for Journals by Title or ISSN
for Articles by Keywords
  Subjects -> CHEMISTRY (Total: 825 journals)
    - ANALYTICAL CHEMISTRY (47 journals)
    - CHEMISTRY (575 journals)
    - CRYSTALLOGRAPHY (22 journals)
    - ELECTROCHEMISTRY (26 journals)
    - INORGANIC CHEMISTRY (41 journals)
    - ORGANIC CHEMISTRY (46 journals)
    - PHYSICAL CHEMISTRY (68 journals)

CHEMISTRY (575 journals)            First | 1 2 3 4 5 6 | Last

Journal of Chemical Health Risks     Open Access   (Followers: 2)
Journal of Chemical Information and Modeling     Full-text available via subscription   (Followers: 6)
Journal of Chemical Research     Full-text available via subscription   (Followers: 5)
Journal of Chemical Science and Technology     Open Access   (Followers: 3)
Journal of Chemical Sciences     Partially Free   (Followers: 16)
Journal of Chemical Theory and Computation     Full-text available via subscription   (Followers: 11)
Journal of Cheminformatics     Open Access   (Followers: 1)
Journal of Chemistry     Open Access   (Followers: 3)
Journal of Chemometrics     Hybrid Journal   (Followers: 10)
Journal of Chromatography A     Hybrid Journal   (Followers: 50)
Journal of Chromatography Library     Full-text available via subscription   (Followers: 5)
Journal of Clinical Toxicology     Open Access  
Journal of Colloid and Interface Science     Hybrid Journal   (Followers: 13)
Journal of Computational Chemistry     Hybrid Journal   (Followers: 14)
Journal of Coordination Chemistry     Hybrid Journal   (Followers: 1)
Journal of Dispersion Science and Technology     Hybrid Journal  
Journal of Encapsulation and Adsorption Sciences     Open Access   (Followers: 5)
Journal of Environmental Chemistry and Ecotoxicology     Open Access   (Followers: 2)
Journal of Flow Chemistry     Full-text available via subscription   (Followers: 1)
Journal of Fluorescence     Hybrid Journal   (Followers: 3)
Journal of Fluorine Chemistry     Hybrid Journal   (Followers: 6)
Journal of Fuel Chemistry and Technology     Full-text available via subscription   (Followers: 5)
Journal of Great Lakes Research     Hybrid Journal   (Followers: 7)
Journal of Heterocyclic Chemistry     Hybrid Journal   (Followers: 5)
Journal of Immunoassay and Immunochemistry     Hybrid Journal   (Followers: 3)
Journal of Inclusion Phenomena and Macrocyclic Chemistry     Hybrid Journal   (Followers: 1)
Journal of Inorganic Biochemistry     Hybrid Journal   (Followers: 2)
Journal of Labelled Compounds and Radiopharmaceuticals     Hybrid Journal   (Followers: 1)
Journal of Macromolecular Science, Part A: Pure and Applied Chemistry     Hybrid Journal   (Followers: 4)
Journal of Mass Spectrometry     Hybrid Journal   (Followers: 23)
Journal of Materials Chemistry A : Materials for Energy and Sustainability     Full-text available via subscription   (Followers: 23)
Journal of Materials Chemistry B : Materials for Biology and Medicine     Full-text available via subscription   (Followers: 5)
Journal of Materials Chemistry C : Materials for Optical, Magnetic and Electronic Devices     Full-text available via subscription   (Followers: 6)
Journal of Materials Physics and Chemistry     Open Access  
Journal of Materials Research     Full-text available via subscription   (Followers: 9)
Journal of Mathematical Chemistry     Hybrid Journal   (Followers: 4)
Journal of Medicinal Chemistry     Full-text available via subscription   (Followers: 260)
Journal of Membrane and Separation Technology     Hybrid Journal  
Journal of Membrane Science     Hybrid Journal   (Followers: 11)
Journal of Modern Chemistry & Chemical Technology     Full-text available via subscription   (Followers: 2)
Journal of Molecular Catalysis A: Chemical     Hybrid Journal   (Followers: 3)
Journal of Molecular Graphics and Modelling     Hybrid Journal   (Followers: 4)
Journal of Molecular Liquids     Hybrid Journal   (Followers: 2)
Journal of Molecular Modeling     Hybrid Journal   (Followers: 3)
Journal of Molecular Recognition     Hybrid Journal   (Followers: 2)
Journal of Molecular Spectroscopy     Hybrid Journal   (Followers: 6)
Journal of Molecular Structure     Hybrid Journal   (Followers: 3)
Journal of Nanoparticles     Open Access  
Journal of Nanostructure in Chemistry     Open Access   (Followers: 4)
Journal of Natural Gas Chemistry     Full-text available via subscription   (Followers: 2)
Journal of Nepal Chemical Society     Open Access  
Journal of Nucleic Acids Investigation     Open Access   (Followers: 2)
Journal of Ocean University of China (English Edition)     Hybrid Journal   (Followers: 1)
Journal of Organometallic Chemistry     Hybrid Journal   (Followers: 12)
Journal of Photochemistry and Photobiology A: Chemistry     Hybrid Journal   (Followers: 4)
Journal of Photochemistry and Photobiology C: Photochemistry Reviews     Full-text available via subscription   (Followers: 3)
Journal of Polymer & Composites     Full-text available via subscription  
Journal of Polymer and Biopolymer Physics Chemistry     Open Access   (Followers: 1)
Journal of Polymer Science Part A: Polymer Chemistry     Hybrid Journal   (Followers: 218)
Journal of Polymers     Open Access   (Followers: 1)
Journal of Porphyrins and Phthalocyanines     Hybrid Journal   (Followers: 2)
Journal of Pure and Applied Chemistry Research     Open Access   (Followers: 1)
Journal of Raman Spectroscopy     Hybrid Journal   (Followers: 11)
Journal of Research Updates in Polymer Science     Hybrid Journal  
Journal of Saudi Chemical Society     Open Access  
Journal of Solid State Chemistry     Hybrid Journal   (Followers: 14)
Journal of Solution Chemistry     Hybrid Journal   (Followers: 4)
Journal of Structural Chemistry     Hybrid Journal  
Journal of Sulfur Chemistry     Hybrid Journal   (Followers: 2)
Journal of Superhard Materials     Hybrid Journal   (Followers: 1)
Journal of Surfactants and Detergents     Hybrid Journal   (Followers: 5)
Journal of Systems Chemistry     Open Access   (Followers: 1)
Journal of Taibah University for Science     Open Access  
Journal of the American Chemical Society     Full-text available via subscription   (Followers: 329)
Journal of the American Society for Mass Spectrometry     Hybrid Journal   (Followers: 20)
Journal of the American Society of Brewing Chemists     Full-text available via subscription   (Followers: 1)
Journal of the Bangladesh Chemical Society     Open Access  
Journal of the Chilean Chemical Society     Open Access   (Followers: 2)
Journal of the Iranian Chemical Society     Hybrid Journal   (Followers: 1)
Journal of the Korean Society for Applied Biological Chemistry     Hybrid Journal   (Followers: 1)
Journal of the Mexican Chemical Society     Open Access   (Followers: 1)
Journal of Theoretical and Computational Chemistry     Hybrid Journal   (Followers: 8)
Journal of Theoretical Chemistry     Open Access  
Journal of Wood Chemistry and Technology     Hybrid Journal   (Followers: 7)
JPC - Journal of Planar Chromatography - Modern TLC     Full-text available via subscription   (Followers: 6)
Jurnal Penelitian Sains (JPS)     Open Access  
Jurnal Teknologi Informasi     Open Access   (Followers: 3)
Kinetics and Catalysis     Hybrid Journal   (Followers: 3)
Korea-Australia Rheology Journal     Hybrid Journal  
Langmuir     Full-text available via subscription   (Followers: 39)
Latvian Journal of Chemistry     Open Access   (Followers: 1)
Lebensmittelchemie     Hybrid Journal   (Followers: 1)
Lipid Insights     Open Access   (Followers: 1)
Luminescence     Hybrid Journal   (Followers: 1)
Macromolecular Materials & Engineering     Hybrid Journal   (Followers: 5)
Macromolecular Rapid Communications     Hybrid Journal   (Followers: 5)
Macromolecular Research     Hybrid Journal  
Macromolecular Symposia     Hybrid Journal  
Macromolecular Theory and Simulations     Hybrid Journal  
Macromolecules     Full-text available via subscription   (Followers: 34)

  First | 1 2 3 4 5 6 | Last

Journal Cover   Photochemistry and Photobiology
  [SJR: 0.764]   [H-I: 96]   [3 followers]  Follow
   Hybrid Journal Hybrid journal (It can contain Open Access articles)
   ISSN (Print) 0031-8655 - ISSN (Online) 1751-1097
   Published by John Wiley and Sons Homepage  [1608 journals]
  • An Optimized Firefly Luciferase Bioluminescent Assay for the Analysis of
           Free Fatty Acids
    • Authors: Simone M. Marques; Luís M. Gonçalves, Joaquim C.G. Esteves da Silva
      Abstract: A firefly luciferase (LUC)‐based bioluminescent assay for total free fatty acids (FFA) is presented. It is based on LUC's capability of converting FFA into fatty acyl‐adenylates with consumption of adenosine 5’‐triphosphate (ATP). Since ATP is a co‐substrate in LUC's bioluminescent reaction, together with firefly d‐luciferin (d‐LH2) and atmospheric oxygen (O2), any reduction in the assay's ATP content will lead to a decrease in the bioluminescent signal, which is proportional to the amount of FFA. Using FFA mixtures containing myristic (14:0), palmitic (16:0), stearic (18:0), oleic (18:1) and arachidonic acid (20:4) in ethanol, the assay was optimized through statistical experimental design methodology, namely fractional factorial (screening) and central composite (optimization) designs. The optimized method requires 2 μL of sample per tube in a final reaction volume of 50 μL. It is linear in the concentration range from 1 to 20 μM, with limits of detection (LOD) and quantitation (LOQ) of 1.3 and 4.5 μM, respectively. The method proved to be simple to perform, demands low reagent volumes, it is sensitive and robust and may be adapted to high‐throughput screening. This article is protected by copyright. All rights reserved.
      PubDate: 2015-04-16T07:56:38.018896-05:
      DOI: 10.1111/php.12458
  • Promotion of Pro‐Apoptotic Signals by Lysosomal Photodamage
    • Authors: David Kessel; John J. Reiners
      Abstract: We previously reported that low level lysosomal photodamage enhanced the efficacy of subsequent mitochondrial photodamage, resulting in a substantial promotion of apoptotic cell death. We now extend our analysis of the sequential PDT protocol to include two additional lysosomal‐targeting photosensitizers. These agents, because of enhanced permeability, are more potent than the agent (N‐aspartyl chlorin E6, NPe6) used in the initial study. Addition of the cell‐permeable cysteine protease inhibitor E‐64d and calcium chelator BAPTA‐AM almost completely suppressed sequential PDT‐induced loss of mitochondrial membrane potential, activation of procaspases‐3 and ‐7 and loss of colony formation. These inhibitors did not, however, suppress the pro‐apoptotic effect of a BH3 mimetic or mitochondrial photodamage. Knockdowns of ATG7 or ATG5, proteins normally associated with autophagy, suppressed photokilling induced by the sequential PDT protocol. These effects appear to be independent of the autophagic process since pharmacological inhibition of autophagy offered no such protection. Effects of ATG7 and ATG5 knockdown may reflect the role that ATG7 plays in regulating lysosome permeability, and the likelihood that a proteolytic fragment of ATG5 amplifies mitochondrial pro‐apoptotic processes. Our results suggest that low‐dose photodamage that sequentially targets lysosomes and mitochondria may offer significant advantages over the use of single photosensitizers. This article is protected by copyright. All rights reserved.
      PubDate: 2015-04-15T01:52:21.372731-05:
      DOI: 10.1111/php.12456
  • Light‐mediated DNA Repair Prevents UVB‐induced Cell Cycle
           Arrest in Embryos of the Crustacean Macrobrachium olfersi
    • Authors: Eliane Cristina Zeni; Dib Ammar, Mayana Lacerda Leal, Heloisa Schramm da Silva, Silvana Allodi, Yara Maria Rauh Müller, Evelise Maria Nazari
      Abstract: High levels of ultraviolet‐B (UVB) radiation can negatively affect aquatic animals. Macrobrachium olfersi is a prawn that lives in clear freshwaters and during the breeding season, females carry eggs in an external brood pouch. Therefore, we hypothesize that eggs are also exposed to environmental UVB radiation. The aim of this study was to investigate whether UVB radiation induces DNA damage and compromises cell‐cycle in embryos of M. olfersi. In laboratory, UVB irradiance (310−2) that embryos receive in the natural environment was simulated. After irradiation, embryos were kept under different light conditions in order to recognize the presence of cell repair. UVB radiation induces DNA damage, specifically thymine dimers. After 48h of UVB exposure, a significant decrease in the level of these dimers was observed in embryos kept under visible light while it remained constant in the dark. Moreover, under visible light and darkness, a decrease in proliferation was observed after 48h of irradiation. An increase in PCNA expression and decrease in p53 expression were observed after, respectively, 1h and 48h of exposure. Our results showed that UVB radiation disturbs the cell‐cycle and induces DNA damage in M. olfersi embryos. However, under visible light these embryos showed successful DNA repair. This article is protected by copyright. All rights reserved.
