for Journals by Title or ISSN
for Articles by Keywords
help
  Subjects -> CHEMISTRY (Total: 792 journals)
    - ANALYTICAL CHEMISTRY (47 journals)
    - CHEMISTRY (552 journals)
    - CRYSTALLOGRAPHY (22 journals)
    - ELECTROCHEMISTRY (24 journals)
    - INORGANIC CHEMISTRY (41 journals)
    - ORGANIC CHEMISTRY (42 journals)
    - PHYSICAL CHEMISTRY (64 journals)

CHEMISTRY (552 journals)            First | 1 2 3 4 5 6 | Last

Journal of Chromatography Library     Full-text available via subscription   (Followers: 5)
Journal of Colloid and Interface Science     Hybrid Journal   (Followers: 12)
Journal of Computational Chemistry     Hybrid Journal   (Followers: 13)
Journal of Coordination Chemistry     Hybrid Journal   (Followers: 1)
Journal of Dispersion Science and Technology     Hybrid Journal  
Journal of Encapsulation and Adsorption Sciences     Open Access   (Followers: 5)
Journal of Environmental Chemistry and Ecotoxicology     Open Access   (Followers: 2)
Journal of Flow Chemistry     Full-text available via subscription   (Followers: 1)
Journal of Fluorescence     Hybrid Journal   (Followers: 3)
Journal of Fluorine Chemistry     Hybrid Journal   (Followers: 6)
Journal of Fuel Chemistry and Technology     Full-text available via subscription   (Followers: 5)
Journal of Great Lakes Research     Hybrid Journal   (Followers: 7)
Journal of Heterocyclic Chemistry     Hybrid Journal   (Followers: 5)
Journal of Immunoassay and Immunochemistry     Hybrid Journal   (Followers: 3)
Journal of Inclusion Phenomena and Macrocyclic Chemistry     Hybrid Journal   (Followers: 1)
Journal of Inorganic Biochemistry     Hybrid Journal   (Followers: 2)
Journal of Labelled Compounds and Radiopharmaceuticals     Hybrid Journal   (Followers: 1)
Journal of Macromolecular Science, Part A: Pure and Applied Chemistry     Hybrid Journal   (Followers: 4)
Journal of Mass Spectrometry     Hybrid Journal   (Followers: 20)
Journal of Materials Chemistry A : Materials for Energy and Sustainability     Full-text available via subscription   (Followers: 23)
Journal of Materials Chemistry B : Materials for Biology and Medicine     Full-text available via subscription   (Followers: 5)
Journal of Materials Chemistry C : Materials for Optical, Magnetic and Electronic Devices     Full-text available via subscription   (Followers: 6)
Journal of Materials Physics and Chemistry     Open Access  
Journal of Materials Research     Full-text available via subscription   (Followers: 9)
Journal of Mathematical Chemistry     Hybrid Journal   (Followers: 4)
Journal of Medicinal Chemistry     Full-text available via subscription   (Followers: 192)
Journal of Membrane Science     Hybrid Journal   (Followers: 10)
Journal of Modern Chemistry & Chemical Technology     Full-text available via subscription   (Followers: 2)
Journal of Molecular Catalysis A: Chemical     Hybrid Journal   (Followers: 2)
Journal of Molecular Graphics and Modelling     Hybrid Journal   (Followers: 4)
Journal of Molecular Liquids     Hybrid Journal   (Followers: 3)
Journal of Molecular Modeling     Hybrid Journal   (Followers: 3)
Journal of Molecular Recognition     Hybrid Journal   (Followers: 2)
Journal of Molecular Spectroscopy     Hybrid Journal   (Followers: 6)
Journal of Molecular Structure     Hybrid Journal   (Followers: 3)
Journal of Nanoparticles     Open Access  
Journal of Nanostructure in Chemistry     Open Access   (Followers: 5)
Journal of Natural Gas Chemistry     Full-text available via subscription   (Followers: 2)
Journal of Nepal Chemical Society     Open Access  
Journal of Nucleic Acids Investigation     Open Access   (Followers: 2)
Journal of Ocean University of China (English Edition)     Hybrid Journal   (Followers: 2)
Journal of Organometallic Chemistry     Hybrid Journal   (Followers: 12)
Journal of Photochemistry and Photobiology A: Chemistry     Hybrid Journal   (Followers: 4)
Journal of Photochemistry and Photobiology C: Photochemistry Reviews     Full-text available via subscription   (Followers: 4)
Journal of Polymer & Composites     Full-text available via subscription  
Journal of Polymer and Biopolymer Physics Chemistry     Open Access  
Journal of Polymer Science Part A: Polymer Chemistry     Hybrid Journal   (Followers: 180)
Journal of Polymers     Open Access   (Followers: 1)
Journal of Porphyrins and Phthalocyanines     Hybrid Journal   (Followers: 2)
Journal of Pure and Applied Chemistry Research     Open Access   (Followers: 1)
Journal of Raman Spectroscopy     Hybrid Journal   (Followers: 10)
Journal of Saudi Chemical Society     Open Access  
Journal of Solid State Chemistry     Hybrid Journal   (Followers: 14)
Journal of Solution Chemistry     Hybrid Journal  
Journal of Structural Chemistry     Hybrid Journal  
Journal of Sulfur Chemistry     Hybrid Journal   (Followers: 2)
Journal of Superhard Materials     Hybrid Journal   (Followers: 1)
Journal of Surfactants and Detergents     Hybrid Journal   (Followers: 5)
Journal of Systems Chemistry     Open Access   (Followers: 1)
Journal of Taibah University for Science     Open Access  
Journal of the American Chemical Society     Full-text available via subscription   (Followers: 280)
Journal of the American Society for Mass Spectrometry     Hybrid Journal   (Followers: 17)
Journal of the American Society of Brewing Chemists     Full-text available via subscription   (Followers: 1)
Journal of the Bangladesh Chemical Society     Open Access  
Journal of the Chilean Chemical Society     Open Access   (Followers: 2)
Journal of the Iranian Chemical Society     Hybrid Journal   (Followers: 1)
Journal of the Korean Society for Applied Biological Chemistry     Hybrid Journal   (Followers: 1)
Journal of the Mexican Chemical Society     Open Access   (Followers: 1)
Journal of Theoretical and Computational Chemistry     Hybrid Journal   (Followers: 7)
Journal of Theoretical Chemistry     Open Access  
Journal of Wood Chemistry and Technology     Hybrid Journal   (Followers: 7)
JPC - Journal of Planar Chromatography - Modern TLC     Full-text available via subscription   (Followers: 6)
Jurnal Penelitian Sains (JPS)     Open Access  
Jurnal Teknologi Informasi     Open Access   (Followers: 3)
Kinetics and Catalysis     Hybrid Journal   (Followers: 3)
Korea-Australia Rheology Journal     Hybrid Journal  
Langmuir     Full-text available via subscription   (Followers: 36)
Latvian Journal of Chemistry     Open Access   (Followers: 1)
Lebensmittelchemie     Hybrid Journal   (Followers: 1)
Lipid Insights     Open Access   (Followers: 1)
Luminescence     Hybrid Journal   (Followers: 1)
Macromolecular Materials & Engineering     Hybrid Journal   (Followers: 4)
Macromolecular Rapid Communications     Hybrid Journal   (Followers: 4)
Macromolecular Research     Hybrid Journal  
Macromolecular Symposia     Hybrid Journal  
Macromolecular Theory and Simulations     Hybrid Journal  
Macromolecules     Full-text available via subscription   (Followers: 31)
Magnetic Resonance in Chemistry     Hybrid Journal   (Followers: 4)
Main Group Chemistry     Hybrid Journal  
Marine Chemistry     Hybrid Journal   (Followers: 4)
Marine Drugs     Open Access   (Followers: 4)
MATEC Web of Conferences     Open Access  
Materials Characterization     Hybrid Journal   (Followers: 23)
Materials Horizons     Full-text available via subscription  
Materials Research Bulletin     Hybrid Journal   (Followers: 17)
Materials Science Monographs     Full-text available via subscription   (Followers: 1)
Materials Science-Poland     Hybrid Journal  
Materials Sciences and Applications     Open Access   (Followers: 4)
MedChemComm     Full-text available via subscription   (Followers: 4)
Medicinal Chemistry Research     Hybrid Journal   (Followers: 10)

