza) has been a devastating disease of citrus caused by Citrus tristeza virus (CTV). Decline is a man-made disease based largely on propagation of sweet orange, grapefruit, and mandarins on the sour orange rootstock. In Florida, the major problem caused by CTV has been decline, since severe stem-pitting isolates are absent. Although this disease can be controlled by using alternative rootstocks, there are soils in which all other rootstock choices are less desirable in terms of fruit quality and yield. A major goal has been to develop measures that allow growers to use the sour orange rootstock in the presence of CTV. Florida has 2 predominant strains of CTV, a decline (T36) strain and a non-decline strain (T30). A first step was to map the viral determinant that induces decline. This was done by creating hybrids with T30 sequences substituted into T36 to identify sequences correlated with loss of decline symptoms. This project was delayed...
      PubDate: Mon, 9 Nov 2015 00:00:00 +0000
       
  • The psorosis disease of citrus: a pale light at the end of the tunnel

    • Abstract: Abstract First reported in 1896, psorosis was the first citrus disease proven to be graft transmissible and also the first for which eradication and budwood certification programs were launched to prevent its economic damage. For many years psorosis etiology remained elusive and only in 1986 it was associated with the presence of virus-like particles in infected plants. However, in the last two decades a virus with unusual morphology (Citrus psorosis virus, CPsV) was characterized and closely associated with psorosis disease as previously defined by field symptoms and by biological indexing in sensitive indicator plants. With a tripartite, negative-sense, RNA genome and a ~48 kDa coat protein, CPsV, the presumed causal agent of psorosis, is the type member of the genus Ophiovirus, within the new family Ophioviridae. Availability of the complete genomic sequence of two CPsV isolates and partial sequences of many others has enabled i) setting up rapid...
      PubDate: Mon, 5 Oct 2015 00:00:00 +0000
       
  • A historical note on two unreported obstacles for cross-protecting mature
           citrus trees against severe Citrus tristeza virus isolates.

    • Abstract: A historical note on two unreported obstacles for cross-protecting mature citrus trees against severe Citrus tristeza virus isolates.
      PubDate: Fri, 28 Aug 2015 00:00:00 +000
       
  • Within-orchard edge effects of the azimuth of the sun on Diaphorina citri
           adults in mature orchards.

    • Abstract: Huanglongbing (HLB) is considered the most devastating disease of citrus. The bacterium and vector associated with HLB in Florida are Candidatus Liberibacter asiaticus and Diaphorina citri (Asian citrus psyllid), respectively. D. citri is positively phototropic, and higher populations have been found along edges of orchards exposed to the sun. A survey was designed to determine if D. citri adult populations along edges of orchards varied according to time-of-day and time-of-year in relation to the azimuth of the sun. The survey was conducted twice. Citrus orchards, each divided into 9 sampling areas, were surveyed for D. citri via stem-tap sampling. Orchards were sampled 3 times per day (near sunrise, solar noon, and sunset) and 4 times per year (near the summer solstice, autumnal equinox, winter solstice, and vernal equinox). Time-of-year and sampling area significantly affected psyllid counts (P =...
      PubDate: Fri, 28 Aug 2015 00:00:00 +000
       
  • Where have all the flowers gone' Postbloom fruit drop of citrus in the
           Americas.

    • Abstract: Postbloom fruit drop (PFD), caused primarily by Colletotrichum acutatum, is a serious disease annually in the humid tropical citrus areas of the Americas and occurs more sporadically in the humid subtropics. The fungus infects flowers of all citrus species producing orange-brown lesions on petals that result in abscission of the fruitlets leaving the persistent calyx and floral disk attached to the twigs. C. acutatum also causes Key lime anthracnose and is morphologically identical to PFD, but the strains can be differentiated by molecular means and pathogenicity tests. C. acutatum produces abundant conidia on infected petals that are dispersed primarily by rain splash. After the bloom season, the fungus persists as appressoria on persistent calyces and other vegetative plant parts. Those appressoria are stimulated to germinate by flower extracts and produce secondary conidia to initiate a new disease cycle. Some cultural measures are useful in reducing disease severity, but control...
      PubDate: Tue, 28 Jul 2015 00:00:00 +000
       
  • First report on citrus dry rot in sour orange rootstock in Texas

    • Abstract: A grapefruit tree on sour orange rootstock in a residential property in Mission, TX was suspected to have citrus dry root rot disease based on symptoms. The causal organism was isolated from the infected root samples and based on fungal cultural and microscopic morphology and PCR, it was confirmed to be Fusarium solani (Martius) Appel & Wollenweber emend. Snyder & Hansen. A total of 10 healthy sour orange rootstock seedlings were inoculated using conidial suspension of the fungus by the standard root-dip method. After 9 month post inoculation, the inoculated fungus was re-isolated from root and stem sections of these plants. Plants were smaller in size and displayed the classical symptoms of dry rot. The fungal colonies were confirmed to be F. solani based on fungal morphology and PCR. This is the first report of F. solani infecting sour orange rootstock plants in Texas.
      PubDate: Tue, 30 Jun 2015 00:00:00 +000
       
  • Huanglongbing in Texas: Report on the first detections in commercial
           citrus

    • Abstract: Huanglongbing (HLB), also known as citrus greening, is a destructive citrus disease associated with 3 α-proteobacteria species of Candidatus Liberibacter. The first report of HLB in the USA was from Florida in 2005 and Ca. L. asiaticus (Las) is the only species currently confirmed in the USA. In January 2012, a Valencia sweet orange tree in a commercial orchard in San Juan, Texas, tested positive for Las by real-time and conventional PCR assays and by the sequence of its partial 16S rRNA gene. The sample tested negative for Ca. L. americanus and Ca. L. africanus. All 4 Valencia sweet orange seedlings that were graft-inoculated using budwood from the first Texas HLB-infected tree showed typical HLB symptoms 3 months post-inoculation and tested positive for the pathogen. Such HLB typical symptoms as leaf blotchy mottle, twig die-back, veinal chlorosis, lopsided and greening fruits were observed on the Las-positive tree in the orchard, which immediately...
      PubDate: Thu, 25 Jun 2015 00:00:00 +000
       
  • Announcement of the International Citrus Microbiome (Phytobiome)
           Consortium.

    • Abstract: Announcement of the International Citrus Microbiome (Phytobiome) Consortium.
      PubDate: Thu, 25 Jun 2015 00:00:00 +000
       
  • Citrus tristeza virus strains present in New Zealand and the South
           Pacific.