      PubDate: 2015-04-13T11:49:30.413911-05:
      DOI: 10.1111/php.12457
  • Effects of Silencing Heme Biosynthesis Enzymes on 5‐Aminolevulinic
           Acid‐mediated Protoporphyrin IX Fluorescence and Photodynamic
    • Authors: Xue Yang; Weihua Li, Pratheeba Palasuberniam, Kenneth A. Myers, Chenguang Wang, Bin Chen
      Abstract: Aminolevulinic acid (ALA)‐mediated protoporphyrin IX (PpIX) production is being explored for tumor fluorescence imaging and photodynamic therapy (PDT). As a prodrug, ALA is converted in heme biosynthesis pathway to PpIX with fluorescent and photosensitizing properties. To better understand the role of heme biosynthesis enzymes in ALA‐mediated PpIX fluorescence and PDT efficacy, we used lentiviral shRNA to silence the expression of porphobilinogen synthase (PBGS), porphobilinogen deaminase (PBGD) and ferrochelatase (FECH) in SkBr3 human breast cancer cells. PBGS and PBGD are the first two cytosolic enzymes involved in PpIX biosynthesis, and FECH is the enzyme responsible for converting PpIX to heme. PpIX fluorescence was examined by flow cytometry and confocal fluorescence microscopy. Cytotoxicity was assessed after ALA‐mediated PDT. Silencing PBGS or PBGD significantly reduced ALA‐stimulated PpIX fluorescence whereas silencing FECH elevated basal and ALA‐stimulated PpIX fluorescence. However, compared with vector control cells, the ratio of ALA‐stimulated fluorescence to basal fluorescence without ALA was significantly reduced in all knockdown cell lines. PBGS or PBGD knockdown cells exhibited significant resistance to ALA‐PDT, while increased sensitivity to ALA‐PDT was found in FECH knockdown cells. These results demonstrate the importance of PBGS, PBGD and FECH in ALA‐mediated PpIX fluorescence and PDT efficacy. This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-21T09:12:33.479197-05:
      DOI: 10.1111/php.12454
  • Photo– and chemical–reduction of copper onto
           anatase–type TiO2 nanoparticles with enhanced surface hydroxyl
           groups as efficient visible–light photocatalysts
    • Authors: Hamed Eskandarloo; Alireza Badiei, Mohammad A. Behnajady, Ghodsi Mohammadi Ziarani
      Abstract: In this study, the photocatalytic efficiency of anatase–type TiO2 nanoparticles synthesized using the sol–gel low temperature method, were enhanced by a combined process of copper reduction and surface hydroxyl groups enhancement. UV–light–assisted photo– and NaBH4–assisted chemical–reduction methods were used for deposition of copper onto TiO2. The surface hydroxyl groups of TiO2 were enhanced with the assistance of NaOH modification. The prepared catalysts were immobilized on glass plates and used as the fixed–bed systems for the removal of phenazopyridine as a model drug contaminant under visible–light irradiation. NaOH–modified Cu/TiO2 nanoparticles demonstrated higher photocatalytic efficiency than that of pure TiO2 due to the extending of the charge carriers lifetime and enhancement of the adsorption capacity of TiO2 toward phenazopyridine (PhP). The relationship of structure and performance of prepared nanoparticles has been established by using various techniques, such as XRD, XPS, TEM, EDX, XRF, TGA, DRS, and PL. The effects of preparation variables, including copper content, reducing agents rate (NaBH4 concentration and UV–light intensity), and NaOH concentration were investigated on the photocatalytic efficiency of NaOH–modified Cu/TiO2 nanoparticles. This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-21T09:08:37.910285-05:
      DOI: 10.1111/php.12455
  • Effects of enhanced UV‐B radiation on biochemical traits in
           postharvest flowers of medicinal chrysanthemum
    • Authors: Chao Si; Xiao‐Qin Yao, Xue‐Li He, Jian‐Zhou Chu, Chun‐Hui Ma, Xiao‐Fei Shi
      Abstract: The paper reported UV‐B radiation effects on biochemical traits in postharvest flowers of chrysanthemum. The experiment included six levels of UV‐B radiation (UV0, 0 μW cm−2; UV50, 50 μW cm−2; UV200, 200 μW cm−2; UV400, 400 μW cm−2; UV600, 600 μW cm−2 and UV800, 800 μW cm−2). Enhanced UV‐B radiation significantly increased hydrogen peroxide content (except for UV50), but did not evidently affect malondialdehyde content in flowers. Chlorophyll b and total chlorophyll content were significantly increased by UV600 and UV800. UV400 and UV600 significantly increased anthocyanins, carotenoids and UV‐B absorbing compounds content, and the activities of phenylalanine ammonia lyase (PAL) and cinnamic acid‐4‐hydroxylase (C4H) over the control. 4‐coumarate CoA ligase (4CL) activity was significantly decreased by enhanced UV‐B radiation (except for UV50). The relationships between UV‐B radiation intensities and the activities of secondary metabolism enzymes were best described by a second‐order polynomial. The R2 values for UV‐B radiation intensities and the activities of PAL, C4H and 4CL were 0.8361, 0.5437 and 0.8025, respectively. The results indicated that enhanced UV‐B radiaiton could promote secondary metabolism processes in postharvest flowers, which might be beneficial for the accumulation of medically active ingredients in medicinal plants. The optimal UV‐B radiation intensities in the study were between UV400‐UV600. This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-17T00:27:18.202906-05:
      DOI: 10.1111/php.12450
  • On the Dual Phosphorescence of Xanthone and Chromone in Glassy Hydrocarbon
    • Authors: Dale McMorrow; Michon Irons Wyche, Pi Tai Chou, Michael Kasha
      Abstract: Trace quantities of hydrogen‐bonding impurities in otherwise highly purified and dried glassy hydrocarbon matrices at 77K can modify the relative triplet state energy levels, and hence the photophysical properties of two aromatic ketones, xanthone and chromone, to the extent that the intrinsic spectroscopic properties are obscured. The intrinsic spectroscopic properties of each are revealed in multicrystalline n‐alkane Shpol'skii matrices, and also can be observed in rigorously purified and dried hydrocarbon glasses at 77K. The extreme sensitivity to stoichiometric, and even sub‐stoichiometric quantities of hydrogen‐bonding impurities arises from the near‐degeneracy of the two lowest‐lying triplet states, and the sensitive nature of the n→π* blue shift phenomena to specific hydrogen‐bonding interactions. This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-12T09:26:37.085379-05:
      DOI: 10.1111/php.12451
  • Utilization of PARAFAC‐Modeled Excitation‐Emission Matrix
           (EEM) Fluorescence Spectroscopy to Identify Biogeochemical Processing of
           Dissolved Organic Matter in a Northern Peatland
    • Authors: Malak M. Tfaily; Jane E. Corbett, Rachel Wilson, Jeffrey P. Chanton, Paul H. Glaser, Kaelin M. Cawley, Rudolf Jaffé, William T. Cooper
      Abstract: In this study we contrast the fluorescent properties of dissolved organic matter (DOM) in fens and bogs in a Northern Minnesota peatland using excitation emission matrix fluorescence spectroscopy with parallel factor analysis (EEM‐PARAFAC). EEM‐PARAFAC identified four humic‐like components and one protein‐like component and the dynamics of each were evaluated based on their distribution with depth as well as across sites differing in hydrology and major biological species. The PARAFAC‐EEM experiments were supported by dissolved organic carbon measurements (DOC), optical spectroscopy (UV‐Vis), and compositional characterization by ultrahigh resolution Fourier transform ion cyclotron resonance mass spectroscopy (FT‐ICR MS). The FT‐ICR MS data indicate that metabolism in peatlands reduces the molecular weights of individual components of DOM, and oxygen‐rich less aromatic molecules are selectively biodegraded. Our data suggest that different hydrologic and biological conditions within the larger peat ecosystem drive molecular changes in DOM, resulting in distinctly different chemical compositions and unique fluorescent fingerprints. PARAFAC modeling of EEM data coupled with ultrahigh resolution FT‐ICR MS has the potential to provide significant molecular‐based information on DOM composition that will support efforts to better understand the composition, sources, and diagenetic status of DOM from different terrestrial and aquatic systems. This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-12T09:20:42.060971-05:
      DOI: 10.1111/php.12448
  • Photodegradation of Hydrophobic Pyridineketoximes in Toluene and Heptane
    • Authors: Karolina Wieszczycka; Joanna Zembrzuska
      Abstract: The goal of the research was to study the reactivity of the hydrophobic 2‐ and 3‐pyridineketoximes under exposure to UV‐VIS light. The photodegradation was conducted in both toluene and heptane for 10 hours under atmosphere of argon. Ten‐hour irradiation experiments demonstrated that the pyridineketoximes underwent the facile E‐Z photoisomerisation, photo‐Beckmann rearrangement and, in the lesser extent, the photosubstitution to the pyridine ring. From LC‐MS and NMR analysis of the irradiated solutions it was found that the photosubstitution proceeded to give the corresponding 6‐substituted 2‐ or 3‐pyridylketoxime via the replacement of the ring hydrogen by the benzyl or heptyl group. The photo‐Beckmann rearrangement led to the formation of the corresponding amides, but also other products formed in the photo‐decomposition reaction This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-12T07:10:33.772255-05:
      DOI: 10.1111/php.12453
  • A Novel Microsensor for Measuring Angular Distribution of Radiative
    • Authors: Thomas E. Murphy; Stuart Pilorz, Leslie Prufert‐Bebout, Brad Bebout
      Abstract: This article presents the design, construction, and characterization of a novel type of light probe for measuring the angular radiance distribution of light fields. The differential acceptance angle (DAA) probe can resolve the directionality of a light field in environments with steep light gradients, such as microbial mats, without the need to remove, re‐orient, and re‐insert the probe, a clear advantage over prior techniques. The probe consists of an inner irradiance sensor inside a concentric, moveable light absorbing sheath. The radiative intensity in a specific zenith direction can be calculated by comparing the irradiance onto the sensor at different acceptance angles. We used this probe to measure the angular radiance distribution of two sample light fields, and observed good agreement with a conventional radiance probe. The DAA probe will aid researchers in understanding light transfer physics in dense microbial communities and expedite validation of numerical radiative transfer models for these environments. This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-12T07:04:25.81225-05:0
      DOI: 10.1111/php.12452
  • Effects of PAR and UV radiation on the structural and functional integrity
           of phycocyanin, phycoerythrin and allophycocyanin isolated from the marine
           cyanobacterium Lyngbya sp. A09DM
    • Authors: Rajesh P Rastogi; Ravi Raghav Sonani, Datta Madamwar
      Abstract: An in vitro analysis of the effects of photosynthetically active and ultraviolet radiations was executed to assess the photostability of biologically relevant pigments phycocyanin (PC), phycoerythrin (PE) and allophycocyanin (APC) isolated from Lyngbya sp. A09DM. Ultraviolet (UV) irradiances significantly affected the integrity of PC, PE and APC; however, PAR showed least effect. UV radiation affected the bilin chromophores covalently attached to phycobiliproteins (PBPs). Almost complete elimination of the chromophore bands associated with α‐ and β‐subunit of PE and APC occurred after 4 h of UV‐B exposure. After 5 h of UV‐B exposure, the content of PC, PE and APC decreased by 51.65%, 96.8% and 96.53%, respectively. Contrary to PAR and UV‐A radiation, a severe decrease in fluorescence of all PBPs was observed under UV‐B irradiation. The fluorescence activity of extracted PBP was gradually inhibited immediately after 15‐30 min of UV‐B exposure. In comparison to the PC, the fluorescence properties of PE and APC were severely lost under UV‐B radiation. Moreover, the present study indicates that UV‐B radiation can damage the structural and functional integrity of phycobiliproteins leading to the loss of their ecological and biological functions This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-12T07:02:03.268454-05:
      DOI: 10.1111/php.12449
  • High Final Energy of Low ‐ Level Gallium Arsenide Laser Therapy
           Enhances Skeletal Muscle Recovery without a Positive Effect on Collagen
    • Authors: Carlos Eduardo Assumpção Freitas; Raquel Santilone Bertaglia, Ivan José Vechetti Júnior, Edson Assunção Mareco, Rondinelle Artur Simões Salomão, Tassiana Gutierrez Paula, Gisele Alborghetti Nai, Robson Francisco Carvalho, Francis Lopes Pacagnelli, Maeli Dal‐Pai‐Silva
      Abstract: The aim of this study was to evaluate the effects of a Gallium Arsenide (GaAs) laser, using a high final energy of 4.8 Joules, during muscle regeneration after cryoinjury. Thirty Wistar rats were divided into three groups: Control (C, n=10); Injured (I, n=10) and Injured and laser treated (Injured/LLLT, n=10). The cryoinjury was induced in the central region of the Tibialis Anterior muscle (TA). The applications of the laser (904 nm, 50mW average power) were initiated 24 hours after injury, at energy density of 69 J/cm2 for 48 seconds, for five days, to two points of the lesion. Twenty‐four hours after the final application, the TA muscle was removed and frozen in liquid nitrogen to assess the general muscle morphology and the gene expression of TNF‐α, TGF‐β, MyoD and Myogenin. The Injured/LLLT group presented a higher number of regenerating fibers and fewer degenerating fibers (p
      PubDate: 2015-03-07T08:51:11.563966-05:
      DOI: 10.1111/php.12446
  • Steady state spectroscopy of the
           2‐(N‐methylacetimidoyl)‐1‐naphthol molecule
    • Authors: Juan Carlos del Valle; Cristina Díaz‐Oliva
      Abstract: The steady‐state spectroscopy of 2‐(N‐methylacetimidoyl)‐1‐naphthol (MAN) reveals composite absorption and emission spectra from 298 to 193 K in hexane. The ground electronic state (So) absorption can be assigned to the sum of three molecular structures: the OH normal tautomer, and two NH proton‐transfer tautomers. The NH‐structures are the most stable ones in equilibrium with the OH tautomer for the So state. On photoexcitation of the OH‐tautomer the excited state intramolecular proton‐transfer is undergone, and the corresponding NH‐emission is monitored at 470 nm. On photoexcitation of the NH‐tautomers the previous emission is monitored in addition to another emission at 600 nm, which is ascribed to intramolecular hydrogen‐bonded (IHB) non‐planar NH‐structures generated from the IHB planar NH‐tautomers. A Jabłoński diagram is introduced which gathers all the experimental evidence as well as the theoretical calculations executed at the DFT‐B3LYP and TD‐DFT levels. The MAN molecule is compared with other analogues such as 1‐hydroxy‐2‐acetonaphthone (HAN), 2‐(1΄‐hydroxy‐2΄‐naphthyl)benzimidazole, and methyl 1‐hydroxy‐2‐naphthoate in order to validate the theoretical calculations. Photoexcitation of MAN generates two emission bands at longer wavelengths than that of the emission band of HAN. The MAN molecule exhibits a great photostability in hydrocarbon solution which depends on the photophysics of the NH‐tautomers (keto forms). This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-04T04:32:11.129832-05:
      DOI: 10.1111/php.12444
  • Biomodulation of Inflammatory Cytokines Related to Oral Mucositis by
           Low‐Level Laser Therapy
    • Authors: Fernanda G. Basso; Taisa N. Pansani, Diana G. Soares, Débora L. Scheffel, Vanderlei S. Bagnato, Carlos Alberto de Souza Costa, Josimeri Hebling
      Abstract: This study evaluated the effects of LLLT on the expression of inflammatory cytokines related to the development of oral mucositis by gingival fibroblasts. Primary gingival fibroblasts were seeded on 24‐well plates (105 cells/well) for 24 hours. Fresh serum‐free culture medium (DMEM) was then added, and cells were placed in contact with LPS (Escherichia coli, 1 μg/mL), followed by LLLT irradiation (LaserTABLE ‐ InGaAsP diode prototype – 780 nm, 25 mW) delivering 0, 0.5, 1.5, or 3 J/cm². Cells without contact with LPS were also irradiated with the same energy densities. Gene expression of TNF‐α, IL‐1β, IL‐6, and IL‐8 was evaluated by Real‐Time PCR, and protein synthesis of these cytokines was determined by enzyme‐linked immunosorbent (ELISA) assay. Data were statistically analyzed by the Kruskal‐Wallis test, complemented by the Mann‐Whitney test (P < 0.05). LPS treatment increased the gene expression and protein synthesis of TNF‐α, IL‐6, and IL‐8, while the expression of IL‐1β was not affected. For LPS‐treated groups, LLLT promoted significant decreases in the expression of TNF‐α, IL‐6, and IL‐8 at 1.5 J/cm2 and 3 J/cm2. These results demonstrate that LLLT promoted a beneficial biomodulatory effect on the expression of inflammatory cytokines related to oral mucositis by human gingival fibroblasts. This article is protected by copyright. All rights reserved.