  First | 1 2 3 4 5 6 | Last

Journal Cover Photochemistry and Photobiology
   [3 followers]  Follow    
   Hybrid Journal Hybrid journal (It can contain Open Access articles)
     ISSN (Print) 0031-8655 - ISSN (Online) 1751-1097
     Published by John Wiley and Sons Homepage  [1604 journals]   [SJR: 0.709]   [H-I: 86]
  • Minimum Exposure Limits and Measured Relationships Between the Vitamin D,
           Erythema and International Commission on Non‐Ionizing Radiation
           Protection Solar Ultraviolet
    • Authors: Nathan Downs; Alfio Parisi, Harry Butler, Joanna Turner, Lisa Wainwright
      Pages: n/a - n/a
      Abstract: The International Commission on Non‐Ionizing Radiation Protection (ICNIRP) has established guidelines for exposure to ultraviolet radiation in outdoor occupational settings. Spectrally weighted ICNIRP ultraviolet exposures received by the skin or eye in an 8 hr period are limited to 30 Jm−2. In this study, the time required to reach the ICNIRP exposure limit was measured daily in ten minute intervals upon a horizontal plane at a subtropical Australian latitude over a full year and compared with the effective Vitamin D dose received to ¼ of the available skin surface area for all six Fitzpatrick skin types. The comparison of measured solar ultraviolet exposures for the full range of sky conditions in the 2009 measurement period, including a major September continental dust event, show a clear relationship between the weighted ICNIRP and the effective vitamin D dose. Our results show that the horizontal plane ICNIRP ultraviolet exposure may be used under these conditions to provide minimum guidelines for the healthy moderation of vitamin D, scalable to each of the six Fitzpatrick skin types. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-18T22:21:20.843717-05:
      DOI: 10.1111/php.12394
       
  • Absorption and Emission Sensitivity of
           2‐(2’‐Hydroxyphenyl)benzoxazole to Solvents and
           Impurities
    • Authors: Zhao Yuan; Qing Tang, Kesavapillai Sreenath, J. Tyler Simmons, Ali H. Younes, De‐en Jiang, Lei Zhu
      Pages: n/a - n/a
      Abstract: 2‐(2’‐Hydroxyphenyl)benzoxazole (HBO) is known for undergoing intramolecular proton transfer in the excited state to result in the emission of its tautomer. A minor long‐wavelength absorption band in the range of 370‐420 nm has been reported in highly polar solvents such as dimethylsulfoxide (DMSO). Yet the nature of this species has not been entirely clarified. In this work, we provide evidence that this long‐wavelength absorption band might have been caused by base or metal salt impurities that are introduced into the spectral sample during solvent transport using glass Pasteur pipettes. The contamination by base or metal salt could be avoided by using borosilicate glass syringes or non‐glass pipettes in sample handling. Quantum chemical calculations conclude that solvent‐mediated deprotonation is too energetically costly to occur without the aid of a base of an adequate strength. In the presence of such a base, the deprotonation of HBO and its effect on emission are investigated in dichloromethane and DMSO, the latter of which facilitates deprotonation much more readily than the former. Finally, the absorption and emission spectra of HBO in 13 solvents are reported, from which it is concluded that ESIPT is hindered in polar solvents that are also strong hydrogen bond acceptors. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-18T04:39:10.999301-05:
      DOI: 10.1111/php.12393
       
  • Steric and Electronic Factors Associated with the Photoinduced Ligand
           Exchange of Bidentate Ligands Coordinated to Ru(II)
    • Authors: Bryan A. Albani; Tyler Whittemore, Christopher B. Durr, Claudia Turro
      Pages: n/a - n/a
      Abstract: In an effort to create a molecule that can absorb low energy visible or near‐infrared light for photochemotherapy (PCT), the new complexes [Ru(biq)2(dpb)](PF6)2 (1, biq = 2,2′‐biquinoline, dpb = 2,3‐bis(2‐pyridyl)benzoquinoxaline) and [(biq)2Ru(dpb)Re(CO)3Cl](PF6)2 (2) were synthesized and characterized. Complexes 1 and 2 were compared to [Ru(bpy)2(dpb)](PF6)2 (3, bpy = 2,2′‐bipyridine) and [Ru(biq)2(phen)](PF6)2 (4, phen = 1,10‐phenanthroline). Distortions around the metal and biq ligands were used to explain the exchange of one biq ligand in 4 upon irradiation. Complex 1, however, undergoes photoinduced dissociation of the dpb ligand rather than biq under analogous experimental conditions. Complex 3 is not photoactive, providing evidence that the biq ligands are crucial for ligand photodissociation in 1. The crystal structures of 1 and 4 are compared to explain the difference in photochemistry between the complexes. Complex 2 absorbs lower energy light than 1, but is photochemically inert although its crystal structure displays significant distortions. These results indicate that both the excited state and electronic structure and steric bulk play key roles in bidentate photoinduced ligand dissociation. The present work also shows that it is possible to stabilize sterically hindered Ru(II) complexes by the addition of another metal, a property that may be useful for other applications. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-18T04:31:47.205366-05:
      DOI: 10.1111/php.12392
       