    • Abstract: Citrus are an important subsistence and commercial crop across the South and Central Pacific. Unfortunately, the spread of plant material has contributed to the spread of citrus pathogens, such as Citrus tristeza virus (CTV). In this study, we examined the incidence and diversity of CTV strains present in both New Zealand, and island nations of the South and Central Pacific, and found that all presently described strains are present, and exist and complex mixtures of strains. Phylogenetic analysis suggests little difference in strain diversity between locations, suggesting extensive movement of infected planting material occurred in the past.
      PubDate: Tue, 26 May 2015 00:00:00 +000
       
  • Xyloporosis: A history of the emergence and eradication of a citrus viroid
           disease

    • Abstract: The etiology of xyloporosis, a disease that has severe effects on citrus trees grafted onto certain citrus rootstocks, was enigmatic for a long time. Symptoms on test hosts following transmission through grafting suggested that it was synonymous with citrus cachexia, a disease that mainly affects mandarin trees. Recent molecular studies have confirmed that certain Hop stunt viroid (HSVd) isolates induce cachexia and xyloporosis symptoms in disease-sensitive citrus hosts. These HSVd infections are mostly symptomless in numerous Near East and Western Mediterranean fruit trees and grapevines; including plants widely cultivated in those regions for several millennia, long before the emergence of xyloporosis and cachexia as diseases of citrus trees. The present review tracks historical changes in citrus propagation practices and the pathological consequences of those changes that contributed to the emergence of xyloporosis as an economically significant disease of citrus trees grafted...
      PubDate: Mon, 27 Apr 2015 00:00:00 +000
       
  • Citrus phytophthora diseases: Management challenges and successes

    • Abstract: Phytophthora spp. are present in nearly all citrus groves in Florida and Brazil and phytophthora-induced diseases, especially foot and root rot, have the potential to cause economically important crop losses. Disease-related losses due to root rot are difficult to estimate because fibrous root damage and yield loss are not always directly proportional. Challenges from phytophthora diseases have been addressed in both countries by enacting phytosanitary requirements for production of pathogen-free nursery trees in enclosed structures, propagated from indexed and certified pathogen-free sources, in conjunction with several other cultural management practices. In Florida groves, a statewide soil sampling program provides growers with soil propagule counts to estimate the damage that Phytophthora spp. are causing to fibrous roots. The results can be used along with rootstock tolerance, soils, topography, irrigation, and drainage to make a decision for the need to treat with fungicides...
      PubDate: Mon, 27 Apr 2015 00:00:00 +000
       
  • Sunn hemp, a major source-plant of the phytoplasma associated with
           huanglongbing symptoms of sweet orange in São Paulo State, Brazil

    • Abstract: In São Paulo State (SPS), sweet orange (Citrus sinensis) trees with huanglongbing (HLB) symptoms are infected with Candidatus (Ca.) Liberibacter (L.) asiaticus (Las) or Ca. L. americanus (Lam). However, in 2007, 3 years after HLB was first reported in SPS, some trees with characteristic HLB symptoms were found free of liberibacters, but infected with a phytoplasma of 16Sr group IX. This phytoplasma was further characterized by PCR amplification of ribosomal protein genes rpsC-rplV-rpsS and amplicon sequencing. A qPCR test to detect the phytoplasma in plants and insects was also developed on the basis of the ribosomal protein genes. The phytoplasma was transmitted from citrus-to-citrus by grafting. The 16Sr group IX phytoplasma associated with HLB symptoms in sweet orange in SPS and characterized by the above techniques was named “HLB-phytoplasma”. Although the HLB-phytoplasma is widely distributed in many municipalities of central, northern, and northwestern SPS, the number of...
      PubDate: Wed, 22 Apr 2015 00:00:00 +000
       
  • Cell Penetrating Peptides as an Alternative Transformation Method in
           Citrus

    • Abstract: Huanlongbing (HLB) has caused the loss of thousands of trees in Florida’s multi-billion dollar citrus industry. An effective, long-term strategy to controlling this disease will be by the incorporation of genetic resistance into commercial genotypes. Because conventional breeding is limited by the lack of natural resistance in citrus to HLB, genetic engineering is now considered a significant alternative to incorporating such characteristics. In fact, despite general concerns from the public against genetically modified organisms (GMOs), one National Academy report1 stated that genetic engineering will be the way to fully exterminate HLB, while growers’ support of a transgenic approach for disease resistant traits also continues to rise. The primary transformation method of citrus typically uses Agrobacterium, in which explants are suspended with the bacterium and subsequently placed on selection media. After treatment, the explants produce shoots that can...
      PubDate: Tue, 23 Dec 2014 00:00:00 +000
       
  • Mandarin and mandarin hybrid genetic transformation for resistance to
           Candidatus Liberibacter asiaticus

    • Abstract: Brazil is one of the largest producers and exporters of citrus. Currently, Huanglongbing disease (HLB) associated to Candidatus Liberibacter asiaticus (CLas) is the main threat to the citrus industry. The aim of this work is to study the genetic transformation of mandarin/mandarin hybrid 'Thomas' (Citrus reticulata Blanco) and 'Fremont' (C. clementina hort. ex Tanaka x C. reticulata Blanco) with the gene that encodes an attacin antibacterial peptide (attA) driven by phloem-specific promoters. The genetic transformation experiments were performed with epicotyl segments, via Agrobacterium tumefaciens (EHA 105), with the gene constructs pCAtSUC2/attA and pCAtPP2/attA, containing the attA gene controlled by AtSUC2 and AtPP2 promoters. Transgenic plants were identified by PCR analysis and acclimatized to greenhouse conditions. The plants will be propagated and evaluated for resistance to CLas.
      PubDate: Tue, 23 Dec 2014 00:00:00 +000
       
  • A Tomato Detached Leaf Assay for Chemical Genomics of an HLB Model System

    • Abstract: To better understand plant-pathogen interactions in Huanglongbing disease and develop control strategies we investigated a novel approach known as chemical genomics with Tomato “Psyllid Yellows”, caused by  Candidatus Liberibacter psyllaurous (CLps), as a model of HLB. Chemical genomics involves three key stages starting with designing and performing high-throughput chemical screening, identifying chemicals inducing desired effects and dissecting the genetic targets of the candidate chemical. Our study has been focused on developing a high throughput chemical screen assay using model plants such as tomato and Arabidopsis that can be infected by Candidatus Liberibacter psyllaurous (Clps). The key objective is to identify chemicals that induce plant defense against CLps infection or its transmission via psyllids. We evaluated Arabidopsis thaliana and tomato in different media such as MS sterile media and hydroponic culture, however qPCR results indicated...
      PubDate: Tue, 23 Dec 2014 00:00:00 +000
       
  • One-for-all: a monoclonal antibody specific to different recombinant
           proteins in transgenic citrus plants

    • Abstract: The easy and rapid identification of a recombinant protein in transgenic plants is becoming increasingly relevant as more transgenic plants are used for research and commercial applications. Tagging recombinant proteins with a small peptide (epitope) can perform such a task using a variety of immunological methods. Epitope tags are short, hydrophilic peptide sequences recognized by specific antibodies. Compared with larger protein fusions, the small size of epitope tags makes them less likely to interfere with protein folding and function.We describe herein the detection of the c-myc epitope using different immunological methods in citrus transgenic plants. A c-myc tag sequence (N-EQKLISEEDL-C, corresponding to the C-terminal amino acids (410-419) of human c-myc protein) was added to the DNA sequence by PCR and the resulting proteins are being tested at the CREC. Our experiments with a genetically altered endogenous citrus gene modified to produce a protein with the...
      PubDate: Tue, 23 Dec 2014 00:00:00 +000
       