      PubDate: 2015-03-04T04:24:45.566994-05:
      DOI: 10.1111/php.12445
  • Photosensitizing Activity of Endogenous Eye Lens Chromophores: an Attempt
           to Unravel Their Contributions to Photo‐Aging and Cataract Disease
    • Authors: Felipe Ávila; Bertrand Friguet, Eduardo Silva
      Abstract: UVA‐visible light has been proposed as a risk factor in the photo‐aging of the human eye lens, as well as in the etiology of cataract disease. There is accumulating evidence indicating that photosensitizing reactions mediated by endogenous chromophores, which are generated during human eye lens aging, can play an important role in the generation of these processes. These reactions can lead to protein impairment by inducing non‐enzymatic post‐translational modifications such as protein oxidation and crosslinking. Although numerous chromophores have been characterized as both bound to human eye lens proteins and as unbound low‐molecular‐mass compounds, their contribution to eye lens photoaging and cataract disease is not completely understood. In this article we discuss the photochemical contribution of UV‐filters derived from tryptophan catabolism and advanced glycation end products (AGEs) to human eye lens aging and cataract disease. We also discuss the recently described photosensitizing capacity of chromophores derived from newly discovered glucose and ascorbate degradation as a parallel pathway to their role in AGEs generation. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-27T10:22:20.256761-05:
      DOI: 10.1111/php.12443
  • Endogenous Retinoic Acid Required to Maintain the Epidermis Following
           Ultraviolet Light Exposure in SKH‐1 Hairless Mice
    • Authors: Katherine L. Gressel; Jason F. Duncan, Tatiana M. Oberyszyn, Krista M. La Perle, Helen B. Everts
      Abstract: Ultraviolet light B (UVB) exposure induces cutaneous squamous cell carcinoma (cSCC), one of the most prevalent human cancers. Reoccurrence of cSCC in high‐risk patients is prevented by oral retinoids. But oral retinoid treatment causes significant side effects; and patients develop retinoid resistance. Exactly how retinoids prevent UVB‐induced cSCC is currently not well understood. Retinoid resistance blocks mechanistic studies in the leading mouse model of cSCC, the UVB exposed SKH‐1 hairless mouse. To begin to understand the role of retinoids in UVB‐induced cSCC we first examined the localization pattern of key retinoid metabolism proteins by immunohistochemistry 48 hours after UVB treatment of female SKH‐1 mice. We next inhibited retinoic acid (RA) synthesis immediately after UVB exposure. Acute UVB increased RA synthesis, signaling, and degradation proteins in the stratum granulosum. Some of these proteins changed their localization; while other proteins just increased in intensity. In contrast, acute UVB reduced the retinoid storage protein lectin:retinol acyltransferase (LRAT) in the epidermis. Inhibiting RA synthesis disrupted the epidermis and impaired differentiation. These data suggests that repair of the epidermis after acute UVB exposure requires endogenous RA synthesis. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-26T01:32:03.40306-05:0
      DOI: 10.1111/php.12441
  • Fluorescence properties of diphenylthiazolo[4,5‐b]pyrazines tuned by
           donor‐acceptor substituent effects
    • Authors: Tatsuki Nakagawa; Minoru Yamaji, Shojiro Maki, Haruki Niwa, Takashi Hirano
      Abstract: Fluorescence properties of 2,6‐ and 2,5‐diphenylthiazolo[4,5‐b]pyrazine (TPy) derivatives having an electron‐donating substituent (methoxy and dimethylamino) on the the 6‐ and 5‐phenyl groups were studied. It was found that 2,6‐diphenyl derivatives fluoresce more efficiently than 2,5‐diphenyl derivatives. Furthermore, a 2,6‐diphenyl derivative having an additional cyano group on the 2‐phenyl ring was an excellent fluorophore showing a wide solvatochromism with great fluorescence yields. Based on the obtained spectroscopic data and mechanistic explanations concerning the substituent effects on the fluorescence properties, useful information on designing new TPy fluorophores is provided. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-25T00:48:36.807819-05:
      DOI: 10.1111/php.12440
  • Actual Isothermal Effects of Water‐Filtered Infrared A
    • Authors: Annika Höhn; Petra Hartmann, Veronika Gebhart, Johanna Sonntag, Tilman Grune, Tobias Jung
      Abstract: In this study, the athermal effects of water‐filtered infrared A (wIRA)‐irradiation (780‐1400 nm) on human dermal fibroblasts were investigated. For this purpose, cells were exposed to wIRA‐irradiation (178 mW/cm2 for 1h), while a sophisticated experimental setup prevented warming of the samples exceeding 0.1 °C. The investigated parameters were the formation of reactive oxygen species (ROS), mitochondrial membrane potential and superoxide release, protein oxidation, proliferation rate, as well as intracellular Ca2+‐release in single cells, most of them quantified via fluorescence microscopy and fluorimetric techniques. The existence of actual athermal wIRA‐effects is still intensively discussed, since their detection requires a careful experimental setup and both efficient and powerful temperature regulation of the exposed samples. Here, we can definitively show that some of the supposed athermal wIRA‐effects may be rather artifacts, since wIRA did not reveal any impact on the above mentioned parameters ‐ as long as the temperature of the exposed cells was carefully maintained. Though, we were able to identify an athermal DNA‐protective wIRA‐effect, since the induced DNA‐damage (quantified via 8‐Oxo‐G‐formation) was significantly decreased after a subsequent UVB‐exposure. These results suggest that many of the supposed athermal wIRA‐effects can be induced by pure warming of the samples, independent from any wIRA‐irradiation. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-24T03:42:44.028235-05:
      DOI: 10.1111/php.12439
  • Susceptibility of Ureaplasma urealyticum to methylene blue‐mediated
           photodynamic antimicrobial chemotherapy: an in vitro study
    • Authors: Tinglu Ye; Bancheng Chen, Bo Yu, Qili Zhong, Guoxing Huang, Xiaoping Hu, Wei Zhang
      Abstract: The aim of the present study was to detect the susceptibility of Ureaplasma urealyticum to methylene blue‐mediated photodynamic antimicrobial chemotherapy (PACT). Three U. urealyticum strains including the standard serotype 1 and 5, and a clinically collected strain were used in this study. Strains were first incubated in 96‐well culture plates in the presence of methylene blue with decreasing concentrations (from 1 to 0.015625 mg mL−1) for 20 or 60min, and then submitted to irradiation with a light‐emitting diode laser with a power density of 100mW/cm2 for 8, 17, 34 or 68min. Regrowth of the strains was performed soon after irradiation. A significant inactivation effect was observed after PACT. Longer incubation time induced more extensive inactivation of U. urealyticum. No difference in response to PACT was observed between the two biovars of U. urealyticum. It was concluded that PACT had a significant inactivation effect on U. urealyticum, and it might be a promising alternative treatment for resistant U. urealyticum infections. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-17T08:28:12.130599-05:
      DOI: 10.1111/php.12438
  • Improved spectral coverage and fluorescence quenching in
           donor‐acceptor systems involving Indolo[3‐2‐b]carbazole
           and Boron‐dipyrromethene (BODIPY) or Diketopyrrolo‐pyrrole
    • Authors: Adis Khetubol; Sven Van Snick, Melissa. L. Clark, Eduard Fron, Eduardo Coutiño‐González, Arvid Cloet, Koen Kennes, Yuliar Firdaus, Maarten Vlasselaer, Volker Leen, Wim Dehaen, Mark Auweraer
      Abstract: A novel π‐conjugated triad and a polymer incorporating indolo[3,2‐b]‐carbazole (ICZ) and 4,4‐difluoro‐4‐bora‐3a,4a‐diaza‐s‐indacene (BODIPY) were synthesized via a Sonogashira coupling. Compared to the parent BODIPY the absorption and fluorescence spectrum were for both compounds broader and red‐shifted. The red‐shift of the fluorescence and the decrease of the fluorescence quantum yield and decay time upon increasing solvent polarity were attributed to the formation of a partial charge transfer state. Upon excitation in the ICZ absorption band the ICZ fluorescence was quenched in both compounds mainly due to energy transfer to the BODIPY moiety. In a similar ICZ–π–DPP polymer, (where DPP is diketopyrolopyrrole), a smaller red shift of the absorption and fluorescence spectra compared to the parent DPP was observed. A less efficient quenching of the ICZ fluorescence in the ICZ–π–DPP polymer could be related to the unfavorable orientation of the transition dipoles of ICZ and DPP. The rate constant for energy transfer was for all compounds an order of magnitude smaller than predicted by Förster theory. While in a solid film of the triad a further red‐shift of the absorption maximum of nearly 100 nm was observed, no such shift was observed for the ICZ–π–BODIPY polymer. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-16T01:21:28.179988-05:
      DOI: 10.1111/php.12437
  • Electron Spin Exchange in Linked Phenothiazine–Viologen Charge
           Transfer Complexes Incorporated in “Through–Ring”
           (Rotaxane) α–Cyclodextrins
    • Authors: Hiroaki Yonemura; Malcolm D. E. Forbes
      Abstract: A series of covalently bound phenothiazene (PHZ) donor and methylviologen (V) acceptor compounds with polymethylene chain spacers (C8, C10, C12) were incorporated in a “through–ring” (rotaxane) fashion to α–cyclodextrin (α–CD) hosts such that the alkyl chains were fully extended, with the donor and acceptor on opposite sides of the α–CD cylinder. Photoexcitation of the PHZ unit induces electron transfer from the PHZ first excited triplet state to the V moiety, forming a biradicaloid charge separated state. Time‐resolved electron paramagnetic resonance (TREPR) spectroscopy at the X–band and Q–band microwave frequencies was used to investigate the spin exchange interaction, J, in these biradicaloids. Simulation of the spectra using a “static” model for spin–correlated radical pairs allows extraction of the J values, which are negative in sign and have absolute values range from 2 to 1000 Gauss (lower limit). Comparison of the PHZnV (n = 8, 10, 12) spectra to those obtained using phenyl ether spacers indicates that π‐bonds may assist the electronic coupling. The results are discussed in terms of through–bond vs. through–space electronic coupling mechanisms. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-16T01:06:37.821968-05:
      DOI: 10.1111/php.12436
  • Histopathological Analysis of UVB and IR Interaction in Rat Skin
    • Authors: Vinícius C. Gonzalez; Ana C. M. Beheregaray, Bárbara M. Peres, Eliza S. V. Sallis, Antônio S. Varela Junior, Gilma S. Trindade
      Abstract: To determine the chronic skin effects caused by the interaction of infrared and ultraviolet B radiations, male Rattus norvegicus (Wistar) (2 months old) were exposed during 15 days to: infrared radiation (600 ‐ 1500 nm, with peak at 1000 nm, n = 12) for 30 minutes (1,080 J/cm²) (IR); to ultraviolet B radiation (peak emission at 313 nm, n = 9) for 90 minutes (55.08 J/cm²) (UVB); to infrared followed after 90 minutes by ultraviolet B (n = 6) (IRUVB) and to ultraviolet B followed after 90 minutes by infrared radiation (n = 9) (UVBIR). Skin samples were collected and histopathological analysis showed the presence of acanthosis, parakeratotic and orthokeratotic hyperkeratosis, intraepidermal pustules, keratin pearls, detachment of epidermis, collagen necrosis, inflammatory infiltrate, vasodilation, basal cell vacuolization and superficial dermis degeneration both in UVB and UVBIR treatments. IRUVB animals showed the same characteristics as above except for parakeratotic hyperkeratosis, keratin pearls and superficial dermis degeneration. To conclude, infrared radiation exposure after ultraviolet B irradiation increases skin damage without protecting the tissue, while infrared radiation exposure before ultraviolet B irradiation showed a protective effect against ultraviolet skin damage. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-16T01:01:32.123586-05:
      DOI: 10.1111/php.12435
  • Variability of solar radiation and CDOM in surface coastal waters of the
           Northwestern Mediterranean Sea
    • Authors: Richard Sempéré; Julien Para, Marc Tedetti, Bruno Charrière, Marc Mallet
      Abstract: Atmospheric and in‐water solar radiation, including UVR‐B, UVR‐A and PAR, as well as chromophoric dissolved organic matter absorption [aCDOM(λ)] in surface waters were monthly measured from November 2007 to December 2008 at a coastal station in the Northwestern Mediterranean Sea (Bay of Marseilles, France). Our results showed that the UVR‐B/UVR‐A ratio followed the same trend in the atmosphere and at 2 m depth in the water (p < 0.0001) with an increase (8 fold higher) during summer. The low diffuse attenuation coefficients for downward irradiance [Kd(λ)] of UVR‐B, UVR‐A and PAR indicated that the waters were highly transparent throughout the year. The relationships between aCDOM(λ) and Kd(λ) in this oligotrophic system suggested that CDOM contributed to UVR attenuation in the UVA domain, but also played a significant role in PAR attenuation. Mean UV doses received in the mixed layer depth were higher by a factor 1.4‐33 relative to doses received at fixed depths (5 and 10 m) in summer (stratified period), while the inverse pattern was found in winter (mixing period). This shows the importance of taking into account the vertical mixing in the evaluation of UVR effects on marine organisms. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-16T00:42:07.432593-05:
      DOI: 10.1111/php.12434
  • Human Hair as a Natural Sun Protection Agent: A Quantitative Study
    • Authors: María Victoria Gálvez; José Aguilera, Jean‐Luc Bernabó, Cristina Sánchez‐Roldán, Enrique Herrera‐Ceballos
      Abstract: The rising incidence of skin cancers attributable to excessive sun exposure has become a major health concern worldwide. While numerous studies have analyzed the sun protective effect of sunscreens, clothing, and antioxidants, none to date have measured the photoprotective effect of hair, despite clinical evidence that individuals with balding or thinning hair are at greater risk of skin lesions that can progress to cancer, hence the recommendation to use hats or umbrellas. We analyzed the level of protection offered by hair according to hair density, thickness and color using the spectral transmittance and corrected for relative erythema effectiveness. Our results show that hair provides a barrier against both UVB and UVA radiation which is significantly increased with respect to the hair density, thickness and the presence of melanins. This is the first study to quantify sun protection factor offered by hair, namely hair ultraviolet protection factor (HUPF). We believe that hair should be recognized as an important natural sun barrier in the prevention of UV‐induced skin cancers. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-16T00:40:01.133958-05:
      DOI: 10.1111/php.12433
  • Electronic and Vibrational Dynamics of Hollow Au Nanocages Embedded in
           Cu2O Shells
    • Authors: Paul Szymanski; Mahmoud A. Mahmoud, Daniel O'Neil, Batyr Garlyyev, Mostafa A. El‐Sayed
      Abstract: We have synthesized hollow Au nanocages embedded within thick porous shells of cuprous oxide (Cu2O). The shell causes a significant redshift of the localized surface plasmon resonance of Au into the near‐IR. Electron–phonon coupling in the Au nanocage is 3–6 times faster in the core–shell structure due to the higher thermal conductivity of Cu2O compared to water. Coherent phonon oscillations within the Au lattice are characterized by a breathing mode of the entire structure for both bare and core–shell nanocages, an assignment made through the use of structural mechanics simulations. The experimental frequencies are obtained through simulations by selectively applying a force to the shell of the core–shell structure. We interpret this as rapid thermal expansion of the gold leading to a mechanical force that acts on the shell. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-14T02:09:05.398691-05:
      DOI: 10.1111/php.12432
  • Interfacial engineering of CdO‐CdSe 3‐D
           micro‐architectures with in situ photopolymerized PEDOT for an
           enhanced photovoltaic performance
    • Authors: Iseul Lim; Dipak V. Shinde, Supriya A. Patil, Do Young Ahn, Wonjoo Lee, Nabeen K. Shrestha, Joong Kee Lee, Sung‐Hwan Han
      Abstract: In the present work, porous 3‐D CdO microstructured electrode obtained by pyrolysis of 3‐D CdCO3 microstructures is self‐sensitized with CdSe using an ion exchange reaction. After sensitization, an interfacial treatment of the CdO‐CdSe interface is performed by depositing a thin film of PEDOT using a photo‐induce polymerization route. The microstructured electrode before and after interfacial treatment is characterized using filed emission scanning microscope, energy dispersive X‐ray analyzer, contact angle measurement, UV‐Visible absorption spectrophotometer, and X‐ray photoelectron spectrometer. After constructing a liquid junction solar cell with a Pt counter electrode, the photovoltaic performance and interfacial charge transfer kinetics across the CdO‐CdSe interface before and after PEDOT treatment are investigated. The results exhibit an improved interfacial charge transfer resistance after the PEDOT treatment, which leads to enhance the short circuit current by 15.81 % and the power conversion efficiency by 19.82 %. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-09T02:44:31.089599-05:
      DOI: 10.1111/php.12429
  • Luciferin Regenerating Enzyme mediates firefly luciferase activation
           through direct effects of D‐cysteine on luciferase structure and
    • Authors: Roohullah Hemmati; Saman Hosseinkhani, Reza H. Sajedi, Taha Azad, Amin Tashakor, Nuredin Bakhtiari, Farangis Ataei
      Abstract: Luciferin regenerating enzyme (LRE) contributes to in vitro recycling of D‐luciferin. In this paper, reinvestigation of the luciferase‐ based LRE assay is reported. Here, using quick change site‐directed mutagenesis seven T‐LRE (Lampyris turkestanicus LRE) mutants were constructed and the most functional mutant of T‐LRE (T69R) was selected for this research and the effects of D‐ and L‐cysteine on T69R T‐LRE‐luciferase coupled assay are examined. Our results demonstrate that bioluminescent signal of T69R T‐LRE‐luciferase coupled assay increases and then reach equilibrium state in the presence of 5 mM D‐cysteine. In addition, results reveal that 5 mM D‐ and L‐cysteine in the absence of T69R T‐LRE cause a significant increase in bioluminescence intensity of luciferase over a long time as well as decrease in decay rate. Based on activity measurements, far‐UV CD analysis, ANS fluorescence and DLS (Dynamic light scattering) results, D‐cysteine increases the activity of luciferase due to weak redox potential, anti‐aggregatory effects, induction of changes in conformational structure and kinetics properties. In conclusion, in spite of previous reports on the effect of LRE on luciferase bioluminescent intensity, the majority of increase in luciferase light output and time‐course originate from the direct effects of D‐cysteine on structure and activity of firefly luciferase. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-09T02:44:15.11599-05:0
      DOI: 10.1111/php.12430
  • Photocatalytic Activity of LaSr2AlO5:Eu Ceramic Powders
    • Authors: C. R. García; J. Oliva, LA Díaz‐Torres
      Abstract: The photocatalytic activity, of undoped and Europium doped LaSr2AlO5 powders, has been investigated by degrading methylene blue dye in water solutions. Those powders were fabricated by a combustion method and an annealing treatment in air. All samples showed a tetragonal single phase according to by X‐ray diffraction measurements (XRD). Scanning electron microscopy (SEM) revealed irregular semi‐oval grains with sizes in the range of 3.5‐4.27 μm. Photoluminescence spectrum showed sharp emission peaks at 588 nm and at 617 nm which are associated to 7F1,7F2→ 5D0 Eu3+ ion forbidden transitions respectively, under UV light excitation of 322 nm. The methylene blue (MB) degradation under UV light (254 nm) was studied by monitoring changes in the absorbance peak of MB at 665 nm. Finally, LaSr2AlO5:Eu powders were used three times and the the efficiency for the degradation of MB decreased from 100% to 61% after the third cycle of use. This article is protected by copyright. All rights reserved.