  • Ultraviolet Index and Location are Important Determinants of Vitamin D
           Status in People with Human Immunodeficiency Virus (HIV)
    • Authors: Karen M Klassen; Christopher K Fairley, Michael G Kimlin, Mark Kelly, Tim RH Read, Jennifer Broom, Darren B Russell, Peter R Ebeling
      Pages: n/a - n/a
      Abstract: This study aimed to document the vitamin D status of HIV‐infected individuals across a wide latitude range in one country and to examine associated risk factors for low vitamin D. Using data from patients attending four HIV specialist clinics across a wide latitude range in Australia, we constructed logistic regression models to investigate risk factors associated with 25(OH)D
      PubDate: 2014-11-14T08:11:52.739589-05:
      DOI: 10.1111/php.12390
       
  • The efficient photocatalytic degradation of methyl tert‐butyl ether
           under Pd/ZnO and visible light irradiation
    • Authors: Zaki S. Seddigi; Saleh A. Ahmed, Ali Bumajdad, Ekram Y. Danish, Ahmed M. Shwaky, Mohammed A. Gondal, Mustafa Soylak
      Pages: n/a - n/a
      Abstract: Methyl tert‐butyl ether is a commonly used fuel oxygenate that is present in gasoline. It was introduced to eliminate the use of leaded gasoline and to improve the octane quality because it aids in the complete combustion of fuel by supplying oxygen during the combustion process. Over the past decade, the use of MTBE has increased tremendously worldwide. For obvious reasons relating to accidental spillage, MTBE started to appear as an environmental and human health threat because of its non‐biodegradable nature and carcinogenic potential, respectively. In the present work, MTBE was degraded with the help of an advanced oxidation process through the use of zinc oxide as a photocatalyst in the presence of visible light. A mixture of 200 mg of zinc oxide in 350 ml of 50 ppm MTBE aqueous solution was irradiated with visible light for a given time. The complete degradation of MTBE was recorded, and approximately 99% photocatalytic degradation of 100 ppm MTBE solution was observed. Additionally, the photoactivity of 1% Pd‐doped ZnO was tested under similar conditions to understand the effect of Pd doping on ZnO. Our results obtained under visible light irradiation are very promising, and they could be further explored for the degradation of several non‐degradable environmental pollutants. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-14T08:11:39.724009-05:
      DOI: 10.1111/php.12391
       
  • Beyond Xeroderma Pigmentosum: DNA Damage and Repair in an Ecological
           Context A Tribute to James E. Cleaver
    • Authors: Deneb Karentz
      Pages: n/a - n/a
      Abstract: The ability to repair DNA is a ubiquitous characteristic of life on Earth and all organisms possess similar mechanisms for dealing with DNA damage, an indication of a very early evolutionary origin for repair processes. James E. Cleaver's career (initiated in the early 1960s) has been devoted to the study of mammalian ultraviolet radiation (UVR) photobiology, specifically the molecular genetics of xeroderma pigmentosum and other human diseases caused by defects in DNA damage recognition and repair. This work by Jim and others has influenced the study of DNA damage and repair in a variety of taxa. Today, the field of DNA repair is enhancing our understanding of not only how to treat and prevent human disease, but is providing insights on the evolutionary history of life on Earth and how natural populations are coping with UVR‐induced DNA damage from anthropogenic changes in the environment such as ozone depletion. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-14T01:21:50.44255-05:0
      DOI: 10.1111/php.12388
       
  • Reviewers for Photochemistry and Photobiology over the period October 1,
           2013–October 1, 2014
    • Pages: E1 - E7
      PubDate: 2014-11-14T00:45:09.748967-05:
      DOI: 10.1111/php.12371
       
  • Regulation and Disregulation of Mammalian Nucleotide Excision Repair: a
           Pathway to Non‐germline Breast Carcinogenesis;
    • Authors: Jean J. Latimer; Vongai J. Majekwana, Yashira R. Pabón‐Padín, Manasi R. Pimpley, Stephen G. Grant
      Pages: n/a - n/a
      Abstract: Nucleotide excision repair (NER) is important as a modulator of disease, especially in constitutive deficiencies, such as the cancer predisposition syndrome Xeroderma pigmentosum. We have found profound variation of NER capacity among normal individuals, between cell‐types and during carcinogenesis. NER is a repair system for many types of DNA damage, and therefore many types of genotoxic carcinogenic exposures, including ultraviolet light, products of organic combustion, metals, oxidative stress, etc. Since NER is intimately related to cellular metabolism, requiring components of both the DNA replicative and transcription machinery, it has a narrow range of functional viability. Thus, genes in the NER pathway are expressed at the low levels manifested by, for example, nuclear transcription factors. Since NER activity and gene expression vary by cell‐type, it is inherently epigenetically regulated. Furthermore, this epigenetic regulation is disregulated during sporadic breast carcinogenesis. Loss of NER is one basis of genomic instability, a required element in cellular transformation, and one that potentially modulates response to therapy. In this paper, we demonstrate differences in NER capacity in eight adult mouse tissues, and place this result into the context of our previous work on mouse extraembryonic tissues, normal human tissues and sporadic early stage human breast cancer. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-13T09:04:47.232963-05:
      DOI: 10.1111/php.12387
       
  • Light Regulated MicroRNAs;
    • Authors: Ashika Jayanthy; Vijayasaradhi Setaluri
      Pages: n/a - n/a
      Abstract: In addition to exposure to passive diurnal cycles of sun light, humans are also subjected to intentional acute exposure to other types of electromagnetic radiation (EM). Understanding the molecular mechanisms involved in the physiological, pathological and therapeutic responses to exposure to radiation is an active area of research. With the advent of methods to readily catalog and identify patterns of changes in gene expression, many studies have reported changes in the gene expression upon exposure of various human and mouse cells in vitro, whole experimental organisms such as mice and parts of human body. However, the molecular mechanisms underlying these broad ranging changes in gene expression are not yet fully understood. MicroRNAs, which are short, non‐coding RNAs that regulate gene expression by targeting many messenger RNAs, are also emerging as important mediators of radiation induced changes in gene expression and hence critical for the manifestation of light‐induced cellular phenotypes and physiological responses. In this article, we review available knowledge on microRNAs implicated in responses to various forms of solar and other EM radiation. Based on this knowledge we elaborate some unifying themes in the regulation and functions of some of these miRNAs. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-10T07:32:14.095513-05:
      DOI: 10.1111/php.12386
       