  • Evidence that ‘flying dragon’ trifoliate orange delays HLB symptom
           expression for four sweet orange cultivars, Tahiti lime and Okitsu
           mandarin

    • Abstract: Huanglongbing (HLB), caused by Candidatus Liberibacter asiaticus and vectored by Diaphorina citri, was first reported in 2004 in Brazil and is currently widespread in São Paulo State. Brazil is the world’s largest sweet orange producer and has 49,000 ha cultivated with ‘Tahiti’ lime acid lime. Mandarin cultivation represents 5.5% of total citrus production in the country. In 2001, three experiments were planted in the Citrus Experimental Station (EECB), Bebedouro, Northern São Paulo State, where the first HLB symptomatic tree was detected in 2006. The initial objective was to evaluate the performance of ‘Folha Murcha’ sweet orange, ‘Tahiti’ acid lime and ‘Okitsu’ mandarin grafted on twelve rootstocks including Rangpur lime, Swingle citrumelo, Rubidoux and Flying Dragon (FD) trifoliate oranges. Cumulative HLB incidence (CI) was calculated in 2009. Folha Murcha and Tahiti lime trees on FD had lower CI values (6.7 and 10%) than trees on Rangpur lime (33.3 and...
      PubDate: Tue, 23 Dec 2014 00:00:00 +000
       
  • Breaking citrus juvenility by modulating endogenous miR156 and miR172
           levels

    • Abstract: The ability to either transform mature citrus directly or to transform juvenile citrus and also induce it to flower and set fruit within a few years is critical for evaluation of fruit quality, quantity and of horticultural performance of any transgenic trees.  In plants, the transition from juvenile to adult stage is regulated by the sequential and complementary action of microRNAs miR156 and miR172.  miR156 suppresses the expression of specific transcriptional factors that would otherwise promote the juvenile to adult phase transition, including factors that activate miR172, which directly promotes the transition.  Here, we created a target mimic for miR156 to attempt to sequester miR156 and reduce its levels in juvenile citrus.  We cloned the nonprotein coding gene IPS1 from Arabidopsis and replaced its native microRNA target with the predicted citrus target of citrus miR156, resulting in a citrus miR156 mimic gene, cMIM156.  Five sweet orange (Hamlin) seedling transgenic...
      PubDate: Tue, 23 Dec 2014 00:00:00 +000
       
  • Preliminary Evidence for Rootstock Effects on HLB Infection Frequency and
           Disease Severity in Sweet Orange and ‘SugarBelle’ Trees

    • Abstract: Evidence is accumulating that root system collapse is involved with HLB-induced tree decline, especially with trees on Swingle and Carrizo.  Phytophthora resistance appears to be breaking down in HLB-infected trees on Swingle.  Other stresses caused by blight, nematodes, cold, etc. also appear to be interacting with HLB to increase HLB disease frequency and severity.  Improved rootstocks could help to mitigate these problems, allowing for sustainable production under appropriate nutrition. We are testing complex hybrid rootstock candidates (diploid and tetraploid) to determine their affect on HLB disease establishment and severity in trees grafted with sweet orange scions; field and greenhouse experiments are underway.  Rootstocks differentially translocate nutrients, phytohormones (plant growth regulators), micro-RNAs, small proteins (pathogenesis related'), and other metabolites to the scion.  This could have both direct and indirect, quantitative and quantitative affects...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Genetic transformation of sweet orange to overexpress a CsPR-8 gene aiming
           for Candidatus Liberibacter asiaticus resistance

    • Abstract: A strategy to produce HLB-resistant citrus using genetic engineering is the overexpression of genes identified in the citrus genome. Plants respond to pathogen attacks by producing several pathogenesis-related (PR) proteins. Therefore, individual PR overexpression in transgenic plants can lead to an increased resistance. In this study, we have chosen to use one PR-8 isoform cloned from Citrus sinensis (CsPR-8). The PR-8 is an endochitinase that also has lysozyme activity, to be potentially used against bacterial attacks. We constructed an expression transformation vector (pCAMBIA2201) containing the CsPR-8 gene and the selection gene nptII that confers kanamycin resistance in plants, both driven by the CaMV35S constitutive promoter. Epicotyl segments collected from in vitro seedlings of ‘Hamlin’ sweet orange (Citrus sinensis L. Osbeck) were used for transformation via Agrobacterium tumefaciens strain EHA105....
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • HLB Progress on Tahiti acid lime grafted onto eight rootstocks

    • Abstract: The State of São Paulo is the main Tahiti (Persian) lime producer in Brazil with 65% of 43,000 ha grown in Brazil.  In 2003, an experiment was planted in the Citrus Experimental Station (EECB), Bebedouro, Northern São Paulo State, with the objective of characterizing the performance of Tahiti acid lime grafted onto eight rootstocks: Davis A and Flying Dragon trifoliate oranges, Swingle citrumelo, HRS 849 [“citradia 1708” (Argentina trifoliate orange x Smooth Flat Sevile)], Morton citrange, Rangur lime and Volkamer lemon, at 8 x 5 m spacing. In 2004, citrus huanglongbing (HLB), was first reported in the São Paulo State and the trees in the experiment started to show HLB symptoms in 2009. From July 2010 to May 2012, disease severity was evaluated four times and the bacteria titer quantified once. The numbers of qPCR positive replications were in a range of five to eight. Severity data was used to calculate the area under the disease severity progress curve (AUDSPC)....
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Candidatus Liberibacter americanus induces significant reprogramming of
           the transcriptome of the susceptible citrus genotype

    • Abstract: In Brazil, Huanglongbing (HLB) is caused by Candidatus Liberibacter americanus (CaLam) and Ca. L. asiaticus (CaLas). Both species are vectored by the Asian citrus psyllid and are restricted to the phloem of infected citrus, where they promote a severe imbalance in the translocation of nutrients and other important substances along the plant. Several studies of the transcriptional response of citrus to HLB have been reported, but only for infection caused by CaLas. This study evaluated the transcriptional reprogramming of a susceptible genotype (Pera sweet orange) challenged with CaLam, using a customized 385K microarray chip. The analyses showed that a large number of genes and biological processes were significantly altered upon CaLam infection. Among the changes we highlight induction of zinc transporters, modulation of enzymes related to sugar metabolism, decreased photosynthesis, induction of several defense-related genes and modulation of enzymes...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Screening of citrus and its close relatives for tolerance to huanglongbing