      PubDate: 2015-02-03T11:03:42.166718-05:
      DOI: 10.1111/php.12428
  • Salvianolic acid B protects normal human dermal fibroblasts against
           ultraviolet B irradiation‐induced photoaging through
           Mitogen‐activated protein kinase and activator protein‐1
    • Authors: Zhengwang Sun; Sang‐Yong Park, Eunson Hwang, Mengyang Zhang, Fengxie Jin, Baochun Zhang, Tae‐Hoo Yi
      Abstract: Exposure to ultraviolet (UV) light causes increased matrix metalloproteinase (MMP) activity and decreased collagen synthesis, leading to skin photoaging. Salvianolic acid B (SAB), a polyphenol, was extracted and purified from salvia miltiorrhiza. We assessed effects of SAB on UVB‐induced photoaging and investigated its molecular mechanism of action in UVB‐irradiated normal human dermal fibroblasts. Our results show that SAB significantly inhibited the UVB‐induced expression of metalloproteinases‐1 (MMP‐1) and interleukin‐6 (IL‐6) while promoting the production of type I procollagen and transforming growth factor β1 (TGF‐β1). Moreover, treatment with SAB in the range of 1–100 μg/mL significantly inhibited UVB‐induced extracellular signal‐regulated kinase (ERK), Jun N‐terminal kinase (JNK), and p38 phosphorylation, which resulted in decreasing UVB‐induced phosphorylation of c‐Fos and c‐Jun. These results indicate that SAB down‐regulates UV‐induced MMP‐1 expression by inhibiting Mitogen‐activated protein kinase (MAPK) signaling pathways and activator protein‐1 (AP‐1) activation. Our results suggest a potential use for SAB in skin photoprotection. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-28T00:23:26.530561-05:
      DOI: 10.1111/php.12427
  • Survey of UV Emissions from Sunbeds in the UK
    • Authors: Marina Khazova; John B O'Hagan, Stewart Robertson
      Abstract: Increased use of indoor tanning for cosmetic purposes has led to concerns for its impact on the risk of cutaneous cancers. The effects on UVR on skin depend on radiant dose, i.e. combination of irradiance and exposure duration. While a number of studies surveyed accessible emission from sunbeds, majority didn't include the information on doses received during tanning sessions. Spectral irradiance of 195 sunbeds in 5 areas of the UK was measured in order to assess the radiant doses for comparison with the SED. Erythema weighted irradiance of more than 85% of all tested solaria exceeded 0.3 W m−2, consistent with the findings of other studies. However, evaluation of radiant doses showed no evidence of increasing exposure per session in the UK in the last decade despite of the increasing sunbed emission levels. Use of sunbeds for cosmetic purposes should be discouraged, with effective enforcement of the ban on under‐18 use, strict control on tanning duration and promotion of information on health risks of sunbed use. Such an integrated approach on safe equipment, safe use and information should reduce the risk of detrimental impact of sunbed use on public health. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-28T00:04:12.60787-05:0
      DOI: 10.1111/php.12425
  • Decontamination efficiency of a DBD lamp containing an UV–C emitting
    • Authors: Bruno Caillier; José Maurício Almeida Caiut, Cristina Muja, Julien Demoucron, Robert Mauricot, Jeanette Dexpert‐Ghys, Philippe Guillot
      Abstract: Among different physical and chemical agents, the UV radiation appears to be an important route for inactivation of resistant microorganisms. The present study introduces a new mercury free Dielectric Barrier Discharge (DBD) flat lamp, where the biocide action comes from the UV emission produced by rare earth phosphor obtained by spray pyrolysis, following plasma excitation. In this study, the emission intensity of the prototype lamp is tuned by controlling gas pressure and electrical power, 500 mbar and 15 W, corresponding to optimal conditions. In order to characterize the prototype lamp, the energetic output, temperature increase following lamp ignition and ozone production of the source were measured. The bactericidal experiments carried out showed excellent results for several gram‐positive and gram‐negative bacterial strains, thus demonstrating the high decontamination efficiency of the DBD flat lamp. Finally, the study of the external morphology of the microorganisms after the exposure to the UV emission suggested that other mechanisms than the bacterial DNA damage could be involved in the inactivation process. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-28T00:01:22.631715-05:
      DOI: 10.1111/php.12426
  • Hiporfin Mediated Photodynamic Therapy in Preclinical Treatment of
    • Authors: Mengxiong Sun; Chenghao Zhou, Hui Zeng, Nahum Puebla‐Osorio, Elisabetta Damiani, Jian Chen, Hongsheng Wang, Guodong Li, Fei Yin, Liancheng Shan, Dongqing Zuo, Yuxin Liao, Zhuoying Wang, Longpo Zheng, Yingqi Hua, Zhengdong Cai
      Abstract: This study was carried out to investigate the anti‐tumor effect and mechanism of hiporfin‐mediated photodynamic therapy (hiporfin‐PDT) in osteosarcoma. We found that hiporfin accumulated mainly in the cytoplasm of osteosarcoma cells in a time and concentration dependent manner. Hiporfin‐PDT inhibited the proliferation, induced apoptosis and produced cell cycle arrest at G2M in osteosarcoma cell lines. Hiporfin‐PDT increased the expression of cleaved‐caspase‐3, cleaved PARP‐1, Bax and RIP1 while it decreased the expression of Bcl‐2; in addition, low concentration of hiporfin increased LC3 conversion. Furthermore, cell death caused by hiporfin‐PDT could be rescued by Nec‐1 but not by Z‐VAD‐FMK. Production of reactive oxygen species was increased after hiporfin‐PDT. In vivo studies showed a significant decrease in tumor volume and weight after hiporfin‐PDT in all three tumor mouse models investigated (subcutaneous and orthotopic). Histological analysis showed widespread cell apoptosis and necrosis after treatment. Immunohistochemisty also showed up‐regulation of cleaved‐caspase‐3 and down‐regulation of Bcl‐2 after hiporfin‐PDT. These results indicate that hiporfin‐PDT exhibits a killing effect in osteosarcoma both in vitro and in vivo, which is associated with apoptosis and necroptosis, while autophagy plays a protective role. All these findings shed light on a potential future clinical use for hiporfin in the treatment of osteosarcoma. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-25T06:51:15.133704-05:
      DOI: 10.1111/php.12424
  • NSET optical ruler for measuring a human telomere structure
    • Authors: Rachel E. Armstrong; Ryan A. Riskowski, Geoffrey F. Strouse
      Abstract: Nanometal surface energy transfer (NSET) techniques on gold nanoparticles (AuNPs) have become an essential tool in molecular biophysics to identify structural details at long‐range donor‐acceptor distances. The NSET mechanism is well described, but it has been suggested that the use of large AuNPs in NSET may manipulate natural biomolecular function. If, in fact, such non‐specific interactions with the AuNP surface can be quantified or contained, then NSET may offer more potential in tracking biomolecular folding than the most comprehensive methods in conformer determination (X‐ray crystallography, NMR, EPR). Here we describe an NSET ruler capable of tracking Hybrid‐2 telomere quadruplex folding and we demonstrate that nucleic acid appendage to AuNPs up to 10nm in diameter does not manipulate biomolecular function. The quadruplex folding of Hybrid‐2 sequences was tracked by monitoring the emission of a DY680 dye on selected basepairs in the telomere sequence when appended to the surface of AuNPs (5‐10nm). Emission‐derived distances extracted from NSET theory correlate well to reported NMR structures of the antiparallel quadruplex. Moreover, NSET theory calculates identical donor‐acceptor distal points between DY680 and all sizes of AuNPs, indicating that the AuNP tether is not dominant or disruptive towards nucleic acid folding. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-22T08:22:51.660953-05:
      DOI: 10.1111/php.12423
  • Solar Spectral Irradiance and Summary Outputs Using Excel
    • Authors: Brian Diffey
      Abstract: The development of an Excel spreadsheet is described that calculates solar spectral irradiance between 290‐3000 nm on an unshaded, horizontal surface under a cloudless sky at sea level, together with summary outputs such as global UV index, illuminance, and percentage of energy in different wavebands. A deliberate goal of the project was to adopt the principle of Ockham's razor and to develop a model that is as simple as it can be commensurate with delivering results of adequate accuracy. Consequently, just 4 inputs are required ‐ geographical latitude, month, day of month and time of day ‐ resulting in a spreadsheet that is easily usable by anyone with an interest in sunlight and solar power irrespective of their background. The accuracy of the calculated data is sufficient for many applications where knowledge of the ultraviolet, visible and infrared levels in sunlight is of interest. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-21T09:27:01.051289-05:
      DOI: 10.1111/php.12422
  • Formulation of Aluminum Chloride Phthalocyanine in Pluronic™
           P‐123 and F‐127 Block Copolymer Micelles: Photophysical
           properties and Photodynamic Inactivation of Microorganisms
    • Authors: Bruno Henrique Vilsinski; Adriana Passarella Gerola, Junior Adalberto Enumo, Katieli Souza Campanholi, Paulo Cesar de Souza Pereira, Gustavo Braga, Noboru Hioka, Elza Kimura, André Luiz Tessaro, Wilker Caetano
      Abstract: Aluminum Chloride Phthalocyanine (AlPcCl) can be used as a photosensitizer (PS) for Photodynamic Inactivation of Microorganisms (PDI). The AlPcCl showed favorable characteristics for PDI due to high quantum yield of singlet oxygen (ΦΔ) and photostability. Physicochemical properties and photodynamic inactivation of AlPcCl incorporated in polymeric micelles of tri‐block copolymer (P‐123 and F‐127) against microorganisms Staphylococcus aureus, Escherichia coli and Candida albicans were investigated in this work. Previously, it was observed that the AlPcCl undergoes self‐aggregation in F‐127, while in P‐123 the PS is in a monomeric form suitable for PDI. Due to the self‐aggregation of AlPcCl in F‐127, this formulation did not show any effect on these microorganisms. On the other hand, AlPcCl formulated in P‐123 was effective against S. aureus and C. albicans and the death of microorganisms was dependent on the PS concentration and illumination time. Additionally, it was found that the values ​​of PS concentration and illumination time to eradicate 90% of the initial population of microorganisms (IC90 and D90, respectively) were small for the AlPcCl in P‐123, showing the effectiveness of this formulation for PDI. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-20T05:14:42.495404-05:
      DOI: 10.1111/php.12421
  • One‐Pot Synthesis of Cu2O/ZnO Nanoparticles at present of folic acid
           to improve UV‐Protective Effect of Cotton fabrics
    • Authors: S. Abbas Noorian; Nahid Hemmatinejad, Azadeh Bashari
      Abstract: In this study, the effect of using folic acid on the in situ synthesis process of nanostructures has been investigated. Folic acid, as a bio‐template for synthesis of Cu2O/ZnO, was used to improve the reducing and stabilizing the ability of cotton fabric and avoid agglomeration of the particles. SEM images revealed that using folic acid caused the formation of particles with smaller sizes on the cotton fabric and X‐ray diffraction confirmed the same crystalline pattern of nanoparticles in comparison with the previous synthesis process. The effect of using this bio‐template on different properties of treated fabrics including UV‐protection effect, hydrophilicity, crease recovery angle, softness, thickness and mechanical properties has been evaluated. The folic acid had a great influence on UV‐protection effect, in synthesis procedure, decreasing the droplet absorption time, bending length and improving the wrinkle resistance and mechanical properties. Interestingly, the higher tensile strength of the treated cotton fabrics proved the incorporation of nanoparticles into the cotton fibers. An in situ, green and rapid method can be provided by using folic acid for the synthesis of the nanostructures with controlled size. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-12T05:32:46.994047-05:
      DOI: 10.1111/php.12420
  • Evaluation of Photoprotective Potential and Percutaneous Penetration by
           Photoacoustic Spectroscopy of the Schinus terebinthifolius Raddi Extract
    • Authors: Milena K. Bulla; Luzmarina Hernandes, Mauro L. Baesso, Ana C. Nogueira, Antonio C. Bento, Bruno B. Bortoluzzi, Lara Z. Serra, Diogenes A. G. Cortez
      Abstract: Schinus terebinthifolius is a plant rich in phenolic compounds, have antioxidant properties and can provide new opportunities for treatment and prevention of diseases mediated by ultraviolet radiation like photoaging and skin cancer. The aim of the present study was to evaluate the photoprotective potential and ex vivo percutaneous penetration of the crude extract of Schinus terebinthifolius leaves. The extract was tested for antioxidant activity using the 2,2‐diphenyl‐1‐picrylhydrazyl (DPPH) method and β‐carotene bleaching test. The sun protection factor was also evaluated. The ex vivo skin permeation of the emulsion and gel formulations were assayed. Fractionation of the extract resulted in gallic acid, ethyl gallate and a mixture of flavonoids, suggesting derivatives of quercetin and myricetin. The phenolic content of the extract was 384.64±2.60 mg GAE/g extract. The antioxidant activity was superior to butylated hydroxytoluene, in DPPH method, and ascorbic acid and rutin, in β‐carotene bleaching assay. The extract showed UV absorption with photoprotector potential in the UVB region. The photoacoustic spectroscopy measurements confirmed absorption in the UV region and topical application of the formulations caused no histological changes in the rats skin. These results suggest that the crude extract of Schinus terebinthifolius leaves may be a promising natural sunscreen product. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-12T03:43:19.658377-05:
      DOI: 10.1111/php.12419
  • Light Treatment Improves Sleep Quality and Negative Affectiveness in High
           Arctic Residents During Winter
    • Authors: Michel A. Paul; Ryan J. Love, Andrea Hawton, Kaighley Brett, Donald R. McCreary, Josephine Arendt
      Abstract: The seasonal extremes of photoperiod in the high Arctic place particular strain on the human circadian system, which leads to trouble sleeping and increased feelings of negative affect in the winter months. To qualify for our study, potential participants had to have been at Canadian Forces Station (CFS) Alert (82° 30’ 00” N) for at least two weeks. Subjects filled out questionnaires regarding sleep difficulty, psychological well‐being and mood, and wore Actigraphs to obtain objective sleep data. Saliva was collected at regular intervals on two occasions, two weeks apart, to measure melatonin and assess melatonin onset. Individuals with a melatonin rhythm that was in disaccord with their sleep schedule were given individualized daily light treatment interventions based on their pre‐treatment salivary melatonin profile. The light treatment prescribed to seven of the twelve subjects was effective at improving sleep quality both subjectively, based on questionnaire results, and objectively, based on the actigraphic data. The treatment also caused a significant reduction of negative affect among the participants. Since the treatment is non‐invasive and has minimal associated side‐effects, our results support the use of the light visors at CFS Alert and other northern outposts during the winter for individuals that are experiencing sleep difficulty or low mood. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-09T11:19:55.780233-05:
      DOI: 10.1111/php.12418
  • Excited‐State Multiple Proton Transfer Depending on the Acidity and
           Basicity of Mediating Alcohols in 7–Azaindole–(ROH)2 (R = H,
           CH3) Complexes: A Theoretical Study
    • Authors: Hua Fang; Binh Khanh Mai, Yongho Kim
      Abstract: Long‐range proton transfer plays an important role in many chemical and biological phenomena. It has recently been reported that the rate of excited–state multiple proton transfer depends on the acidity and basicity of mediating alcohols in the H–bonded wire. The excited–state triple proton transfer in 7–azaindole complexes through cyclic H–bonded wires was theoretically studied to investigate rates depending on the mediating alcohols. This study showed that the acidity and basicity of alcohols collectively functioned to assist proton transfers depending on the paths; the proton transfers of protolytic and solvolytic paths were assisted by the pull–behind effect and the push–ahead effect, respectively. Both proton–donating and accepting abilities of alcohols in the H–bonded wire can accumulate to help proton transfer, and the strong acidity and basicity of the alcohols with relatively small structural changes in the wire have larger impacts on reducing the activation energies than those of alcohols that trigger proton transfer. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-07T00:51:44.994557-05:
      DOI: 10.1111/php.12417
  • Interphotoreceptor Retinoid‐Binding Protein Protects Retinoids from
    • Authors: Federico Gonzalez‐Fernandez; Brandi Betts‐Obregon, Brian Yust, Joshua Mimun, Dongjin Sung, Dhiraj Sardar, Andrew T. Tsin
      Abstract: Retinol degrades rapidly in light into a variety of photoproducts. It is remarkable that visual cycle retinoids can evade photodegradation as they are exchanged between the photoreceptors, retinal pigment epithelium and Müller glia. Within the interphotoreceptor matrix, all‐trans retinol, 11‐cis retinol and retinal are bound by interphotoreceptor retinoid‐binding protein (IRBP). Apart from its role in retinoid trafficking and targeting, could IRBP have a photoprotective function? HPLC was used to evaluate the ability of IRBP to protect all‐trans and 11‐cis retinols from photodegradation when exposed to incandescent light (0 to 8,842 μW/cm2); time periods of 0 – 60 min, and bIRBP: retinol molar ratios of 1:1 to 1:5. bIRBP afforded a significant prevention of both all‐trans and 11‐cis retinol to rapid photodegradation. The effect was significant over the entire light intensity range tested, and extended to the bIRBP: retinol ratio 1:5. In view of the continual exposure of the retina to light, and the high oxidative stress in the outer retina, our results suggest IRBP may have an important protective role in the visual cycle by reducing photodegradation of all‐trans and 11‐cis retinols. This role of IRBP is particularly relevant in the high flux conditions of the cone visual cycle. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-06T09:46:23.738057-05:
      DOI: 10.1111/php.12416
  • Low level light therapy modulates inflammatory mediators secreted by human
           annulus fibrosus cells during intervertebral disc degeneration in vitro
    • Authors: Min Ho Hwang; Jae Hee Shin, Kyoung Soo Kim, Chang Min Yoo, Ga Eun Jo, Joo Han Kim, Hyuk Choi
      Abstract: Intervertebral disc degeneration (IVD) is one of the important causes of low back pain and is associated with inflammation induced by interaction between macrophages and the human annulus fibrosus (AF) cells. Low‐level light therapy (LLLT) has been widely known to regulate inflammatory reaction. However, the effect of LLLT on macrophage‐mediated inflammation in the AF cells has not been studied till date. The aim of this study is to mimic the inflammatory microenvironment and to investigate the anti‐inflammatory effect of LLLT at a range of wavelengths (405, 532 and 650 nm) on the AF treated with macrophage‐like THP‐1 cells conditioned medium (MCM) containing pro‐inflammatory cytokines and chemokines (interleukin‐1beta, tumor necrosis factor‐alpha, interleukin‐6 and 8). We observed that AF cells exposed to MCM secrete significantly higher concentrations of IL‐6, IL‐8, IL‐1β and TNF‐α. LLLT markedly inhibited secretion of IL‐6 at 405nm in a time‐dependent manner. Level of IL‐8 was significantly decreased at all wavelengths in a time‐dependent manner. We showed that MCM can induce the inflammatory microenvironment in AF cells and LLLT selectively suppressed IL‐6 and 8 levels. The results indicate that LLLT is a potential method of IVD treatment and provide insights for further investigation of its anti‐inflammation effect on IVD. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-02T00:51:21.094444-05:
      DOI: 10.1111/php.12415
  • Influence of Trans Fat on Skin Damage in First Generation Rats Exposed to
           UV Radiation
    • Authors: Raquel Cristine S. Barcelos; Luciana T. Vey, HecsonJesser Segat, Dalila M. Benvegnú, Fabíola Trevizol, Karine Roversi, Katiane Roversi, Verônica T Dias, Geisa S. Dolci, Fábio T Kuhn, Jaqueline Piccolo, Juliana Cristina Veit, Tatiana Emanuelli, Marilise E. Bürger
      Abstract: The influence of transfatty acids (TFA) on lipid profile, oxidative damage and mitochondrial function in the skin of rats exposed to ultraviolet radiation (UVR) was assessed. The first generation offspring of female Wistar rats supplemented from pregnancy with either soybean oil (C‐SO, rich in n‐6 FA; control group) or hydrogenated vegetable fat (HVF, rich in TFA) were continued with the same supplements until adulthood, when half of each group was exposed to UVR for 12 weeks. The HVF group showed higher TFA cutaneous incorporation, increased protein carbonyl (PC) levels, decreased functionality of mitochondrial enzymes and antioxidant defenses of the skin. After UVR, the HVF group showed increased skin thickness and reactive species (RS) generation, with decreased skin antioxidant defenses. RS generation was positively correlated with skin thickness, wrinkles and PC levels. Once incorporated to skin, TFA make it more susceptible to developing UVR‐induced disorders. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-02T00:46:29.220422-05:
      DOI: 10.1111/php.12414
  • Measurement of photosynthesis using PAM technology in a purple sulphur
           bacterium Thermochromatium tepidum (Chromatiaceae)
    • Authors: Raymond J. Ritchie; Nutsara Mekjinda
      Abstract: We demonstrate that Blue‐diode‐based PAM (Pulse Amplitude Modulation) technology can be used to measure the photosynthetic electron transport rate (ETR) of purple sulphur bacteria (Thermochromatium tepidum, Chromatiaceae). Previous studies showed that PAM technology could be used to estimate photosynthesis in purple non‐sulphur bacteria and so PAM technology can be used to estimate photosynthesis of both kinds of purple photosynthetic bacteria. The absorptance of Thermochromatium films on glass fibre discs was measured and used to calculate actual ETR. ETR vs. Irradiance (P vs. E) curves fitted the waiting‐in‐line model (ETR = (ETRmax×E/Eopt) × exp (1‐E/Eopt)). Yield (Y) was only ≈ 0.3 to 0.4. Thermochromatium saturates at 325 ± 13.8 μmol photons m−2 s−1 or ≈ 15% sunlight and shows photoinhibition at high irradiances. A pond of Thermochromatium would exhibit classic surface inhibition. Photosynthesis is extremely low in the absence of an electron source: ETR increases in the presence of acetate (5 mol m−3) provided as an organic carbon source and also increases in the presence of sulphite (3 mol m−3) but not sulphide and is only marginally increased by the presence of Fe2+. Non‐photochemical quenching does occur in Thermochromatium but at very low levels compared to oxygenic photoorganisms or Rhodopseudomonads. This article is protected by copyright. All rights reserved.
      PubDate: 2015-01-02T00:35:52.056575-05:
      DOI: 10.1111/php.12413
  • Editorial
    • Authors: Jean Cadet
      Pages: 253 - 253
      PubDate: 2015-03-06T00:59:54.586292-05:
      DOI: 10.1111/php.12431
  • A Tribute to the Extraordinary Career (1964‐present) of James Edward
    • Authors: David Mitchell
      Pages: 450 - 451
      PubDate: 2015-03-06T00:59:59.603726-05:
      DOI: 10.1111/php.12376
  • A bright Quantum of Time in the Cleaver Laboratory; a Tribute and
    • Authors: William K. Kaufmann
      Pages: 501 - 504
      PubDate: 2015-03-06T00:59:54.686996-05:
      DOI: 10.1111/php.12384
  • Opening Enediyne Scissors Wider: pH‐Dependent DNA Photocleavage by
           meta‐Diyne Lysine Conjugates
    • Authors: Kemal Kaya; Madeleine Johnson, Igor V. Alabugin
      Abstract: Photochemical activation of meta‐diynes incapable of Bergman and C1‐C5 cyclizations still leads to efficient double‐strand DNA cleavage. Spatial proximity of the two arylethynyl groups is not required for efficient DNA‐photocleavage by the enediyne‐lysine conjugates. Efficiency of the cleavage is a function of the external pH ‐ DNA damage is strongly enhanced at pH
      PubDate: 2014-12-24T09:14:25.058753-05:
      DOI: 10.1111/php.12412
  • Intramolecular proton transfer in
           evidence for tautomer in the ground state
    • Authors: Francis A. S. Chipem; Ashim Malakar, G. Krishnamoorthy
      Abstract: The intramolecular proton transfer in a newly synthesized molecule, 2‐(2’‐hydroxyphenyl)oxazolo[4,5‐b]pyridine (HPOP) is studied using UV‐visible absorption, fluorescence emission, fluorescence excitation and time‐resolved fluorescence spectroscopy. In the ground state the molecule exists as cis‐ and trans‐ enol in all the solvents. However, in dioxane, alcohols, acetonitrile, dimethylformaide and dimethylsulfoxide the keto tautomer is also observed in the ground state. Dual fluorescence is observed in HPOP where the large Stoke shifted emission is due to emission from the excited state intramolecular proton transfer product while the other emission is the normal emission from enol form. The fluorescence (both normal and tautomer emission) of HPOP is less than those of corresponding benzoxazole and imidazopyridine derivatives. This reveals that the nonradiative decay becomes more efficient upon substitution of electronegative atom on the charge acceptor. The pH studies substantiate the conclusion that (unlike in its imidazole analogue) the third ground state species is the keto tautomer and not the monoanion. The effect of temperature on cis‐enol‐trans‐enol‐keto equilibrium and the nonradiative deactivation from the excited state are also investigated. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-23T09:36:32.923147-05:
      DOI: 10.1111/php.12411
  • Growth Under Visible Light Increases Conidia and Mucilage Production and
           Tolerance to UV‐B Radiation in the Plant‐Pathogenic Fungus
           Colletotrichum acutatum
    • Authors: Henrique D. Menezes; Nelson S. Massola Júnior, Stephan D. Flint, Geraldo J. da Silva, Luciano Bachmann, Drauzio E. N. Rangel, Gilberto U. L. Braga
      Abstract: Light conditions can influence fungal development. Some spectral wavebands can induce conidial production, while others can kill the conidia reducing the population size and limiting dispersal. The plant‐pathogenic fungus Colletotrichum acutatum causes anthracnose in several crops. During the asexual stage on the host plant, Colletototrichum produces acervuli with abundant mucilage‐embedded conidia. These conidia are responsible for fungal dispersal and host infection. This study examined the effect of visible light during C. acutatum growth on the production of conidia and mucilage and also on the UV tolerance of these conidia. Conidial tolerance to an environmentally realistic UV irradiance was determined both in conidia surrounded by mucilage on sporulating colonies and in conidial suspension. Exposures to visible light during fungal growth increased production of conidia and mucilage as well as conidial tolerance to UV. Colonies exposed to light produced 1.7 times more conidia than colonies grown in continuous darkness. The UV tolerances of conidia produced under light were at least 2 times higher than conidia produced in the dark. Conidia embedded in the mucilage on sporulating colonies were more tolerant of UV than conidia in suspension that were washed free of mucilage. Conidial tolerance to UV radiation varied among 5 selected isolates. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-23T08:10:54.924429-05:
      DOI: 10.1111/php.12410
  • Spectroscopic Properties of Morin in Various CH3OH‐H2O and
           CH3CN‐H2O Mixed Solvents
    • Authors: Hyoung‐Ryun Park; Seo‐Eun Im, Jung‐Ja Seo, Bong‐Gon Kim, Jin Ah Yoon, Ki‐Min Bark
      Abstract: The specific fluorescence properties of morin (3,2’,4’,5,7‐pentahydroxyflavone) were studied in various CH3OH‐H2O and CH3CN‐H2O mixed solvents. Although the dihedral angle is large in the S0 state, morin has an almost planar molecular structure in the S1 state owing to the very low rotational energy barrier around the interring bond between B and the A, C ring. The excited state intramolecular proton transfer (ESIPT) at the S1 state cannot occur immediately after excitation, S1 → S0 fluorescence can be observed. Two conformers, Morin A and B have been known. At the CH3OH‐H2O, Morin B will be the principal species but at the CH3CN‐H2O, Morin A is the principal species. At the CH3OH‐H2O, owing to the large Franck‐Condon (FC) factor for S2 → S1 internal convernal (IC) and flexible molecular structure, only S1 → S0 fluorescence was exhibited. At the CH3CN‐H2O, since the FC factor for S2 → S1 IC is small and molecular structure is rigid, S2 → S0 and S1 → S0 dual fluorescence was observed. This abnormal fluorescence property was further orted by the small pK1 value, effective delocalization of the lone pair electrons of C(2’)‐OH to the A, C ring, and a theoretical calculation. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-22T09:52:35.787472-05:
      DOI: 10.1111/php.12407
  • Molecular Regulation of UV‐Induced DNA Repair
    • Authors: Palak Shah; Yu‐Ying He
      Abstract: Ultraviolet (UV) radiation from sunlight is a major etiologic factor for skin cancer, the most prevalent cancer in the U.S., as well as premature skin aging. In particular, UVB radiation causes formation of specific DNA damage photoproducts between pyrimidine bases. These DNA damage photoproducts are repaired by a process called nucleotide excision repair, also known as UV‐induced DNA repair. When left unrepaired, UVB‐induced DNA damage leads to accumulation of mutations, predisposing people to carcinogenesis as well as to premature aging. Genetic loss of nucleotide excision repair leads to severe disorders, namely, xeroderma pigmentosum (XP), trichothiodystrophy (TTD) and Cockayne syndrome (CS), which are associated with predisposition to skin carcinogenesis at a young age as well as developmental and neurological conditions. Regulation of nucleotide excision repair is an attractive avenue to preventing or reversing these detrimental consequences of impaired nucleotide excision repair. Here we review recent studies on molecular mechanisms regulating nucleotide excision repair by extracellular cues and intracellular signaling pathways, with a special focus on the molecular regulation of individual repair factors. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-22T09:49:07.037572-05:
      DOI: 10.1111/php.12406
  • Synthesis of Bi2WO6/Bi2O3 composite with enhanced photocatalytic activity
           by a facile one‐step hydrothermal synthesis route
    • Authors: Tianye Wang; Fengjun Zhang, Guosheng Xiao, Shuang Zhong, Cong Lu
      Abstract: In this study, the characterization and photocatalytic activity of Bi2WO6/Bi2O3 under visible‐light irradiation was investigated in detail. The results suggested that Bi2WO6/Bi2O3 can be synthesized by a facile one‐pot hydrothermal route using a super big 200 mL Teflon‐lined autoclave with optimal sodium oleate/Bi molar ratio of 1.25. Through the characterization of Bi2WO6/Bi2O3 by X‐ray diffraction, scanning electron microscopy, X‐ray photoelectron spectroscopy, Fourier transform infrared, UV‐vis diffuse reflectance spectra and Photoluminescence spectra, it was found that the as‐prepared composite possessed smaller crystallite size and higher visible‐light responsive than the pure Bi2WO6. Moreover, it was expected that the as‐prepared composites exhibited enhanced photocatalytic activity for the degradation of Rhodamine B under visible‐light irradiation, which could be ascribed to their improved light absorption property and the reduced recombination of the photo‐generated electrons and holes during the photocatalytic reaction. In general, this study could provide a principle method to synthesize Bi2WO6/Bi2O3 with enhanced photocatalytic activity by one‐step hydrothermal synthesis route for environmental purification. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-22T02:05:28.087823-05:
      DOI: 10.1111/php.12409
  • Interaction of crown ether-annelated styryl dyes with double-stranded DNA
    • Authors: Daria V. Berdnikova; Olga A. Fedorova, Elena V. Tulyakova, Haixing Li, Sarah Kölsch, Heiko Ihmels
      Abstract: DNA-binding properties of 15-crown-5-derived mono- and bis-styryl dyes were investigated in the presence of calf thymus DNA. To access the factors that influence the DNA association in the series of these ligands, the structure of the molecules was varied by either changing size of the heterocyclic moiety or altering the position of the styryl substituents. The major binding mode for the monostyryl dyes is intercalation. Notably, binding of the dyes to the nucleic acids leads to a fluorescence enhancement by a factor of up to 54. Therefore, these cationic styryl derivatives may be applied as fluorescent ‘light-up’ probes for DNA detection. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-18T16:17:55.43795-05:0
      DOI: 10.1111/php.12405
  • Response of growth and photosynthesis of Emiliania huxleyi to visible and
           UV irradiances under different light regimes
    • Authors: Tao Xing; Kunshan Gao, John Beardall
      Abstract: Microalgae are capable of acclimating to changes in light and ultraviolet radiation (UVR, 280‐400nm). However, little is known about how the ecologically important coccolithophore Emiliania huxleyi responds to UVR when acclimated to different light regimes. Here, we grew E.huxleyi under indoor constant light or fluctuating sunlight with or without UVR, and investigated its growth, photosynthetic performance and pigmentation. Under the indoor constant light regime, the specific growth rate (μ) was highest, while fluctuating outdoor solar radiation significantly decreased the growth rate. Addition of UVR further decreased the growth rate. The repair rate of photosystem II (PSII), as reflected in changes in PSII quantum yield, showed an inverse correlation with growth rate. Cells grown under the indoor constant light regime exhibited the lowest repair rate, while cells from the outdoor fluctuating light regimes significantly increased their repair rate. Addition of UVR increased both the repair rate and intracellular UV‐absorbing compounds. This increased repair capability, at the cost of decreased growth rate, persisted after the cells were transferred back to the indoor again, suggesting an enhanced allocation of energy and resources for repair of photosynthetic machinery damage by solar UVR which persisted for a period after transfer from solar UVR. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-16T08:36:07.832602-05:
      DOI: 10.1111/php.12403
  • Unveiling the triplet state of a 4‐
           amino‐7‐Nitrobenzofurazan Derivative in cyclohexane
    • Authors: Christopher Sveen; Nicolas Macia, Vanina Zaremberg, Belinda Heyne
      Abstract: The nitrobenzofurazan (NBD) moiety has gained tremendous popularity over the last decades due to its fluorogenic nature. Indeed, upon interaction with aliphatic amines, it generates a stable fluorescent adduct, which has been used for protein and lipid labeling. In fact the 4‐amino substituted NBD belongs to the broad family of intramolecular charge transfer molecules, with the amino group acting as an electron donor upon photoexcitation, and the nitro group as an electron acceptor. Whereas the singlet excited state of 4‐amino NBD derivatives has been abundantly studied, investigation of its triplet manifold is scarce and even the absence of intersystem crossing for this type of molecules has been suggested. However, intramolecular charge transfer molecules are known to undergo intersystem crossing and high phosphorescence quantum yields have been reported in non‐polar solvent. In the present paper, we have investigated the photophysical and photochemical properties of N‐hexyl‐7‐nitrobenzo[c][1,2,5]xadiazole‐4‐amine. We have shown the existence of a triplet state for this molecule in cyclohexane via nanosecond laser flash photolysis. Interestingly, deactivation of the triplet state leads to photoproducts formation, which are only present in the absence of oxygen. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-16T08:35:52.689273-05:
      DOI: 10.1111/php.12402
  • Thioredoxin Reductase Activity may be More Important than GSH Level in
           Protecting Human Lens Epithelial Cells Against UVA Light
    • Authors: Vanita A. Padgaonkar; Victor R. Leverenz, Aparna V. Bhat, Sara E. Pelliccia, Frank J. Giblin
      Abstract: This study compares the abilities of the glutathione (GSH) and thioredoxin (Trx) antioxidant systems in defending cultured human lens epithelial cells (LECs) against UVA light. Levels of GSH were depleted with either L‐buthionine‐(S,R)‐sulfoximine (BSO) or 1‐chloro‐2,4‐dinitrobenzene (CDNB). CDNB treatment also inhibited the activity of thioredoxin reductase (TrxR). Two levels of O2, 3% and 20%, were employed during a 1 hr exposure of the cells to 25 J/cm2 of UVA radiation (338‐400nm wavelength, peak at 365nm). Inhibition of TrxR activity by CDNB, combined with exposure to UVA light, produced a substantial loss of LECs and cell damage, with the effects being considerably more severe at 20% O2 compared to 3%. In contrast, depletion of GSH by BSO, combined with exposure to UVA light, produced only a slight cell loss, with no apparent morphological effects. Catalase was highly sensitive to UVA‐induced inactivation, but was not essential for protection. Although UVA light presented a challenge for the lens epithelium, it was well‐tolerated under normal conditions. The results demonstrate an important role for TrxR activity in defending the lens epithelium against UVA light, possibly related to the ability of the Trx system to assist DNA synthesis following UVA‐induced cell damage. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-15T05:06:47.287662-05:
      DOI: 10.1111/php.12404
  • Effects of Substituents on Synthetic Analogs of Chlorophylls. Part 4: How
           Formyl Group Location Dictates the Spectral Properties of Chlorophylls b,
           d and f
    • Authors: Jonathan M. Yuen; Michelle A. Harris, Mengran Liu, James R. Diers, Christine Kirmaier, David F. Bocian, Jonathan S. Lindsey, Dewey Holten
      Abstract: Photosynthetic organisms are adapted to light characteristics in their habitat in part via the spectral characteristics of the associated chlorophyll pigments, which differ in the position of a formyl group around chlorin macrocycle (chlorophylls b, d, f) or no formyl group (chlorophyll a). To probe the origin of this spectral tuning, the photophysical and electronic structural properties of a new set of synthetic chlorins are reported. The zinc and free base chlorins have a formyl group at either the 2‐ or 3‐position. The four compounds have fluorescence yields in the range 0.19–0.28 and singlet excited‐state lifetimes of ~4 ns for zinc chelates and ~8 ns for the free base forms. The photophysical properties of the 2‐ and 3‐formyl zinc chlorins are similar to those observed previously for 13‐formyl or 3,13‐diformyl chlorins, but differ markedly from those for 7‐formyl analogs. Molecular‐orbital characteristics obtained from density functional theory calculations were used as input to spectral simulations employing the four‐orbital model. The analysis has uncovered the key changes in electronic structure engendered by the presence/location of a formyl group at various macrocycle positions, which is relevant to understanding the distinct spectral properties of the natural chlorophylls a, b, d, and f. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-09T04:11:59.231456-05:
      DOI: 10.1111/php.12401
  • Nobiletin, a polymethoxy flavonoid, reduced endothelin‐1 plus
           SCF‐induced pigmentation in human melanocytes
    • Authors: Hyo Jung Kim; Takayuki Yonezawa, Toshiaki Teruya, Je‐Tae Woo, Byung‐Yoon Cha
      Abstract: Nobiletin is unique flavonoid having polymethoxy groups and has exhibited anti‐inflammatory and anti‐obesity effects. Here we examined the inhibition of nobiletin on melanogenesis induced by endothelin‐1 (ET) and stem cell factor (SCF) in normal human melanocytes. Nobiletin dose‐dependently reduced ET plus SCF‐stimulated tyrosinase activity without causing cytotoxicity. Nobiletin reduced cAMP‐response element‐binding protein (CREB) phosphorylation and microphthalmia‐associated transcription factor (MITF) expression, which is a key transcription factor for tyrosinase expression in pigmentation induced by ET plus SCF stimulation. Nobiletin treatment effectively decreased ET plus SCF‐induced Raf, MEK, and ERK phosphorylation and also down‐regulated the forskolin‐induced phosphorylation of CREB. Furthermore, nobiletin inhibited ET plus SCF‐triggered production of melanin and expression of MITF/tyrosinase in a three‐dimensional human epidermal model. In accordance with protein expression, the expression of genes related to the pigmentation was also increased in the cells stimulated with ET plus SCF and the co‐treatment with nobiletin decreased obviously the ET plus SCF‐triggered gene expressions of tyrosinase, PMEL, TRP1, and MITF. Nobiletin contributes to hypopigmentation by downregulating MITF and tyrosinase expression through reduced Raf‐1 phosphorylation. Our findings implicate nobiletin as a potential new whitening agent. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-09T04:08:24.798814-05:
      DOI: 10.1111/php.12400
  • Improved Efficiency and Stability of Flexible Dye Sensitized Solar Cells
           on ITO/PEN Substrates Using an Ionic Liquid Electrolyte
    • Authors: Yu Han; Jennifer M. Pringle, Yi‐Bing Cheng
      Abstract: Flexible dye‐sensitized solar cells (DSSCs) built on plastic substrates have attracted great interest as they are lightweight and can be roll‐to‐roll printed to accelerate production and reduce cost. However, plastic substrates such as PEN and PET are permeable to water, oxygen and volatile electrolyte solvents, which is detrimental to the cell stability. Therefore, to address this problem, in this work, an ionic liquid (IL) electrolyte is used to replace the volatile solvent electrolyte. The initial IL‐based devices only achieved around 50% of the photovoltaic conversion efficiency of the cells using the solvent electrolyte. Current‐voltage and electrochemical impedance spectroscopy (EIS) analysis of the cells in the dark indicated that this lower efficiency mainly originated from (i) a lack of blocking layer to reduce recombination, and (ii) a lower charge collection efficiency. To combat these problems, cells were developed using a 12nm thick blocking layer, produced by atomic layer deposition, and 1 μm thick P25 TiO2 film sensitized with the hydrophobic MK‐2 dye. These flexible DSSCs utilizing an IL electrolyte exhibit significantly improved efficiencies and a less than 10% drop in performance after 1000 hours aging at 60ºC under continuous light illumination. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-05T03:21:38.864919-05:
      DOI: 10.1111/php.12399
  • Application of CdTe/ZnSe Quantum Dots in In Vitro Imaging of Chicken
           Tissue and Embryo
    • Authors: Amitava Moulick; Iva Blazkova, Vedran Milosavljevic, Zdenka Fohlerova, Jaromir Hubalek, Pavel Kopel, Marketa Vaculovicova, Vojtech Adam, Rene Kizek
      Abstract: The present work is aimed to synthesize CdTe/ZnSe core/shell quantum dots (QDs) in an easy way and to explore the possibilities of its application in in vitro imaging of chicken tissue and embryo. The QDs were prepared using microwave irradiation with different temperatures, which is a very easy and less time‐consuming method. Subsequently these QDs were characterized by spectrofluorimetry, Transmission Electron Microscopy, X‐ray fluorescence analysis and Dynamic Light Scattering measurement. A blue‐shifting of the emission was found when ZnSe was deposited on CdTe QDs. The QDs showed its fluorescence emission quantum yields up to 25%. They were applied into chicken embryos and breast muscle tissues to study their efficiency in in vitro imaging. All the QDs of different color were able to visualize in in vitro imaging. The highest fluorescence intensity was detected in the case of red QDs prepared at 100 °C. The green and red QDs were possible to detect up to the depth of 3 and 4 mm of the tissue respectively. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-05T03:20:46.607015-05:
      DOI: 10.1111/php.12398
  • Low‐level laser (light) therapy increases mitochondrial membrane
           potential and ATP synthesis in C2C12 myotubes with a peak response at
           3‐6 hours
    • Authors: Cleber Ferraresi; Beatriz Kaippert, Pinar Avci, Ying‐Ying Huang, Marcelo Victor Pires Sousa, Vanderlei Salvador Bagnato, Nivaldo Antonio Parizotto, Michael R Hamblin
      Abstract: Low level laser (light) therapy has been used before exercise to increase muscle performance in both experimental animals and in humans. However uncertainty exists concerning the optimum time to apply the light before exercise. The mechanism of action is thought to be stimulation of mitochondrial respiration in muscles, and to increase adenosine triphosphate (ATP) needed to perform exercise. The goal of this study was to investigate the time course of the increases in mitochondrial membrane potential (MMP) and ATP in myotubes formed from C2C12 mouse muscle cells and exposed to light‐emitting diode therapy (LEDT). LEDT employed a cluster of LEDs with 20 red (630 ± 10 nm, 25 mW) and 20 near‐infrared (850 ± 10 nm, 50 mW) delivering 28 mW/cm2 for 90 sec (2.5 J/cm2) with analysis at 5 min, 3 h, 6 h and 24 h post‐LEDT. LEDT‐6h had the highest MMP, followed by LEDT‐3h, LEDT‐24h, LEDT‐5min and Control with significant differences. The same order (6h>3h>24h>5min>Control) was found for ATP with significant differences. A good correlation was found (r=0.89) between MMP and ATP. These data suggest an optimum time window of 3‐6 h for LEDT stimulate muscle cells. This article is protected by copyright. All rights reserved.