  • Development of Effective Skin Cancer Treatment and Prevention in Xeroderma
           Pigmentosum
    • Authors: W. Clark Lambert; Muriel W. Lambert
      Pages: n/a - n/a
      Abstract: Xeroderma pigmentosum (XP) is a rare, recessively transmitted genetic disease characterized by increasingly marked dyspigmentation and xerosis (dryness) of sun‐exposed tissues, especially skin. Skin cancers characteristically develop in sun‐exposed sites at very much earlier ages than in the general population; these are often multiple and hundreds or even thousands may develop. Eight complementation groups have been identified. Seven groups, XP‐A…G, are associated with defective genes encoding proteins involved in the nucleotide excision DNA repair (NER) pathway that recognizes and excises mutagenic changes induced in DNA by sunlight, the eighth group, XP‐V, is associated with defective trans‐lesion synthesis (TLS) bypassing such alterations. The dyspigmentation, xerosis, and eventually carcinogenesis in XP patients appear to be due to their cells’ failure to respond properly to these mutagenic DNA alterations, leading to mutations in skin cells. A subset of cases, especially those in some complementation groups, may develop neurological degeneration, which may be severe. However, in most XP patients in the past the multiple skin cancers have led to death at an early age due either to metastases or sepsis. Using either topical 5‐fluorouracil or imiquimod, we have developed a protocol that effectively prevents most skin cancer development in XP patients. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-07T10:23:27.184767-05:
      DOI: 10.1111/php.12385
       
  • Vitamin D and skin cancer;
    • Authors: Erin M. Burns; Craig A. Elmets, Nabiha Yusuf
      Pages: n/a - n/a
      Abstract: Vitamin D signaling plays a key role in various important processes, including cellular proliferation, differentiation, and apoptosis, immune regulation, hormone secretion, and skeletal health. Further, vitamin D production and supplementation have been shown to exert protective effects via an unknown signaling mechanism involving the vitamin D receptor (VDR) in several diseases and cancer types, including skin cancer. With over 3.5 million new diagnoses in 2 million patients annually, skin cancer is the most common cancer type in the United States. While ultraviolet B (UVB) radiation is the main etiologic factor for non‐melanoma skin cancer (NMSC), UVB also induces cutaneous vitamin D production. This paradox has been the subject of contradictory findings in the literature in regards to amount of sun exposure necessary for appropriate vitamin D production, as well as any beneficial or detrimental effects of vitamin D supplementation for disease prevention. Further clinical and epidemiological studies are necessary to elucidate the role of vitamin D in skin carcinogenesis. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-07T02:54:25.254662-05:
      DOI: 10.1111/php.12382
       
  • ß‐Ga2O3 Nanorod Synthesis with a One‐step Microwave
           Irradiation Hydrothermal Method and its Efficient Photocatalytic
           Degradation for Perfluorooctanoic Acid
    • Authors: Baoxiu Zhao; Xiang Li, Long Yang, Fen Wang, Jincheng Li, Wenxiang Xia, Weijiang Li, Li Zhou, Colin Zhao
      Pages: n/a - n/a
      Abstract: ß‐Ga2O3 nanorod was first directly prepared by the microwave irradiation hydrothermal way without any subsequent heat treatments, and its characterizations were analyzed by X‐ray diffraction (XRD), scanning electron microscope (SEM), high resolution transmission electron microscope (HRTEM), UV‐Vis diffuse reflection spectroscopy techniques, and also its photocatalytic degradation for perfluorooctanoic acid (PFOA) was investigated. XRD patterns revealed that ß‐Ga2O3 crystallization increased with the enhancement of microwave power and the adding of active carbon (AC). PFOA, as an environmental and persistent pollutant, is hard decomposed by hydroxyl radicals (HO·); however, it is facilely destroyed by ß‐Ga2O3 photocatalytic reaction in an anaerobic atmosphere. The important factors such as pH, ß‐Ga2O3 dosage and bubbling atmosphere were researched, and the degradation and defluorination was 98.8% and 56.2%, respectively. Reductive atmosphere reveals that photoinduced electron may be the major reactant for PFOA. Furthermore, the degradation kinetics for PFOA was simulated and constant and half‐life was calculated, respectively. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-07T01:39:22.268762-05:
      DOI: 10.1111/php.12383
       
  • Following Oxygen Consumption In Singlet Oxygen Reactions Via Changes In
           Sensitizer Phosphorescence
    • Authors: Tingting Feng; Tod A. Grusenmeyer, Max Lupin, Russell H. Schmehl
      Pages: n/a - n/a
      Abstract: This work reports an examination of singlet oxygen reactions with amino acid substrates by a method involving measurement of the change in phosphorescence intensity of the singlet oxygen sensitizer. The sensitizer, a Ru(II) bipyridyl complex covalently linked to pyrene, has long lived phosphorescence in N2 purged aqueous solutions (τ0 ~ 20μs) that is nearly completely quenched by oxygen in aerated solutions. Irradiation of the complex in water containing sub mM concentrations of histidine, tryptophan and methionine results in a dramatic, easily visible increase in the phosphorescence intensity over a period of 10‐100 seconds. Rate constants for singlet oxygen oxidation of each of the substrates can be obtained by using changes in the phosphorescence intensity in initial rate kinetic analysis. Rate constants obtained in this way compare favorably with those reported in the literature. The method represents a very simple approach for obtaining rate constants for singlet oxygen reactions with various substrates and the kinetics can be extended to nonaqueous solvents. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-04T03:10:55.547249-05:
      DOI: 10.1111/php.12381
       
  • Transition from Charge‐Transfer to Largely Locally Excited
           Exciplexes, from Structureless to Vibrationally Structured Emissions ;
    • Authors: Ralph H. Young; Adam M. Feinberg, Joseph P. Dinnocenzo, Samir Farid
      Pages: n/a - n/a
      Abstract: Exciplexes of 9,10‐dicyanoanthracene (DCA) with alkylbenzene donors in cyclohexane show structureless emission spectra, typical of exciplexes with predominantly charge‐transfer (CT) character, when the donor has a relatively low oxidation potential (Eox), e.g. hexamethylbenzene (HMB). With increasing Eox and stronger mixing with a locally excited (LE) state, vibrational structure begins to appear with 1,2,3,5‐tetramethylbenzene and becomes prominent with p‐xylene (p‐Xy). A simple theoretical model reproduces the spectra and the radiative rate constants, and it reveals several surprises: Even in this nonpolar solvent, the fractional CT character of a highly mixed exciplex varies widely in response to fluctuations in the microscopic environment. Environments that favor the LE (or CT) state contribute more to the blue (or red) side of the overall spectrum. It is known that sparsely substituted benzene radical cations, e.g., p‐Xy•+, are stabilized more in acetonitrile than the heavily substituted HMB•+. Remarkably, ion pairing with DCA•– in cyclohexane leads to even larger differences in the stabilization of these radical cations. The spectra of the low‐Eox donors are almost identical except for displacements that approximately equal the differences in Eox, even though the exciplexes have varying degrees of CT character. These similarities result from compensation among several non–obvious, but quantified factors. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-01T09:42:23.935124-05:
      DOI: 10.1111/php.12380
       