    • Abstract: Huanglongbing (HLB), a devastating disease of citrus, has become a serious problem for the citrus industries in Brazil and Florida, and both the disease and its psyllid vector, Diaphorina citri continue to spread to other citrus growing regions. Host resistance or tolerance to the pathogen would be extremely valuable to the citrus industry. A field trial was established in Fort Pierce, Florida where HLB has become endemic to assess the HLB tolerance level of different cultivars of citrus and citrus relatives. Over 800 seedlings representing over 100 accessions (8 replications of each) belonging to 18 genera of the subfamily Aurantioideae and family Rutaceae were evaluated over a period of four years. Leaf samples were collected at 6 month intervals during the spring and fall seasons and tested for the presence of HLB associated bacterium, Candidatus Liberibacter asiaticus (LAS) by real time PCR. While most accessions were found to be susceptible to HLB, the...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • A quick evaluation method of AtNPR1 transgenic plants for resistance to
           HLB

    • Abstract: We have produced a number of 'Carrizo' citrange (Citrus sinensis x Poncirus trifoliata) transformed with the Arabidopsis thaliana NPR1, a transcriptional co-activator that is key in the regulation of systemic acquired resistance (SAR) and the expression of pathogenesis related (PR) genes. Over-expression of this gene has been shown to induce broad spectrum disease resistance in several species. One of the limitations in obtaining genetically resistant citrus plants to HLB is how lengthy it is to propagate and evaluate the transgenic plants. Using grafting with infected budwood takes several months, is labor intensive and normally requires specialized greenhouse space which can be limited. We have developed a system to quickly screen AtNPR1 transgenic lines and determine if they exhibit an enhanced defense response to Candidatus Liberibacter asiaticus PAMPs. First, we used a synthetic peptide of L-flg22 (22 amino acid flagellin epitope derived from...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Analysis and evaluation of China-native citrus and citrus related
           germplasm on their susceptibility to the infestation by Diaphorina citri
           Kuwayama (Homotera: Psyllidae)

    • Abstract: Huanglongbing (HLB) is the most devastating disease of citrus worldwide and vectored by the Asian citrus psyllid (ACP), Diaphorina citri Kuwayama (Hemiptera: Psyllidae). The pathogen associated with HLB maintains uncultural in vitro, and there are few effective options against HLB-affected plants. Identification and deployment of ACP- resistance traits of citrus and citrus related germplasm to suppress ACP populations may be a potential management strategy for the management of HLB. In the present study, the susceptibilities of 71 Chinese citrus genotypes to ACP infestation were evaluated and analyzed in a free-choice situation under field conditions by using the method of systematic clustering and dynamic clustering. The results showed that there was significant difference in susceptibility to ACP infestation among the genotypes of citrus. These genotypes can be graded according to the number of psyllids on the trees. Grade I: highly susceptible with a total of 8...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Resistance of Poncirus and Citrus x Poncirus Germplasm to the Asian Citrus
           Psyllid

    • Abstract: The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, has spread to citrus growing regions nearly worldwide and transmits phloem-limited bacteria (Candidatus Liberibacter spp.) that are putatively responsible for citrus greening disease.  Host plant resistance may hold promise as a control tactic for ACP, but ACP has a broad host range and resistance in Citrus and relatives to ACP has only recently been actively explored.  Very low abundances of ACP were found on two accessions of Poncirus trifoliata L. in a field survey (Westbrook et al., 2011).  Therefore, we tested whether 81 accessions of P. trifoliata and xCitroncirus sp. (hybrids of P. trifoliata and Citrus spp.) from the USDA-ARS National Clonal Germplasm Repository for Citrus and Dates were resistant to ACP by determining whether these accessions influence oviposition and lifespan of adults in no-choice tests.  There was a higher abundance...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Candidatus Liberibacter americanus induces significant reprogramming of
           the transcriptome of the susceptible citrus genotype

    • Abstract: In Brazil, Huanglongbing (HLB) is caused by Candidatus Liberibacter americanus (CaLam) and Ca. L. asiaticus (CaLas). Both species are vectored by the Asian citrus psyllid and are restricted to the phloem of infected citrus, where they promote a severe imbalance in the translocation of nutrients and other important substances along the plant. Several studies of the transcriptional response of citrus to HLB have been reported, but only for infection caused by CaLas. This study evaluated the transcriptional reprogramming of a susceptible genotype (Pera sweet orange) challenged with CaLam, using a customized 385K microarray chip. The analyses showed that a large number of genes and biological processes were significantly altered upon CaLam infection. Among the changes we highlight induction of zinc transporters, modulation of enzymes related to sugar metabolism, decreased photosynthesis, induction of several defense-related genes and modulation of enzymes...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Results on attempts in management of HLB under small scale in Vietnam and
           initiation in screening for HLB tolerant from varieties/clones belonging
           to Rutaceae

    • Abstract: In the Mekong Delta, Vietnam, Citrus Huanglongbing (HLB) was officially announced in 1994 and its causal organism was described by Bove and Garnier in 1995 to be Candidatus Liberibacter asiaticus. Throughout the years, intensive works have been carried out for HLB control under small scale orchards and the achievements are discussed, the model for effective control of HLB under small scale which could elongate the life cycle of citrus tree for better and longer harvesting. In addition, there were 130 rutaceae related accessions had been collected and screened for HLB tolerance; the results revealed that the serverity of HLB infection was less on Hanh/Tac/Quat (Citrus microcarpa) and Long Co co pummelo (Citrus maxima) than that on orange and mandarin. The wild Rutaceae species/clones such as Quyt Dang, Quyt rung, Cam rung, Buoi Rung, Buoi Dang, Buoi Bung, Mac Run, Mac Mat, Can Thang, Quach, Nguyet Que, Kim quit, Truc, Com Ruou, Dau dau ba la, Ca ri,...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Huanglongbing Resistance and Tolerance in Citrus

    • Abstract: Huanglongbing (HLB) is severely impacting Florida citrus. Productivity declines in many HLB-affected genotypes, often with greatly thinned canopies. Fruit size and quality are often adversely affected as the disease advances. HLB was assessed in diverse cultivars in commercial groves with high HLB-incidence. ‘Temple’ had the lowest HLB symptoms and Liberibacter (Las) titer, while ‘Murcott’ and ‘Minneola’ had the highest. The USDA Ft. Pierce, FL farm is managed to reveal genotype responses to HLB. Some current cultivars and hybrid seedlings demonstrate resistance/tolerance, at least to strain(s) of Las present. C. trifoliata is the best documented citrus resistance source with Las titers suppressed even when C. trifoliata is grafted onto severely-infected rootstocks. Some cultivars and hybrids have abundant foliage symptoms, but full canopies and seemingly normal fruit set and size. In 3-years of data from a replicated trial of ‘Triumph’(T), ‘Jackson’(J), ‘Flame’(F), and ‘Marsh’(M),...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Lflg22, a Pathogen-Associated Molecular Pattern (PAMP) of Candidatus
           Liberibacter asiaticus, initiated differential PAMP-Triggered Immunity
           (PTI) in Grapefruit and Sun Chu Sha