      PubDate: 2014-12-01T02:43:51.632146-05:
      DOI: 10.1111/php.12397
  • Effects of ultraviolet radiation (UVA+UVB) and copper on the morphology,
           ultrastructural organization and physiological responses of the red alga
           Pterocladiella capillacea
    • Authors: Éder C Schmidt; Marianne Kreusch, Marthiellen R. Felix, Debora T. Pereira, Giulia B. Costa, Carmen Simioni, Luciane C. Ouriques, Francine L Farias‐Soares, Neusa Steiner, Fungyi Chow, Fernanda Ramlov, Marcelo Maraschin, Zenilda L. Bouzon
      Abstract: The effect of ultraviolet (UV) radiation and copper (Cu) on apical segments of Pterocladiella capillacea was examined under two different conditions of radiation, PAR (control) and PAR+UVA+UVB (PAR+UVAB), and three copper concentrations, ranging from 0 (control) to 0.62, 1.25 and 2.50 μM. Algae were exposed in vitro to photosynthetically active radiation (PAR) at 70 μmol photons m−2s−1, PAR + UVB at 0.35 W m−2 and PAR +UVA at 0.70 W m−2 during a 12‐hour photocycle for 3 h each day during 7 days. The effects of radiation and copper on growth rates, content of photosynthetic pigments, and photosynthetic performance were analyzed. In addition, samples were processed for light and transmission electron microscopy. The content of photosynthetic pigments decreased after exposure to radiation and Cu. Compared with PAR radiation and copper treatments modified the kinetics patterns of the photosynthesis/irradiance curve. The treatments also caused changes in the ultrastructure of cortical and subcortical cells, including increased cell wall thickness and accumulation of plastoglobuli, as well as changes in the organization of chloroplasts. The results indicate that the synergistic interaction between UV radiation and Cu in P. capillacea, led to the failure of protective mechanisms and causing more drastic changes and cellular imbalances. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-28T09:56:49.239351-05:
      DOI: 10.1111/php.12396
  • Photophysics of Acetophenone Interacting with DNA: Why the Road to
           Photosensitization is Open
    • Authors: Miquel Huix‐Rotllant; Elise Dumont, Nicolas Ferré, Antonio Monari
      Abstract: DNA photosensitization, i.e. the photo‐induced electron‐ or energy‐transfer of chromophores interacting with DNA, is a crucial phenomenon that triggers important DNA lesions such as pyrimidine dimerization, even upon absorption of relatively low‐energy radiation. Oxidative lesions may also be produced via the photo‐induced production of reactive oxygen species. Aromatic ketones, and acetophenone in particular, are well known for their sensitization effects. In this contribution we model the structural and dynamical properties of the acetophenone/DNA aggregates as well as their spectroscopic and photophysical properties using high‐level hybrid quantum mechanics/molecular mechanics methods. We show that the key steps of the photochemistry of acetophenone in gas phase are conserved in the macromolecular environment and thus an ultrafast singlet‐triplet conversion of acetophenone is expected prior to the transfer to DNA. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-21T05:53:52.51435-05:0
      DOI: 10.1111/php.12395
  • Minimum Exposure Limits and Measured Relationships Between the Vitamin D,
           Erythema and International Commission on Non‐Ionizing Radiation
           Protection Solar Ultraviolet
    • Authors: Nathan Downs; Alfio Parisi, Harry Butler, Joanna Turner, Lisa Wainwright
      Abstract: The International Commission on Non‐Ionizing Radiation Protection (ICNIRP) has established guidelines for exposure to ultraviolet radiation in outdoor occupational settings. Spectrally weighted ICNIRP ultraviolet exposures received by the skin or eye in an 8 hr period are limited to 30 Jm−2. In this study, the time required to reach the ICNIRP exposure limit was measured daily in ten minute intervals upon a horizontal plane at a subtropical Australian latitude over a full year and compared with the effective Vitamin D dose received to ¼ of the available skin surface area for all six Fitzpatrick skin types. The comparison of measured solar ultraviolet exposures for the full range of sky conditions in the 2009 measurement period, including a major September continental dust event, show a clear relationship between the weighted ICNIRP and the effective vitamin D dose. Our results show that the horizontal plane ICNIRP ultraviolet exposure may be used under these conditions to provide minimum guidelines for the healthy moderation of vitamin D, scalable to each of the six Fitzpatrick skin types. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-18T22:21:20.843717-05:
      DOI: 10.1111/php.12394
  • Absorption and Emission Sensitivity of
           2‐(2’‐Hydroxyphenyl)benzoxazole to Solvents and
    • Authors: Zhao Yuan; Qing Tang, Kesavapillai Sreenath, J. Tyler Simmons, Ali H. Younes, De‐en Jiang, Lei Zhu
      Abstract: 2‐(2’‐Hydroxyphenyl)benzoxazole (HBO) is known for undergoing intramolecular proton transfer in the excited state to result in the emission of its tautomer. A minor long‐wavelength absorption band in the range of 370‐420 nm has been reported in highly polar solvents such as dimethylsulfoxide (DMSO). Yet the nature of this species has not been entirely clarified. In this work, we provide evidence that this long‐wavelength absorption band might have been caused by base or metal salt impurities that are introduced into the spectral sample during solvent transport using glass Pasteur pipettes. The contamination by base or metal salt could be avoided by using borosilicate glass syringes or non‐glass pipettes in sample handling. Quantum chemical calculations conclude that solvent‐mediated deprotonation is too energetically costly to occur without the aid of a base of an adequate strength. In the presence of such a base, the deprotonation of HBO and its effect on emission are investigated in dichloromethane and DMSO, the latter of which facilitates deprotonation much more readily than the former. Finally, the absorption and emission spectra of HBO in 13 solvents are reported, from which it is concluded that ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-18T04:39:10.999301-05:
      DOI: 10.1111/php.12393
  • Steric and Electronic Factors Associated with the Photoinduced Ligand
           Exchange of Bidentate Ligands Coordinated to Ru(II)
    • Authors: Bryan A. Albani; Tyler Whittemore, Christopher B. Durr, Claudia Turro
      Abstract: In an effort to create a molecule that can absorb low energy visible or near‐infrared light for photochemotherapy (PCT), the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′‐biquinoline, dpb = 2,3‐bis(2‐pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complexes 1 and 2 were compared to [Ru(bpy)2(dpb)](PF6)2 (3, bpy = 2,2′‐bipyridine) and [Ru(biq)2(phen)](PF6)2 (4, phen = 1,10‐phenanthroline). Distortions around the metal and biq ligands were used to explain the exchange of one biq ligand in 4 upon irradiation. Complex 1, however, undergoes photoinduced dissociation of the dpb ligand rather than biq under analogous experimental conditions. Complex 3 is not photoactive, providing evidence that the biq ligands are crucial for ligand photodissociation in 1. The crystal structures of 1 and 4 are compared to explain the difference in photochemistry between the complexes. Complex 2 absorbs lower energy light than 1, but is photochemically inert although its crystal structure displays significant distortions. These results indicate that both the excited state and electronic structure and steric bulk play key roles in bidentate photoinduced ligand dissociation. The present work also shows that it is possible to stabilize sterically hindered Ru(II) complexes by the addition of another metal, a property that may be useful for other applications. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-18T04:31:47.205366-05:
      DOI: 10.1111/php.12392
  • Ultraviolet Index and Location are Important Determinants of Vitamin D
           Status in People with Human Immunodeficiency Virus (HIV)
    • Authors: Karen M Klassen; Christopher K Fairley, Michael G Kimlin, Mark Kelly, Tim RH Read, Jennifer Broom, Darren B Russell, Peter R Ebeling
      Abstract: This study aimed to document the vitamin D status of HIV‐infected individuals across a wide latitude range in one country and to examine associated risk factors for low vitamin D. Using data from patients attending four HIV specialist clinics across a wide latitude range in Australia, we constructed logistic regression models to investigate risk factors associated with 25(OH)D
      PubDate: 2014-11-14T08:11:52.739589-05:
      DOI: 10.1111/php.12390
  • The efficient photocatalytic degradation of methyl tert‐butyl ether
           under Pd/ZnO and visible light irradiation
    • Authors: Zaki S. Seddigi; Saleh A. Ahmed, Ali Bumajdad, Ekram Y. Danish, Ahmed M. Shwaky, Mohammed A. Gondal, Mustafa Soylak
      Abstract: Methyl tert‐butyl ether is a commonly used fuel oxygenate that is present in gasoline. It was introduced to eliminate the use of leaded gasoline and to improve the octane quality because it aids in the complete combustion of fuel by supplying oxygen during the combustion process. Over the past decade, the use of MTBE has increased tremendously worldwide. For obvious reasons relating to accidental spillage, MTBE started to appear as an environmental and human health threat because of its non‐biodegradable nature and carcinogenic potential, respectively. In the present work, MTBE was degraded with the help of an advanced oxidation process through the use of zinc oxide as a photocatalyst in the presence of visible light. A mixture of 200 mg of zinc oxide in 350 ml of 50 ppm MTBE aqueous solution was irradiated with visible light for a given time. The complete degradation of MTBE was recorded, and approximately 99% photocatalytic degradation of 100 ppm MTBE solution was observed. Additionally, the photoactivity of 1% Pd‐doped ZnO was tested under similar conditions to understand the effect of Pd doping on ZnO. Our results obtained under visible light irradiation are very promising, and they could be further explored for the degradation of several non‐degradable environmental pollutants. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-14T08:11:39.724009-05:
      DOI: 10.1111/php.12391
  • Beyond Xeroderma Pigmentosum: DNA Damage and Repair in an Ecological
           Context A Tribute to James E. Cleaver
    • Authors: Deneb Karentz
      Abstract: The ability to repair DNA is a ubiquitous characteristic of life on Earth and all organisms possess similar mechanisms for dealing with DNA damage, an indication of a very early evolutionary origin for repair processes. James E. Cleaver's career (initiated in the early 1960s) has been devoted to the study of mammalian ultraviolet radiation (UVR) photobiology, specifically the molecular genetics of xeroderma pigmentosum and other human diseases caused by defects in DNA damage recognition and repair. This work by Jim and others has influenced the study of DNA damage and repair in a variety of taxa. Today, the field of DNA repair is enhancing our understanding of not only how to treat and prevent human disease, but is providing insights on the evolutionary history of life on Earth and how natural populations are coping with UVR‐induced DNA damage from anthropogenic changes in the environment such as ozone depletion. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-14T01:21:50.44255-05:0
      DOI: 10.1111/php.12388
  • Regulation and Disregulation of Mammalian Nucleotide Excision Repair: a
           Pathway to Non‐germline Breast Carcinogenesis;
    • Authors: Jean J. Latimer; Vongai J. Majekwana, Yashira R. Pabón‐Padín, Manasi R. Pimpley, Stephen G. Grant
      Abstract: Nucleotide excision repair (NER) is important as a modulator of disease, especially in constitutive deficiencies, such as the cancer predisposition syndrome Xeroderma pigmentosum. We have found profound variation of NER capacity among normal individuals, between cell‐types and during carcinogenesis. NER is a repair system for many types of DNA damage, and therefore many types of genotoxic carcinogenic exposures, including ultraviolet light, products of organic combustion, metals, oxidative stress, etc. Since NER is intimately related to cellular metabolism, requiring components of both the DNA replicative and transcription machinery, it has a narrow range of functional viability. Thus, genes in the NER pathway are expressed at the low levels manifested by, for example, nuclear transcription factors. Since NER activity and gene expression vary by cell‐type, it is inherently epigenetically regulated. Furthermore, this epigenetic regulation is disregulated during sporadic breast carcinogenesis. Loss of NER is one basis of genomic instability, a required element in cellular transformation, and one that potentially modulates response to therapy. In this paper, we demonstrate differences in NER capacity in eight adult mouse tissues, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-13T09:04:47.232963-05:
      DOI: 10.1111/php.12387
  • Development of Effective Skin Cancer Treatment and Prevention in Xeroderma
    • Authors: W. Clark Lambert; Muriel W. Lambert
      Abstract: Xeroderma pigmentosum (XP) is a rare, recessively transmitted genetic disease characterized by increasingly marked dyspigmentation and xerosis (dryness) of sun‐exposed tissues, especially skin. Skin cancers characteristically develop in sun‐exposed sites at very much earlier ages than in the general population; these are often multiple and hundreds or even thousands may develop. Eight complementation groups have been identified. Seven groups, XP‐A…G, are associated with defective genes encoding proteins involved in the nucleotide excision DNA repair (NER) pathway that recognizes and excises mutagenic changes induced in DNA by sunlight, the eighth group, XP‐V, is associated with defective trans‐lesion synthesis (TLS) bypassing such alterations. The dyspigmentation, xerosis, and eventually carcinogenesis in XP patients appear to be due to their cells’ failure to respond properly to these mutagenic DNA alterations, leading to mutations in skin cells. A subset of cases, especially those in some complementation groups, may develop neurological degeneration, which may be severe. However, in most XP patients in the past the multiple skin cancers have led to death at an early age due either to metastases or sepsis. Using either topical 5‐fluorouracil or imiquimod, we have developed a protocol that effectively prevents most skin cancer development in XP patients. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-07T10:23:27.184767-05:
      DOI: 10.1111/php.12385
  • Following Oxygen Consumption In Singlet Oxygen Reactions Via Changes In
           Sensitizer Phosphorescence
    • Authors: Tingting Feng; Tod A. Grusenmeyer, Max Lupin, Russell H. Schmehl
      Abstract: This work reports an examination of singlet oxygen reactions with amino acid substrates by a method involving measurement of the change in phosphorescence intensity of the singlet oxygen sensitizer. The sensitizer, a Ru(II) bipyridyl complex covalently linked to pyrene, has long lived phosphorescence in N2 purged aqueous solutions (τ0 ~ 20μs) that is nearly completely quenched by oxygen in aerated solutions. Irradiation of the complex in water containing sub mM concentrations of histidine, tryptophan and methionine results in a dramatic, easily visible increase in the phosphorescence intensity over a period of 10‐100 seconds. Rate constants for singlet oxygen oxidation of each of the substrates can be obtained by using changes in the phosphorescence intensity in initial rate kinetic analysis. Rate constants obtained in this way compare favorably with those reported in the literature. The method represents a very simple approach for obtaining rate constants for singlet oxygen reactions with various substrates and the kinetics can be extended to nonaqueous solvents. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-04T03:10:55.547249-05:
      DOI: 10.1111/php.12381
  • Transition from Charge‐Transfer to Largely Locally Excited