  • Electronic excitations in G‐quadruplexes formed by the human
           telomeric sequence: a time‐resolved fluorescence study;
    • Authors: Pascale Changenet‐Barret; Ying Hua, Thomas Gustavsson, Dimitra Markovitsi
      Pages: n/a - n/a
      Abstract: The present study deals with G‐quadruplexes formed by folding of the human telomeric sequence d(GGGTTAGGGTTAGGGTTAGGG), in presence of K+ cations, noted Tel21/K+. Fluorescence decays and fluorescence anisotropy decays, obtained upon excitation at 267 nm, are probed from femtosecond to nanosecond domains using two different detection techniques, fluorescence upconversion and time‐correlated single photon counting. The results are discussed in the light of recent theoretical studies. It is shown that efficient energy transfer takes place among the bases on the femtosecond time‐scale, possible only via exciton states. The major part of the fluorescence originates from bright excited states having weak charge transfer character and decaying between 1 and 100 ps. Charge transfer states involving guanines in different tetrads decay mainly after 100 ps and emit at the red wing of the spectrum. The persistence of electronic excitations in Tel21/K+ is longer and the contribution of charge transfer states is more pronounced than what is observed for G‐quadruplexes formed by association of four d(TGGGT) strands and containing the same number of tetrads. This difference is due to the increased structural rigidity of monomolecular structures which reduces non‐radiative deactivation path‐ways and favors collective effects. This article is protected by copyright. All rights reserved.
      PubDate: 2014-11-01T09:41:27.971373-05:
      DOI: 10.1111/php.12379
       
  • In Vitro Photodynamic Inactivation Effects of Ru(II) Complexes on Clinical
           Methicillin‐resistant Staphylococcus aureus Planktonic and Biofilm
           Cultures
    • Authors: Yucheng Wang; Qianxiong Zhou, Ying Wang, Jie Ren, Hongyou Zhao, Sumin Wu, Jiyong Yang, Jie Zhen, Yanping Luo, Xuesong Wang, Ying Gu
      Pages: n/a - n/a
      Abstract: Photosensitizers (PSs) combined with light are able to generate antimicrobial effects. Ru(II) complexes have been recognized as a novel class of PSs. In this study, we investigated the effectiveness of photodynamic inactivation (PDI) mediated by three Ru(II) polypyridine complexes, 1–3, against four isolates of clinical methicillin‐resistant Staphylococcus aureus (MRSA‐1, MRSA‐2, MRSA‐3 and MRSA‐4). In PDI of a planktonic culture of MRSA‐1, compound 3 showed the highest efficacy, likely owing to its advantageous light absorption, 1O2 quantum yield and bacterial cellular binding. The PDI efficacy of 3 was further evaluated against all other strains and MRSA‐1 biofilms. At appropriate PS concentrations, viability reduction of 100% or 96.83% was observed in planktonic or biofilm forms of MRSA, respectively. The mechanisms of action were investigated using negative staining transmission electron microscopy (TEM), confocal laser scanning microscopy (CLSM) and scanning electron microscopy (SEM). It was demonstrated that PDI of planktonic bacteria was achieved primarily through damage to the cell envelope. Biofilms were eliminated through both the destruction of their structure and inactivation of the individual bacterial cells. In conclusion, Ru(II) complexes, especially 3, are potential candidates for the effective photodynamic control of MRSA infections. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-29T09:27:39.569464-05:
      DOI: 10.1111/php.12378
       
  • UV Signature Mutations;
    • Authors: Douglas E. Brash
      Pages: n/a - n/a
      Abstract: Sequencing complete tumor genomes and exomes has sparked the cancer field's interest in mutation signatures for identifying the tumor's carcinogen. This review and meta‐analysis discusses signatures and their proper use. We first distinguish between a mutagen's canonical mutations – deviations from a random distribution of base changes to create a pattern typical of that mutagen – and the subset of signature mutations, which are unique to that mutagen and permit inference backward from mutations to mutagen. To verify UV signature mutations, we assembled literature datasets on cells exposed to UVC, UVB, UVA, or solar simulator light (SSL) and tested canonical UV mutation features as criteria for clustering datasets. A confirmed UV signature was: ≥60% of mutations are C→T at a dipyrimidine site, with ≥5% CC→TT. Other canonical features such as a bias for mutations on the non‐transcribed strand or at the 3’ pyrimidine had limited application. The most robust classifier combined these features with criteria for the rarity of non‐UV canonical mutations. In addition, several signatures proposed for specific UV wavelengths were limited to specific genes or species; non‐signature mutations induced by UV may cause melanoma BRAF mutations; and the mutagen for sunlight‐related skin neoplasms may vary between continents. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-29T09:27:37.423973-05:
      DOI: 10.1111/php.12377
       
  • In situ FTIR spectroscopy study of the photo‐degradation of
           acetaldehyde and azo dye photobleaching on bismuth‐modified TiO2
    • Authors: Jiří Henych; Václav Štengl, Andreas Mattsson, Lars Österlund
      Pages: n/a - n/a
      Abstract: The photocatalytic properties of bismuth‐modified titania were studied by photo‐bleaching of two aqueous azo dyes solutions (Reactive Black 5 and Acid Orange 7), and by photo induced decomposition (PID) of acetaldehyde using in situ FTIR spectroscopy. Low bismuth doping concentrations up to 3 at.% is shown to lead to an increased photo‐bleaching rate of both azo dyes solutions. Too high Bi dopant concentrations lead to less developed crystallite nanoparticles and exhibit weaker adsorption capacity. Bismuth doping altered the adsorption kinetics of acetaldehyde resulting in different surface products, and a modified photocatalytic reaction pathway was inferred. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-27T07:00:34.659325-05:
      DOI: 10.1111/php.12374
       