    • Abstract: ‘Duncan’ Grapefruit (Citrus paradisi Macf.) and ‘Sun Chu Sha’ mandarin (C. reticulalta Blanco) represent two citrus genotypes that have different levels of tolerance to citrus greening or huanglongbing (HLB), a bacterial disease caused by Candidatus Liberibacter sp. In this study, the response of the two genotypes to the conserved 22 amino acid domain of the Liberibacter flagellin (Lflg22), a Pathogen-Associated Molecular Pattern (PAMP), were compared. The expression levels of citrus defense-associated genes including AZI1, EDS1, NDR1, SGT1, RAR1, PAL1, ICS1, PAL1, NPR1, NPR2, NPR3, PR1 and RdRp in response to Lflg22 were analyzed. The HLB moderately tolerant Sun Chu Sha showed a stronger response to Lflg22 than the HLB-sensitive grapefruit. These results suggest that differences in the levels of PAMP-triggered Immunity (PTI) between the two genotypes are associated with the observed levels of HLB tolerance. Interestingly, although the Ca....
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Identification of differentially expressed genes in Citrus sinensis leaves
           and branches in response to Candidatus Liberibacter asiaticus and Ca. L.
           americanus

    • Abstract: Several studies have addressed transcriptional changes in Citrus sinensis samples in response to Candidatus Liberibacter asiaticus (CaLas) with the objective to reveal the mechanisms underlying the development of Huanglongbing (HLB) and identify possible strategies to manage the disease. The aim of this work was to provide data using NGS technology (RNAseq) for a comprehensive analysis of differential expression changes in C. sinensis leaves and branches induced by HLB, caused either by CaLas or CaLam. Four treatments were evaluated; each of them consisted of RNA bulks extracted from five C. sinensis HLB symptomatic leaves or branches inoculated with CaLam or CaLas. The samples were subjected to RNAseq sequencing and the differential expression analyses were performed with Cuffdiff. In parallel, we performed a simple parametric test based on the mean and standard deviation to select statistically significant differentially expressed...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • Screening of Transgenic Citrus for HLB Resistance

    • Abstract: Transgenic citrus scion (mostly grapefruit and sweet orange) and rootstock cultivars (Carrizo and experimental complex tetraploids) were transformed with gene(s) encoding antimicrobial peptides or systemic acquired resistance (SAR) proteins. Each transgene was under control of an enhanced CaMV 35S promoter. Several genes were also under control of a phloem specific Arabidopsis SUC2 (AtSUC2) promoter.  A number of clones of each transgenic line (at least 3 replicate plants per clone) were evaluated for resistance to Huanglongbing (HLB, caused by Candidatus Liberibacter asiaticus). 650 clones, from over 180 individual transgenic lines planted in spring 2009 in a heavily HLB infected Martin County grove were tested using qPCR for infection to HLB after 30 months in field. 396 trees tested negative for the HLB bacterium. Approximately 200 clones were observed to be healthy and flushing after 40 months in the field and were again evaluated using...
      PubDate: Mon, 22 Dec 2014 00:00:00 +000
       
  • The Dynamics of Prophages/Phages FP1 and FP2 of ‘Candidatus Liberibacter
           asiaticus’ in Response to Stress Conditions

    • Abstract: ‘Candidatus Liberibacter asiaticus’ (Las), the prevalent bacterial pathogen associated with citrus huanglongbing (HLB), harbors at least two prophages, named FP1 and FP2. Due to the fastidious nature of Las, little is known about the prophage’s response to stress conditions. In this study, we used real time PCR to investigate the potential conversion of the FP1 and FP2 prophages under stress conditions by comparing the 16S rDNA copy number in HLB-affected periwinkle and citrus. When HLB-affected periwinkle was exposed to heat stress for 4.0 hours, more FP1 and FP2 phage particles were released at 42℃ and 45℃ than at 37℃. A temperature increase from 23℃ to 37℃ caused the relative copy numbers of FP1 and FP2 to increase six folds, while a shift from 23℃ to 42℃ or 45℃ caused the relative copy numbers of FP1 and FP2 to increase between 7.5 and 15-folds compared to the initial samples. Meanwhile, similar results were found when HLB-affected citrus scions were treated with...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Identification of small molecule inhibitors against SecA of Candidatus
           Liberibacter asiaticus by structure based design

    • Abstract: Huanglongbing is the most devastating disease of citrus caused by Candidatus Liberibacter asiaticus (Las) (1, 2). In the present study, we report the discovery of novel small molecule inhibitors against SecA ATPase of Las by using structure based design methods. We built the homology model of SecA protein structure of Las based on the SecA of Escherichia coli. The model was used for in-silico screening of commercially available compounds from ZINC database. Using the glide flexible molecular docking method, twenty structures were chosen for in vitro studies. Five compounds were found to inhibit the ATPase activity of SecA of Las at nano molar concentrations and showed antimicrobial activities against Agrobacterium tumefaciens with MBC ranging from 128 to 256 g/mL.  These compounds appear to be suitable as lead compounds for further development of antimicrobial compounds against Las. To test the application potential of those compounds...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Whole Genome PCR Sequencing Strategy for ‘Candidatus’ Liberibacter
           asiaticus: Analyzing Sequence Diversity Among U.S. Isolates

    • Abstract: The inability to culture the ‘Candidatus’ Liberibacter asiaticus (CLas) bacterium has greatly hindered research on the etiology of the citrus disease Huanglongbing which is associated with this bacterium.  This is especially true with respect to possible links between strain/isolate diversity and disease symptom variations and development.  Past genetic marker research indicates that there is considerable CLas isolate diversity even within Florida (a location that has only recognized the presence of the disease since 2005); however, no effort has been made to correlate this diversity with symptom differences.  To advance our understanding of CLas geographic spread and strain/isolate diversity, we have developed a whole-genome PCR amplification strategy that can be used in conjunction with next generation genome sequencing to rapidly obtain near whole genome sequence for specific isolates.  This method was used to generate genome sequence data (~93% of the total genome...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Exploiting the Las and Lam phage for potential control of HLB

    • Abstract: Huanglongbing (HLB) is a lethal disease of citrus caused by Ca. L. asiaticus (Las), Ca. L. americanus (Lam), and Ca. L. africanus.  Our published results demonstrate that Las carries a prophage with a lytic cycle that can become activated in plants to kill the Las cell that carries it. Our more recent results analyzing the complete genome of Lam (refer Wulff et al abstract at this conference) demonstrates that it, too, carries a very similar prophage and apparent lytic cycle.  Our goal is to try to develop a sensitive, multiwell, microtiter dish assay for high throughput screening of chemicals with ability to trigger the lytic cycle and potentially lead to a chemical treatment method to eliminate Las from infected trees, whether symptomatic with HLB or not.  The intergenic region between the early and late genes of Las phage SC1 and SC2 (between locus tags gp120 and gp125) were cloned in both directions upstream of the lacZ reporter...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Increases in ‘Candidatus Liberibacter asiaticus’ viability and
           investigations of biofilm-like structures in citrus juice medium