           Exciplexes, from Structureless to Vibrationally Structured Emissions ;
    • Authors: Ralph H. Young; Adam M. Feinberg, Joseph P. Dinnocenzo, Samir Farid
      Abstract: Exciplexes of 9,10‐dicyanoanthracene (DCA) with alkylbenzene donors in cyclohexane show structureless emission spectra, typical of exciplexes with predominantly charge‐transfer (CT) character, when the donor has a relatively low oxidation potential (Eox), e.g. hexamethylbenzene (HMB). With increasing Eox and stronger mixing with a locally excited (LE) state, vibrational structure begins to appear with 1,2,3,5‐tetramethylbenzene and becomes prominent with p‐xylene (p‐Xy). A simple theoretical model reproduces the spectra and the radiative rate constants, and it reveals several surprises: Even in this nonpolar solvent, the fractional CT character of a highly mixed exciplex varies widely in response to fluctuations in the microscopic environment. Environments that favor the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. It is known that sparsely substituted benzene radical cations, e.g., p‐Xy•+, are stabilized more in acetonitrile than the heavily substituted HMB•+. Remarkably, ion pairing with DCA•– in cyclohexane leads to even larger differences in the stabilization of these radical cations. The spectra of the low‐Eox donors are almost identical except for displacements that approximately equal the differences in Eox, even though the exciplexes have varying degrees of CT character. These similarities result from compensation among several non–obvious, but quantified factors. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-01T09:42:23.935124-05:
      DOI: 10.1111/php.12380
  • Electronic excitations in G‐quadruplexes formed by the human
           telomeric sequence: a time‐resolved fluorescence study;
    • Authors: Pascale Changenet‐Barret; Ying Hua, Thomas Gustavsson, Dimitra Markovitsi
      Abstract: The present study deals with G‐quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time‐correlated single photon counting. The results are discussed in the light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time‐scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G‐quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces non‐radiative deactivation path‐ways and favors collective effects. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-01T09:41:27.971373-05:
      DOI: 10.1111/php.12379
  • o‐Amino Analogs of GFP Chromophore: Photoisomerization,
           Photodimerization, and Aggregation‐Induced Emission
    • Authors: Guan‐Jhih Huang; Che‐Jen Lin, Yi‐Hung Liu, Shie‐Ming Peng, Jye‐Shane Yang
      Abstract: The photochemical properties of three o‐amino analogs of the GFP chromophore O0, O1, and O8 (o‐ABDIs) have been investigated and compared with those of the m‐ and p‐amino isomers (m‐ABDIs and p‐ABDIs) in solutions, aggregates, and the solid state. In aprotic solvents, the fluorescence competes with the Z → E photoisomerization for all cases, and the o‐ABDIs display a fluorescence quantum efficiency of 1−6%, lying between the m‐ABDIs of 5−48% and the p‐ABDIs of < 0.1%. The fluorescence of both the o‐ and m‐ABDIs is nearly quenched in protic solvents, attributable to the solvent‐solute hydrogen bonding (SSHB) interactions. The phenomenon of aggregation‐induced emission observed for O8 in poor solvents resembles the behavior of M8 as a consequence of exclusion of the SSHB interactions and restriction of internal rotation for molecules located inside the aggregates. The occurrence of [2+2] photodimerization for O0 in the solid state is unique among the ABDIs, and the X‐ray crystal structures of O0 and the photodimer OD reveal the head‐to‐tail syn‐oriented stereochemistry. Analysis on the X‐ray crystal structures of O0, O1, M0, M1, and P0 shows that not only the pairwise topochemical geometry but also the columnar packing mode is important in determining the photodimerization reactivity. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-27T06:45:08.933575-05:
      DOI: 10.1111/php.12373
  • Photoisomerization of
           cis‐1,2‐di(1‐Methyl‐2‐naphthyl)ethene at 77
           K in Glassy Media
    • Authors: Christopher Redwood; V. K. Ratheesh Kumar, Stuart Hutchinson, Frank B. Mallory, Clelia W. Mallory, Ronald J. Clark, Olga Dmitrenko, Jack Saltiel
      Abstract: cis‐1,2‐Di(1‐methyl‐2‐naphthyl)ethene, c‐1,1, undergoes photoisomerization in methylcyclohexane, isopentane and diethyl ether/isopentane/ethanol glasses at 77 K. On 313 nm excitation the fluorescence of c‐1,1 is replaced by fluorescence from t‐1,1. Singular value decomposition reveals that the spectral matrices behave as two component systems suggesting conversion of a stable c‐1,1 conformer to a stable t‐1,1 conformer. However, the fluorescence spectra are λexc dependent. Analysis of global spectral matrices shows that c‐1,1 is a mixture of two conformers each of which gives one of four known t‐1,1 conformers. The λexc dependence of the c‐1,1 fluorescence spectrum is barely discernible. Structure assignments to the resolved fluorescence spectra are based on the principle of least motion and on calculated geometries, energy differences and spectra of the conformers. The relative shift of the c‐1,1 conformer spectra is consistent with the shift of the calculated absorption spectra. The calculated structure of the most stable conformer of c‐1,1 agrees well with the X‐ray crystal structure. Due to large deviations of the naphthyl groups from the ethenic plane in the conformers of both c‐ and t‐1,1 isomers, minimal motion of these bulky substituents accomplishes cis → trans interconversion by rotation about the central bond. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-18T05:21:57.559828-05:
      DOI: 10.1111/php.12367
  • Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic
    • Authors: Almaz S. Jalilov; Ryan M. Young, Samuel W. Eaton, Michael R. Wasielewski, Frederick D. Lewis
      Abstract: The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's Ketone linkers have been investigated by means of steady state and time‐resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well‐stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly‐stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-08T10:41:22.009619-05:
      DOI: 10.1111/php.12360
  • Interspecific Variation in the Repair of UV Damaged DNA in the Genus
           Xiphophorus as a Factor in the Decline of the Rio Grande Platyfish
    • Authors: David Mitchell; Lakshmi Paniker, Kevin Lin, André Fernandez
      Abstract: The fish genus Xiphophorus consists of 26 species distributed along the eastern slopes of mountain ranges extending from northern Mexico to Belize and Nicaragua. We analyzed light‐dependent repair of UV‐induced DNA damage in at least two species from each of the four monophyletic Xiphophorus groups. We found that the northern platyfish had significantly reduced photoenzymatic repair compared to the other three groups, including the northern swordtails, southern platyfish and southern swordtails. All of the species of the platyfish, including the Marbled (meyeri), Northern (gordoni) and Monterrey Platyfish (couchianus) are the northernmost species in the genus and are the only three species in the genus that are currently found on the IUCN Red List of Threatened Species. Satellite data from the past 30 years (1979‐2008) correlates greater increases in shorter wavelength UVB with higher latitudes within the Xiphophorus range. We suggest that, combined with other consequences of human population growth, anthropogenic deozonation resulting in a disproportionate increase in UVB in temperate latitudes may be a contributing factor in the decline and extirpation of the northern platyfish. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-08T10:40:55.879868-05:
      DOI: 10.1111/php.12358
  • Comparison of Templating Abilities of Urea and Thioruea During
           Photodimerization of Bipyridylethyelene and Stilbazole Crystals
    • Authors: Balakrishna R. Bhogala; Burjor Captain, V. Ramamurthy
      Abstract: Photodimerization of co‐crystals of four bispyridylethylenes and two stilbazoles with urea as a template in the solid state has been investigated following our success with thiourea. Four investigated olefins photodimerized quantitatively to a single dimer in the crystalline state only. The reactivity of urea‐olefin crystals is understood on the basis of their packing arrangements in the crystalline state. In reactive crystals the adjacent reactive molecules are within 4.2 Å and parallel, while the unreactive ones have their adjacent molecules are farther than 4.6Å and non‐parallel. Thus, with the knowledge of crystal packing the reactivity of urea‐olefin crystals is predictable on the basis of Schmidt's topochemical postulates. The templating property of urea, similar to thiourea, derives from its ability to form hydrogen bonds with itself and the guest olefins. Despite the similarities in molecular structures of urea and thiourea their subtle electronic properties, yet to be fully understood, affect the crystal packing and consequently their reactivity in the crystalline state. Further work is needed to fully exploit the templating properties of urea. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-28T21:12:25.943849-05:
      DOI: 10.1111/php.12353
  • Forty Years of Research on Xeroderma Pigmentosum at the US National
           Institutes of Health
    • Authors: Kenneth H. Kraemer; John J. DiGiovanna
      Abstract: In 1968, Dr. James Cleaver reported defective DNA repair in cultured cells from patients with xeroderma pigmentosum. This link between clinical disease and molecular pathophysiology has sparked interest in understanding not only the clinical characteristics of sun sensitivity, damage and cancer that occurred in XP patients but also the mechanisms underlying the damage and repair. While affected patients are rare, their exaggerated UV damage provides a window into the workings of DNA repair. These studies have clarified the importance of a functioning DNA repair system to the maintenance of skin and neurologic health in the general population. Understanding the role of damage in causing cancer, neurologic degeneration, hearing loss and internal cancers provides an opportunity for prevention and treatment. Characterizing complementation groups pointed to the importance of different underlying genes. Studying differences in cancer age of onset and underlying molecular signatures in cancers occurring either in XP patients or the general population has led to insights into differences in carcinogenic mechanisms. The accelerated development of cancers in XP has been used as a model to discover new cancer chemopreventive agents. An astute insight can be a “tipping point” triggering decades of productive inquiry. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-15T03:16:16.941709-05:
      DOI: 10.1111/php.12345
  • Photo‐Wolff Rearrangement of
           2‐Diazo‐1,2‐naphthoquinone: Stern–Volmer Analysis
           of the Stepwise Reaction Pathway;
    • Authors: Manfred Ladinig; Markus Ramseier, Jakob Wirz
      Abstract: 2‐Diazo‐1,2‐naphthoquinone (1) and its derivatives are the photoactive components in Novolak photoresists. A femtosecond infrared study has established that the photoreaction of 1 proceeds largely by a concerted Wolff‐rearrangement yielding the ketene 1H‐inden‐1‐ylidene‐methanone (3) within 300 fs after excitation, but earlier trapping studies gave evidence for a minor reaction path via a carbene intermediate 1‐oxo‐2(1H)‐naphthalenylidene (2) with a lifetime of about 10 ps. Here, we provide a quantitative assessment of the stepwise pathway by Stern–Volmer analysis of the trapping of 2 by methanol to yield 2‐methoxy‐1‐naphthol (4). We conclude that the lifetime of the carbene 2 is at least 200 ps. Moreover, [3+2]cycloaddition of 2 and acetonitrile yielding 2‐methylnaphth[2,1‐d]oxazole (5) was observed. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground state reaction). This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-05T10:25:51.45167-05:0
      DOI: 10.1111/php.12341
  • A New Series of Fluorescent Indicators for Super Acids
    • Authors: I‐Chih Shih; Yu‐Shan Yeh, I‐Che Wu, You‐Hua Chen, Jiun‐Yi Shen, Yi‐An Chen, Mei‐Lin Ho, Pi‐Tai Chou
      Abstract: The photophysical properties of fluorescent Hammett acidity indicator derived from 3,4,5,6‐tetrahydrobis(pyrido[3,2‐g]indolo)[2,3‐a:3’,2’‐j]acridine (1a), 6‐bis(pyrido[3,2‐g]indol‐2’‐yl)pyridine (1b) and their analogues have been investigated in sulfuric acid solutions by means of absorption, fluorimetry, relaxation dynamics and computational approach. These new indicators undergo a reversible protonation process in the Hammett acidity range of H0 < 0, accompanied by a drastic increase of the bright blue‐green (1a) or yellow (1b) fluorescence intensity upon increasing the acidity. For 1a in H2SO4, the emission yield increases as large as 200 folds from pH = ‐0.41 to the Hammett acidity range of ‐5.17, the results of which are rationalized by a much increase of the steric hindrance upon third protonation toward the central pyridinic site, together with their accompanied changes of electronic configuration from charge transfer to a delocalized ππ* character in the lowest lying excited state. The combination of 1a and 1b renders a wide and linear range of H0 measurement from ‐1.2 to ‐5.1 detected by highly intensive fluorescence. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-07T02:09:17.116293-05:
      DOI: 10.1111/php.12326
  • Xeroderma Pigmentosum in the United Kingdom;
    • Authors: Alan R Lehmann
      First page: 484
      Abstract: The seminal discovery by James Cleaver of defective DNA repair in xeroderma pigmentosum (XP) opened up an ever‐expanding field of DNA repair‐related disorders. In addition it put XP on the map and has led to improved diagnosis, care and management of affected patients. In the UK, we recently established a multi‐disciplinary specialist clinic for XP patients. All XP patients in the UK are able to visit the clinic where they are examined and advised by a team of specialists with detailed knowledge of the different aspects of XP. This article is protected by copyright. All rights reserved.
      PubDate: 2014-06-19T01:55:47.802274-05:
      DOI: 10.1111/php.12301
  • Effect of Light on Expression of Clock Genes in Xenopus laevis
    • Authors: Maria Nathália Moraes; Maristela Poletini, Bruno Cesar Ribeiro Ramos, Leonardo Henrique Ribeiro Graciani Lima, Ana Maria Castrucci
      Abstract: Light‐dark cycles are considered important cues to entrain biological clocks. A feedback loop of clock gene transcription and translation is the molecular basis underlying the mechanism of both central and peripheral clocks. Xenopus laevis embryonic melanophores respond to light with melanin granule dispersion, response possibly mediated by the photopigment melanopsin. In order to test whether light modulates clock gene expression in Xenopus melanophores, we used qPCR to evaluate the relative mRNA levels of Per1, Per2, Clock and Bmal1 in cultured melanophores exposed to light‐dark (LD) cycle or constant darkness (DD). LD cycles elicited temporal changes in the expression of Per1, Per2 and Bmal1. A 10‐min pulse of blue light was able to increase the expression of Per1 and Per2. Red light had no effect on the expression of these clock genes. These data suggest the participation of a blue‐wavelength sensitive pigment in the light‐dark cycle‐mediated oscillation of the endogenous clock. Our results add an important contribution to the emerging field of peripheral clocks, which in non‐mammalian vertebrates have been mostly studied in Drosophila and Danio rerio. Within this context, we show that Xenopus laevis melanophores, which have already led to melanopsin discovery, represent an ideal model to understanding circadian rhythms. This article is protected by copyright. All rights reserved.
      PubDate: 2013-12-26T07:09:26.462616-05:
      DOI: 10.1111/j.1751-1097.2013.12230.x
School of Mathematical and Computer Sciences
Heriot-Watt University
Edinburgh, EH14 4AS, UK
Tel: +00 44 (0)131 4513762
Fax: +00 44 (0)131 4513327
About JournalTOCs
News (blog, publications)
JournalTOCs on Twitter   JournalTOCs on Facebook

JournalTOCs © 2009-2015