  • Effective Photoprotection of Human Skin Against Infrared A Radiation by
           Topically Applied Antioxidants: Results from a Vehicle Controlled,
           Randomized Study
    • Authors: Susanne Grether‐Beck; Alessandra Marini, Thomas Jaenicke, Jean Krutmann
      Pages: n/a - n/a
      Abstract: Infrared A radiation (IRA) from solar sunlight contributes to photoaging of human skin, e.g. by upregulating MMP‐1 expression in dermal fibroblasts, indicating the need for photoprotection of human skin against IRA. Up to now, however, there has been no controlled study to show that effective protection of human skin against IRA radiation is possible. Here we have conducted a randomized, controlled, double blinded prospective study in 30 healthy volunteers to assess the capacity of an SPF 30 sunscreen versus the same sunscreen supplemented with an antioxidant cocktail containing grape seed extract, vitamin E, ubiquchinone and vitamin C to protect human skin against IRA radiation‐induced MMP‐1 upregulation. As expected, exposure to IRA radiation significantly upregulated MMP‐1 expression, as compared to unirradiated skin, and this response was significantly reduced, if the SPF30 sunscreen plus the antioxidant cocktail had been applied prior to IRA radiation. In contrast, treatment of human skin with the SPF30 sunscreen alone did not provide significant protection. These results indicate that topically applied antioxidants effectively protect human skin against IRA radiation and that regular sunscreens need to be supplemented with specific antioxidants in order to achieve IRA photoprotection. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-27T06:45:22.971985-05:
      DOI: 10.1111/php.12375
       
  • o‐Amino Analogs of GFP Chromophore: Photoisomerization,
           Photodimerization, and Aggregation‐Induced Emission
    • Authors: Guan‐Jhih Huang; Che‐Jen Lin, Yi‐Hung Liu, Shie‐Ming Peng, Jye‐Shane Yang
      Pages: n/a - n/a
      Abstract: The photochemical properties of three o‐amino analogs of the GFP chromophore O0, O1, and O8 (o‐ABDIs) have been investigated and compared with those of the m‐ and p‐amino isomers (m‐ABDIs and p‐ABDIs) in solutions, aggregates, and the solid state. In aprotic solvents, the fluorescence competes with the Z → E photoisomerization for all cases, and the o‐ABDIs display a fluorescence quantum efficiency of 1−6%, lying between the m‐ABDIs of 5−48% and the p‐ABDIs of < 0.1%. The fluorescence of both the o‐ and m‐ABDIs is nearly quenched in protic solvents, attributable to the solvent‐solute hydrogen bonding (SSHB) interactions. The phenomenon of aggregation‐induced emission observed for O8 in poor solvents resembles the behavior of M8 as a consequence of exclusion of the SSHB interactions and restriction of internal rotation for molecules located inside the aggregates. The occurrence of [2+2] photodimerization for O0 in the solid state is unique among the ABDIs, and the X‐ray crystal structures of O0 and the photodimer OD reveal the head‐to‐tail syn‐oriented stereochemistry. Analysis on the X‐ray crystal structures of O0, O1, M0, M1, and P0 shows that not only the pairwise topochemical geometry but also the columnar packing mode is important in determining the photodimerization reactivity. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-27T06:45:08.933575-05:
      DOI: 10.1111/php.12373
       
  • Synthesis, Structure and Photophysical Properties of Ferrocenyl or mixed
           Sandwich Cobaltocenyl Ester Linked meso‐Tetratolylporphyrin Dyads
    • Authors: Gokulnath Sabapathi; B. Shivaprasad Achary, Challa Kiran Kumar, Rajiv Trivedi, B. Sreedhar, Lingamallu Giribabu
      Pages: n/a - n/a
      Abstract: We report here the design and synthesis of porphyrin‐metallocene dyads consisting of a metallocene [either ferrocene or mixed sandwich η5‐[C5H4(COOH)]Co(η4‐C4Ph4) connected via an ester linkage at meso phenyl position of either free‐base or zinc porphyrin. All these dyad systems were characterized by various spectroscopic and electrochemical methods. A dimeric form of this molecule was observed in the X‐ray crystal structure of Zn‐TTPCo. The absorption spectra of all four dyads indicated the absence of electronic interactions between porphyrin macrocycle and metallocene in the ground state. However, interestingly, in all four dyads, fluorescence emission of the porphyrin was quenched (19‐55%) as compared to their monomeric units. The quenching was more pronounced in ferrocene derivatives rather than cobaltocenyl derivatives. The emission quenching can be attributed to the excited state intramolecular photoinduced electron transfer from metallocene to singlet excited state of porphyrin and the electron transfer rates (kET) were established in the range 1.51 x 108 to 1.11 x 109 s−1. They were found to be solvent dependent. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-27T06:45:00.476627-05:
      DOI: 10.1111/php.12372
       
  • Analysis of Oxyluciferin Photoluminescence Pathways in Aqueous Solutions
    • Authors: Miyabi Hiyama; Toshimitsu Mochizuki, Hidefumi Akiyama, Nobuaki Koga
      Pages: n/a - n/a
      Abstract: We evaluated the pKa values of oxyluciferin and its conjugate acids and bases theoretically with the help of experimental correction values, from which free energies for the first excited and the ground states of all the species were estimated. On the basis of these results, we calculated pH‐dependent absorption spectra, where the relative absorption intensities of various species strongly depend on photo‐excitation energy, and we further analysed the photoluminescence pathways of oxyluciferin in aqueous solutions with various pH. In the case of 350 nm photo‐excitation, in particular, experiments have shown that dominant emission colour is green and it attenuates with pH decreasing, while blue (3 < pH < 8) and red (pH < 3) emissions appear. Our present results clarify the pathways of these photoluminescence depending on the pH values and thus should be useful in further analyses of photoluminescence pathways for other photo‐excitation wavelength in comparison with experiments. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-21T07:52:11.713827-05:
      DOI: 10.1111/php.12370
       
  • Combination of Er:YAG Laser and CO2 Laser treatment on skin tissue
    • Authors: Sana Mohammeb Anayb Baleg; Noriah Bidin, Lau Pik Suan, Muhammad Fakarruddin Sidi Ahmad, Ganesan Krishnan, Asmah Hamid
      Pages: n/a - n/a
      Abstract: The skin is the most important organ in our body, as it protects us from external environmental effects. The study of the ability of the skin to stretch and the histological examinations of irradiated tissues have significant values in scientific and medical applications. Only a few studies have been done to study the correlation between epidermis ablation and the changes that occur at dermal levels when using dual lasers in ablative resurfacing mode. The aim of this work is to determine this correlation and to estimate the effects of multiple pulses on induced collagen remodelling and the strength of skin exposed with dual lasers in an in vivo rat model. All laser exposures led to marked improvements in the skin's strength compared to their own controls. The histological investigation indicated that there was a thickness loss in the epidermis layer with the induction of deep collagen coagulation in the dermis layer as the dual laser pulses increased. Additionally, more collagen fibres were remoulded in the treated samples by dual wavelengths. We conclude that by combining dual lasers with multiple pulses targeted at not only the epidermis layer of the skin, it could also induce some heat diffusion in the dermis layer which causes more coagulation of collagen fibres. The tensile results confirmed by our histological data demonstrates that the strength of irradiated skin with dual wavelengths increased more than using both lasers separately on the skin tissue since more collagen is induced. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-18T05:22:00.861954-05:
      DOI: 10.1111/php.12369
       