    • Abstract: Huanglongbing disease of citrus, associated with infection by the bacterium ‘Candidatus Liberibacter asiaticus’ (LAS), has spread rapidly in the US since 2005. Attempts to culture LAS in vitro have not yielded a consistently reproducible culture method; therefore, obtaining knowledge about the infection process is difficult. To determine conditions which sustain LAS viability, LAS inoculum obtained from seeds of fruit from infected pomelo trees (Citrus grandis ‘Mato Buntan’) was added to different media, and cell viability was monitored for several weeks using quantitative polymerase chain reaction (qPCR) in conjunction with ethidium monoazide (EMA). Among media tested, King’s B (K) did not support viability of LAS cells, while grapefruit juice (G) allowed LAS cells to survive in vitro for ~20 days. In media that sustained LAS viability, a reproducible biofilm-like substance was formed over time at the air-liquid interface of culture flasks...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • First Report of ‘Candidatus Liberibacter asiaticus’ associated with
           huanglongbing in the weeds Cleome rutidosperma, Pisonia aculeata and
           Trichostigma octandrum in Jamaica

    • Abstract: Citrus huanglongbing (HLB) also known as citrus greening is the most destructive disease of citrus worldwide.  Three species of the causal organism have been identified.  These are ‘Candidatus Liberibacter asiaticus’, ‘Ca. L. africanus’ and ‘Ca. L. americanus’ (Bové, 2006). In 2010 a survey of non-citrus plants was conducted on two major citrus producing farms in Clarendon and St Catherine in Jamaica.  This was to determine the possibility of the existence of non-citrus hosts of HLB.  A total of 120 plants belonging to 10 different species and nine families were collected over a period of two months.  The plants collected included weeds as well as non-citrus trees.  None of the plants collected exhibited any symptoms of HLB and at the time of sample collection, no citrus psyllids was observed on the plants.  DNA was extracted from plant samples using the method of Dellaporta et al. (1983) and analysed by PCR using the primer pair OI1 (5` GCGCGTATGCAATACGAGCGGCA3`) and OI2c...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • ‘Candidatus Liberibacter’ in four indigenous Rutaceous species
           from South Africa

    • Abstract: ‘Candidatus Liberibacter africanus’ (Laf), a phloem restricted, gram negative bacteria of the α-proteobacteria is the agent associated with Citrus greening disease in South Africa. A related bacterium ‘Candidatus Liberibacter africanus spp. capensis’ (LafC) was previously described from an indigenous Rutaceae tree, Calodendrum capense. This led to the hypothesis that other indigenous Rutaceous trees may also be infected with Liberibacters related to either Laf or LafC. Samples from 289 Vepris lanceolata, 231 Zanthoxylum capense, and 234 Clausena anisata were collected from within the natural distribution of these trees in South Africa. Total DNA was extracted and tested for the presence of a Liberibacter using a generic Liberibacter real-time PCR. ‘Candidatus Liberibacters’ present in positive samples were characterised by amplifying and sequencing the β-operon, 16S and omp gene regions. The percentage...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • ‘Candidatus Liberibacter asiaticus’ Encodes Two Novel Autotransporters
           that Target to Mitochondria

    • Abstract: As a phloem-limited, intracellular bacterial pathogen, ‘Candidatus Liberibacter asiaticus’ (Las) has a significantly reduced genome and causes huanglongbing (HLB), a devastating disease of citrus worldwide.  In this study, we characterized two novel autotransporter proteins of Las, and redesignated them as LasAI and LasAII in lieu of the previous names HyvI and HyvII. Proteins secreted by the type V secretion system (T5SS), known as autotransporters, are large extracellular virulence proteins localized to the bacterial poles. Bioinformatic analyses revealed that LasAI and LasAII share the structural features of an autotransporter family containing large repeats of a passenger domain and a unique C-terminal translocator domain. When fused to the GFP gene and expressed in E. coli, the LasAI C-terminus and the full length LasAII were localized to the bacterial...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Differentiation of “Candidatus Liberibacter asiaticus” isolates from
           Brazil, China, and the United States

    • Abstract: “Candidatus Liberibacter asiaticus” is associated with citrus Huanglongbing (HLB, yellow shoot disease), a highly destructive disease currently threatening world citrus production. HLB has a long history in China and was found in Brazil in 2004 and U.S.A. in 2005.  There is an urgent need to differentiate isolates of “Ca. L. asiaticus” from different geographical regions for effective control of HLB.  In this study, isolates of “Ca. L. asiaticus” collected from Brazil, China and the United States were evaluated based on two previously characterized genomic loci, one locus (trn1) with variable tandem repeat numbers (TRNs), and the other locus (snp1) is characteristic in single nucleotide polymorphisms (SNPs).  A total of 299 strains (84 Brazil, 132 China and 83 U.S.) were analyzed.  At the trn1 locus, “Ca. L. asiaticus” strains were divided into TRN-A and TRN-B groups.  TRN-A isolates dominated the China and U.S....
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Improved methods for genome sequencing of Liberibacters by BAC
           library-based metagenomics approach

    • Abstract: Liberibacters have not yet been successfully cultured; their minimal genomes carry multiple copies of several genes. Sequences identical to phage genomes have been found in many Liberibacters. Available evidences suggest that the Liberibacter genomes are adapting rapidly in different hosts and environments. Characterization of genomes of rapidly changing unculturable organisms can be challenging. We have used a model system based on Candidatus Liberibacter psyllaurous associated with tomato “psyllid yellows” (Hansen et al., 2008) to develop methodologies using alternate techniques for sequencing metagenomes. We have constructed a BAC library from infected tomato psyllids (Bactericera cockerelli). The library consists of 57,600 clones arrayed in 150 plates each with 384 wells. DNA from individual clones were pooled for screening purposes. Initial identification of clones with Liberibacter sequences were conducted based on 16s ribosomal sequences, and contiguous...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • The complete genome sequence of Candidatus Liberibacter americanus, a
           bacterium associated with Citrus Huanglongbing in Brazil

    • Abstract: We used PFGE followed by CsCl bisbenzymide centrifugation to obtain sufficient DNA for pyrosequencing of the Ca. Liberibacter americanus (Lam) strain “São Paulo” genome. The complete circular genomic DNA sequence of Lam is 1,195,201 bp, with an average GC content of 31.12%, somewhat lower than other Liberibacters. There are 1,056 predicted Lam genes, with 1,002 encoding proteins, 9 encoding rRNA genes and 45 encoding tRNAs. The overall gene organization and structure of the Lam genome is more similar to Lso than to Las. There are 951 genes common to Lam, Lso and Las, 27 genes found in Lam and Lso but not Las, and only 8 genes common to Lam and Las but not found in Lso. Many pseudogenes or truncated genes were found among the unique genes of all 3 species. As with Las, two prophage were confirmed in Lam, with SP2 being 39,941 bp and SP1 being 16,398 bp in size; as in Las, the one that appears to replicate as an excision plasmid prophage carries putative lysogenic conversion...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Clues into the metagenome of Huanglongbing infected Citrus by analysis of
           ancillary sequences from Ion Torrent whole genome Candidatus Liberibacter
           asiaticus sequencing