  • Oxidatively generated damage to cellular DNA by UVB and UVA radiation
    • Authors: Jean Cadet; Thierry Douki, Jean‐Luc Ravanat
      Pages: n/a - n/a
      Abstract: This review article focuses on a critical survey of the main available information on the UVB and UVA oxidative reactions to cellular DNA as the result of direct interactions of UV photons, photosensitized pathways and biochemical responses including inflammation and bystander effect. UVA radiation appears to be much more efficient than UVB in inducing oxidatively generated damage to the bases and 2‐deoxyribose moieties of DNA in isolated cells and skin. The UVA‐induced generation of 8‐oxo‐7,8‐dihydroguanine is mostly rationalized in terms of selective guanine oxidation by singlet oxygen generated through type II photosensitization mechanism. In addition, hydroxyl radical whose formation may be accounted for by metal‐catalyzed Haber‐Weiss reactions subsequent to the initial generation of superoxide anion radical contributes in a minor way to the DNA degradation. This leads to the formation of both oxidized purine and pyrimidine bases together with DNA single strand breaks at the exclusion however of direct double strand breaks. No evidence has been provided so far for the implication of delayed oxidative degradation pathways of cellular DNA. In that respect putative characteristic UVA‐induced DNA damage could include single and more complex lesions arising from one‐electron oxidation of the guanine base together with aldehyde adducts to amino‐substituted nucleobases. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-18T05:21:59.199749-05:
      DOI: 10.1111/php.12368
       
  • Photoisomerization of
           cis‐1,2‐di(1‐Methyl‐2‐naphthyl)ethene at 77
           K in Glassy Media
    • Authors: Christopher Redwood; V. K. Ratheesh Kumar, Stuart Hutchinson, Frank B. Mallory, Clelia W. Mallory, Ronald J. Clark, Olga Dmitrenko, Jack Saltiel
      Pages: n/a - n/a
      Abstract: cis‐1,2‐Di(1‐methyl‐2‐naphthyl)ethene, c‐1,1, undergoes photoisomerization in methylcyclohexane, isopentane and diethyl ether/isopentane/ethanol glasses at 77 K. On 313 nm excitation the fluorescence of c‐1,1 is replaced by fluorescence from t‐1,1. Singular value decomposition reveals that the spectral matrices behave as two component systems suggesting conversion of a stable c‐1,1 conformer to a stable t‐1,1 conformer. However, the fluorescence spectra are λexc dependent. Analysis of global spectral matrices shows that c‐1,1 is a mixture of two conformers each of which gives one of four known t‐1,1 conformers. The λexc dependence of the c‐1,1 fluorescence spectrum is barely discernible. Structure assignments to the resolved fluorescence spectra are based on the principle of least motion and on calculated geometries, energy differences and spectra of the conformers. The relative shift of the c‐1,1 conformer spectra is consistent with the shift of the calculated absorption spectra. The calculated structure of the most stable conformer of c‐1,1 agrees well with the X‐ray crystal structure. Due to large deviations of the naphthyl groups from the ethenic plane in the conformers of both c‐ and t‐1,1 isomers, minimal motion of these bulky substituents accomplishes cis → trans interconversion by rotation about the central bond. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-18T05:21:57.559828-05:
      DOI: 10.1111/php.12367
       
  • N4‐Methylation of cytosine drastically favors the formation of
           (6–4) photoproducts in a TCG context
    • Authors: Thierry Douki; Jarah A. Meador, Izabel Bérard, Aude Wack
      Pages: n/a - n/a
      Abstract: Methylation of cytosine is a common biological process both in prokaryotic and eukaryotic cells. In addition to 5–methylcytosine (5mC), some bacterial species contain in their genome N4–methylcytosine (N4mC). Methylation at C5 has been shown to enhance the formation of pyrimidine dimeric photoproducts but nothing is known of the effect of N4 methylation on UV‐induced DNA damage. In the present work, we compared the yield and the nature of bipyrimidine photoproducts induced in a series of trinucleotides exhibiting a TXG sequence where X is either T, C, 5mC or N4mC. HPLC associated to tandem mass spectrometry was used to quantify cyclobutane pyrimidine dimers (CPD), (6‐4) photoproducts (64PP) and their Dewar valence isomer. Methylation at position N4 was found to drastically increase the reactivity of C upon exposure to both UVC and UVB and to favor the formation of 64PP. In contrast methylation at C5 increased the yield of CPD at the expense of 64PP. In addition, enhancement of photoreactivity by C5 methylation was much higher in the UVB than in the UVC range. These results show the drastic effect of the methylation site on the photochemistry of cytosine. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-15T10:42:04.717219-05:
      DOI: 10.1111/php.12365
       
  • Solar UV Irradiances Modulate Effects of Ocean Acidification on the
           Coccolithophorid Emiliania huxleyi
    • Authors: Kai Xu; Kunshan Gao
      Pages: n/a - n/a
      Abstract: Emiliania huxleyi, the most abundant coccolithophorid in the oceans, is naturally exposed to solar UV radiation (UVR, 280‐400 nm) in addition to photosynthetically active radiation (PAR). We investigated the physiological responses of E. huxleyi to present‐day and elevated CO2 (390 vs 1000 μatm; with pHNBS 8.20 vs 7.86) under indoor constant PAR and fluctuating solar radiation with or without UVR. Enrichment of CO2 stimulated the production rate of particulate organic carbon (POC) under constant PAR, but led to unchanged POC production under incident fluctuating solar radiation. The production rates of particulate inorganic carbon (PIC) as well as PIC/POC ratios were reduced under the elevated CO2, ocean acidification (OA) condition, regardless of PAR levels and the presence of UVR. However, moderate levels of UVR increased PIC production rates and PIC/POC ratios. OA treatment interacted with UVR to influence the alga's physiological performance, leading to reduced specific growth rate in the presence of UVA (315‐400 nm) and decreased quantum yield, along with enhanced non‐photochemical quenching, with addition of UVB (280‐315 nm). The results clearly indicate that UV radiation needs to be invoked as a key stressor when considering the impacts of ocean acidification on E. huxleyi. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-15T10:41:52.568895-05:
      DOI: 10.1111/php.12363
       