    • Abstract: Huanglongbing (HLB) is a globally devastating disease of citrus.  Presently, three etiological agents are associated with HLB and include; Candidatus Liberibacter asiaticus (CLas), Candidatus Liberibacter americanus; and Candidatus Liberibacter africanus.  Attempts to determine alternate (non-Liberibacter) associated etiological agents of HLB have been performed, namely by metagenomic analyses with HLB phenotypic citrus of phloem tissue isolated from bark [1] and whole leaf midribs [2].  These reports indicated a strong correlation for Liberibacter species associated with HLB etiology, but they do not indicate the presence of other significant associated etiological agents.  Utilizing both PCR and non-PCR based metagenomic strategies; these previous reports present an undersized view (relating to inherent technique limits, restricted sample scope, and/or bacterial bias) into the etiology of HLB.  Here we report ancillary contiguous metagenomic...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Characterization of putative virulent factors of Candidatus Liberibacter
           asiaticus

    • Abstract: Citrus greening or huanglongbing (HLB) is a devastating disease of citrus, and poses a major threat to the citrus industry in the United States (1, 2). Candidatus Liberibacter asiaticus has been known to be associated with HLB in the United States (3, 4).  Unsuccessful attempts to culture Ca. L. asiaticus have notably hampered efforts to understand its biology and pathogenesis mechanism despite some limited progresses in culturing.  In order to characterize the putative virulence factors, we expressed putative virulent factors in Nicotiana benthamiana.   Totally 24 putative virulent factors are being tested with most of them containing signal peptides. By transient expression of the candidates using TMV vector in N. benthamiana, we can screen the genes influencing plant development and morphology. Meanwhile, transformation of candidate genes into N. benthamiana driven by 35S promoter and phloem specific promoter respectively will...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Prophage-mediated population dynamics of ‘Candidatus Liberibacter
           asiaticus’ in plant and insect hosts

    • Abstract: As an intracellular bacterium, ‘Candidatus Liberibacter asiaticus’ (Las) lacks known transposons and IS elements but contains at least two prophages/phages. In this study, we revealed the genetic diversity and population dynamics of this bacterium based on two prophage hyper-variable regions (HVRs) using separate libraries constructed from citrus, periwinkle and psyllid. A total of 9 variants were identified, including 4 abundance types A, B, C, D and 5 rare types E, A1, A2, C1 and C2. The two HVRs, Type A and B, share highly conserved sequences and are localize to the two prophages, FP1 and FP2, respectively. The most abundant type in the psyllid library was Type A (36.71%), followed by Type B (25.17%) and Type C (19.72), but there was no Type D. However, the most abundant type in citrus was Type B (64.24%), followed by Type A (20.14%), C (11.11%) and D (1.39%). More interestingly, the Type A sequence was a very rare group (0.36%) in the periwinkle library. The most...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Comparative genomics analysis of Liberibacter species to elucidate
           pathogenesis and culturability

    • Abstract: Liberibacter crescens BT-1, a gram negative, rod-shaped bacterial isolate, was previously recovered from mountain papaya and sequenced. As L. crescens is culturable and is not a pathogen of citrus, comparative genomics of this strain with other uncultured, pathogenic Liberibacter should suggest genes involved in both phenotypes. Genomic comparison to Liberibacter sp. revealed differences in metabolic pathways and virulence genes.  Specific differences in metabolism include the inability of L. asiaticus and L. solanacearum to synthesize histidine, tryptophan, and thiamine, as well as a reduced ability to produce other amino acids. L. asiaticus and L. solanacearum possess a thiamine ABC transporter not found in L. crescens, which may compensate for the inability to synthesize thiamine.  Diversity in the flp pilus operon and metal ABC transporters were observed that may contribute to the pathogenesis...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Detection of 16Sr IX phytoplasma (HLB phytoplasma) in Sunn Hemp
           (Crotalaria juncea) in São Paulo State, Brazil

    • Abstract: In São Paulo State, besides the occurrence of Candidatus Liberibacter americanus and Ca. L. asiaticus, a 16Sr IX group phytoplasma was associated with HLB symptoms, indistinguishable from those caused by liberibacters. This phytoplasma is called HLB phytoplasma and was found widespread in citrus orchards, although at low incidence. The same phytoplasma was found in Sunn Hemp (Crotalaria juncea) in 2008 and witches’-broom was commonly found associated with 16Sr group IX detection. The aim of this work was to assess the phytoplasma diversity in Sunn Hemp with emphasis at the detection of group 16Sr IX phytoplasma and to establish an association between the occurrence of HLB phytoplasma and symptoms. Sunn Hemp samples were harvested close to the blooming period. Plants were selected in the field when showing symptoms common to phytoplasma infection. We employed universal primers do amplify phytoplasmas in general and group specific primers for 16Sr group...
      PubDate: Fri, 19 Dec 2014 00:00:00 +000
       
  • Transcriptome analysis of Huanglongbing-infected sweet orange leaves using
           RNA sequencing and quantitative PCR

    • Abstract: RNA sequencing (RNA-seq) methods provide a complete description of RNA transcripts including alternative splicing and small RNA characterization. RNA-seq performed in our laboratory on healthy and Huanglongbing (HLB)-infected young leaves revealed that 4,044 transcripts were up-regulated and 2,562 were down-regulated in the diseased trees. Moreover, a number of genes showed alternative splicing events including exon skipping, intron retention, and 5' and 3' alternative splicing. Furthermore, quantitative PCR (qPCR) performed on 20 randomly chosen genes with high differential expression (10 up and 10 down regulated) showed that all were consistent with RNA-seq data. Additionally, variation in levels of gene expression was observed between young and mature leaves. These early host plant response genes due to HLB-infection might be useful in the development of early HLB-detection methods before manifestation of disease symptoms in the infected plants.
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Comparison of micro RNA (miRNA) Profiles and Some miRNA Target Gene
           Expression levels in Roots of Non-infected and Huanglongbing-infected
           Tangerine (Citrus reticulata Blanco cv.‘Sanhu’ ) Trees

    • Abstract: Solexa sequencing was used to reveal the changes in small RNAome profile in roots of mock-inoculated (CK) and Huanglongbing bacteria-inoculated (HLB) ‘Sanhu’ tangerine (Citrus reticulata Blanco) trees. Results showed that the number of reads of both unique and total sRNAs decreased apparently in roots following infection with HLB. Distribution in length of sRNAs changed also remarkably, showing an increase in 22 nt and 21 nt small RNAs (sRNAs) and a decrease in 24 nt sRNAs in HLB-infected samples. A total of 42 known micro RNAs (miRNAs) belonging to 27 highly conserved miRNA families were identified. Comparisons showed that 33 known miRNAs exhibited a significant expression difference between CK and HLB-inoculated samples. In addition, 34 novel miRNAs, among which 24 were differentially expressed, were also identified, and their expression levels were analyzed by qRT-PCR. Three hundred and eighty five potential target genes were predicted for most of the 57 differentially...
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Early root infection and damage in Huanglongbing disease development

    • Abstract: Huanglongbing in grove trees is initially identified by foliar symptoms, most commonly blotchy mottle.  Detection of Candidatus Liberibacter asiaticus (Las) in leaf tissue by qPCR early in disease development is usually limited to symptomatic leaves and proximal young leaves.  Over multiple years, disease symptoms spread to the rest of the canopy.  Although Las has been detected in root tissue, the decline of roots has been assumed to happen later in disease development when photosynthate production and transport have been significantly diminished in the tree canopy.  Observations of initial spread of Las from the bud-inoculation site in the trunk of 1-yr-old potted trees have revealed that Las is frequently detectable in roots months before detection of Las in leaves and foliar symptom development.  Even after symptom development Las is more evenly distributed in root tissue than in the canopy.  Preliminary evidence suggests that Las is also more evenly distributed...
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Development of Symptom Expression and Presence of Candidatus Liberibacter
           asiaticus in Recently Infected, Mature Orange Trees

    • Abstract: There have been limited studies and documentation of how long a mature Florida orange tree can remain commercially viable after expressing initial symptoms of the HLB disease. This study focuses on understanding the distribution and spread of HLB symptoms on newly symptomatic, mature trees and the association of these symptoms with the presence of the Candidatus Liberibacter asisticus (Las) bacterium in the various sectors of a tree. The investigation of this process will lead to a better understanding of how long HLB-infected trees can survive under conventional grove practices and, possibly, to better management decisions on tree elimination.
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Colonization of Seeds of Citrus Rootstock Varieties by ‘Candidatus
           Liberibacter asiaticus’

    • Abstract: Huanglongbing (HLB) is a disease of citrus associated with a systemic infection by the α-proteobacterium ‘Candidatus Liberibacter asiaticus’.  Infection of an individual tree can occur via psyllids (Diaphorina citri Kuwayama) carrying the bacterium or if the tree is propagated from infected budwood.  Seed transmission is another possible mode of dissemination of the pathogen.  Rootstock varieties are propagated from seed so we assessed the seed transmission among eighteen rootstock varieties using seeds from mature fruit collected in late winter and immature fruit collected in late summer.  In dissected seeds real-time PCR detected pathogen DNA in seed coats at an incidence of 0-100%, whereas no pathogen DNA was detected in cotyledons or embryos from any variety.  Seeds collected in late winter were germinated in a greenhouse and no pathogen DNA was detected in extracts of shoots of 425 seedlings harvested at 7-10 days post-germination whereas a small amount...
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Analyses of proteomic expression profiles and nutrient status of citrus
           plants in response to Huanglongbing

    • Abstract: Huanglongbing (HLB) is a highly devastating citrus disease and represents a major threat to the citrus industries in US. The etiology of HLB worldwide is associated with three insect-transmissible phloem-limited members of the bacterial group ‘Candidatus Liberibacter spp.’, prevalently ‘Candidatus Liberibacter asiaticus’ (Las). All citrus cultivars are susceptible to HLB. To better understand the physiological and molecular processes involved in host responses to Las, proteomic analyses via 2-DE and mass spectrometry as well as ICP spectroscopy analysis were employed to elucidate protein expression profiles in leaves of Las-infected grapefruit and lemon plants at presymptomatic and symptomatic stages of the disease. Las-mediated down-regulation of 56 proteins including those associated with photosynthesis, protein synthesis, and metabolism was correlated with significant reductions in the concentrations of Ca, Mg, Fe, Zn, Mn, and Cu, especially in symptomatic...
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Nutrient concentration in sap extracts of HLB-infected trees

    • Abstract: Huanglongbing (HLB) has affected approximately 4% of the citrus trees in São Paulo State, Brazil. Scouting, diagnosis, and eradication of affected plants as well as control of the Asian psyllid vector of Ca. Liberibacter spp. were established as required measures for suppression of disease inoculum and maintenance of fruit production in the orchards. Despite the relative effectiveness of those, growers still look for nutrient management practices to minimize losses due to expected progress of the disease. However, clear evidence of positive effects of improved mineral nutrition on tree health and productivity is lacking. A study was set up in the field with 8-yr-old sweet orange trees to evaluate the effects of nutrients (K, Zn, and Mn), phosphate and salicilate leaf sprays to the trees four times in the year during spring and summer. The orchard presented <2% of HLB infected trees at the beginning of the study and experimental plots that represented 1800 trees...
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Characterization of the microbial community structure in ‘Candidatus
           

    • Abstract: The updated PhyloChipTM G3 were used to explore the differences in the relative abundance and phylogenetic diversity of the bacterial communities associated with HLB-affected citrus plants in the field over a growing season and those treated with antibiotic combinations of AG (Ampicillin at 1000 mg/L and Gentamicin at 100 mg/L) and PS (Penicillin at 1000 mg/L and Streptomycin at 100 mg/L). Both antibiotic treatments resulted in significantly lower Las bacterial titers (Pr<0.05) and their hybridization scores. Of the 50,000+ available operational taxonomic units (OTUs) on PhyloChip™ G3, 7,028 known OTUs in 58 phyla were detected from the field plants, and 7,407 OTUs in 53 phyla from the inoculated potted plants. Proteobacteria was the constantly dominant phylum of bacteria (38.7%~44.1%) vying for prevalence based on the season, followed by Firmicutes (23.5%~29.0%), Actinobacteria (12.4%~16.1%), Bacteroidetes (6.2%~6.6%) and Cyanobacteria...
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
  • Citrus leaf volatiles response to ‘Candidatus Liberibacter asiaticus’
           and to its insect vector Asian citrus psyllid

    • Abstract: Plant volatiles play an important role in defending plants against insects and pathogens attack. Released volatiles from insect-damaged plants may result in direct or indirect defense against insect, and volatile accumulation in pathogen-infected plants may inhibit the movement of the pathogens within plant tissues.  However, available information about the response of citrus leaf volatiles to Asian citrus psyllids (ACP) feeding and ‘Candidatus Liberibacter asiaticus’ (Clas) infection is limited.  Here we investigate the effect of ACP feeding, Clas infection, and simultaneous attack by ACP and Clas on the volatile content of Valencia leaves.  Leaf volatiles were extracted using hexane and analyzed with gas chromatography-mass spectrometry (GC-MS).  Eighteen out of  twenty-seven detected volatiles were induced (2 to 10-folds) in ACP-infested plants.  On the other hand, only four volatiles were induced in Clas-infected plants (d-limonene, β-phelandrene, citronellal,...
      PubDate: Thu, 18 Dec 2014 00:00:00 +000
       
 
JournalTOCs
School of Mathematical and Computer Sciences
Heriot-Watt University
Edinburgh, EH14 4AS, UK
Email: journaltocs@hw.ac.uk
Tel: +00 44 (0)131 4513762
 


Your IP address: 44.210.77.106
 
Home (Search)
API
About JournalTOCs
News (blog, publications)
JournalTOCs on Twitter   JournalTOCs on Facebook

JournalTOCs © 2009-