  • Recent Advances in the Application of Chlorophyll a Fluorescence from
           Photosystem II
    • Authors: Ya Guo; Jinglu Tan
      Pages: n/a - n/a
      Abstract: In the photosynthesis process, part of the absorbed photon energy in photosystem II (PSII) may be re‐emitted as chlorophyll a fluorescence (ChlF). Environmental and plant physiological changes affect the emission of ChlF, which makes ChlF a potentially useful tool to sense these changes. Volumes of research on ChlF are published each year and some published work has been controversial. In order to facilitate the application of ChlF, it is important to have a holistic picture of the field. This review summarizes ChlF applications published in the last 10 years. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-14T11:59:22.095521-05:
      DOI: 10.1111/php.12362
       
  • DNA damage checkpoint responses in the S phase of synchronized diploid
           human fibroblasts
    • Authors: Paul D. Chastain; Bruna P. Brylawski, Yingchun C. Zhou, Shangbang Rao, Haitao Chu, Joseph G. Ibrahim, William K. Kaufmann, Marila Cordeiro‐Stone
      Pages: n/a - n/a
      Abstract: We investigated the hypothesis that the strength of the activation of the intra‐S DNA damage checkpoint varies within the S phase. Synchronized diploid human fibroblasts were exposed to either 0 or 2.5 J/m2 UVC in early, mid‐ and late‐S phase. The endpoints measured were the following: (I) radio‐resistant DNA synthesis (RDS), (II) induction of Chk1 phosphorylation, (III) initiation of new replicons, and (IV) length of replication tracks synthesized after irradiation. RDS analysis showed that global DNA synthesis was inhibited by approximately the same extent (30±12%), regardless of when during S phase the fibroblasts were exposed to UVC. Western blot analysis revealed that the UVC‐induced phosphorylation of Chk1 on serine 345 was high in early and mid S but 10‐fold lower in late S. DNA fiber immunostaining studies indicated that the replication fork displacement rate decreased in irradiated cells at the three time points examined; however, replicon initiation was inhibited strongly in early and mid S, but this response was attenuated in late S. These results suggest that the intra‐S checkpoint activated by UVC‐induced DNA damage is not as robust toward the end of S phase in its inhibition of the latest firing origins in human fibroblasts. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-14T11:43:28.655937-05:
      DOI: 10.1111/php.12361
       
  • Electronic Interactions of Michler's Ketone with DNA Bases in Synthetic
           Hairpins
    • Authors: Almaz S. Jalilov; Ryan M. Young, Samuel W. Eaton, Michael R. Wasielewski, Frederick D. Lewis
      Pages: n/a - n/a
      Abstract: The mechanism and dynamics of photoinduced electron transfer in two families of DNA hairpins possessing Michler's Ketone linkers have been investigated by means of steady state and time‐resolved transient absorption and emission spectroscopies. The excited state behavior of the diol linker employed in hairpin synthesis is similar to that of Michler's ketone in methanol solution. Hairpins possessing only a Michler's ketone linker undergo fast singlet state charge separation and charge recombination with an adjacent purine base, attributed to well‐stacked ground state conformations, and intersystem crossing to the triplet state, attributed to poorly‐stacked ground state conformations. The failure of the triplet to undergo electron transfer reactions on the 7 ns time scale of our measurements is attributed to the low triplet energy and reduction potential of the twisted triplet state. Hairpins possessing both a Michler's ketone linker and a perylenediimide base surrogate separated by four base pairs undergo photoinduced hole transport from the diimide to Michler's ketone upon excitation of the diimide. The efficiency of hole transport is dependent upon the sequence of the intervening purine bases. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-08T10:41:22.009619-05:
      DOI: 10.1111/php.12360
       
  • Oculocutaneous Albinism in Sub‐Saharan Africa: Adverse
           Sun‐Associated Health Effects and Photoprotection
    • Authors: Caradee Y. Wright; Mary Norval, Richard W. Hertle
      Pages: n/a - n/a
      Abstract: Oculocutaneous albinism (OCA) is a genetically inherited autosomal recessive condition. Individuals with OCA lack melanin and therefore are susceptible to the harmful effects of solar ultraviolet radiation, including extreme sun sensitivity, photophobia and skin cancer. OCA is a grave public health issue in sub‐Saharan Africa with a prevalence as high as 1 in 1 000 in some tribes. This article considers the characteristics and prevalence of OCA in sub‐Saharan African countries. Sun‐induced adverse health effects in the skin and eyes of OCA individuals are reviewed. Sun exposure behaviour and the use of photoprotection for the skin and eyes are discussed to highlight the major challenges experienced by these at‐risk individuals and how these might be best resolved. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-08T10:41:07.506343-05:
      DOI: 10.1111/php.12359
       
  • Interspecific Variation in the Repair of UV Damaged DNA in the Genus
           Xiphophorus as a Factor in the Decline of the Rio Grande Platyfish
    • Authors: David Mitchell; Lakshmi Paniker, Kevin Lin, André Fernandez
      Pages: n/a - n/a
      Abstract: The fish genus Xiphophorus consists of 26 species distributed along the eastern slopes of mountain ranges extending from northern Mexico to Belize and Nicaragua. We analyzed light‐dependent repair of UV‐induced DNA damage in at least two species from each of the four monophyletic Xiphophorus groups. We found that the northern platyfish had significantly reduced photoenzymatic repair compared to the other three groups, including the northern swordtails, southern platyfish and southern swordtails. All of the species of the platyfish, including the Marbled (meyeri), Northern (gordoni) and Monterrey Platyfish (couchianus) are the northernmost species in the genus and are the only three species in the genus that are currently found on the IUCN Red List of Threatened Species. Satellite data from the past 30 years (1979‐2008) correlates greater increases in shorter wavelength UVB with higher latitudes within the Xiphophorus range. We suggest that, combined with other consequences of human population growth, anthropogenic deozonation resulting in a disproportionate increase in UVB in temperate latitudes may be a contributing factor in the decline and extirpation of the northern platyfish. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-08T10:40:55.879868-05:
      DOI: 10.1111/php.12358
       
  • Photostability of Cosmetic UV Filters on Mammalian Skin Under UV Exposure
    • Authors: Constanze Stiefel; Wolfgang Schwack, Yen‐Thi Hai Nguyen
      Pages: n/a - n/a
      Abstract: Previous studies showed that the common UV filter substances benzophenone‐3 (BP–3), butyl methoxydibenzoylmethane (BM–DBM), octocrylene (OCR), ethylhexyl methoxycinnamate (EHMC), ethylhexyl salicylate (EHS), and ethylhexyl triazone (EHT) were able to react with amino side chains of different proteins in vitro. To transfer the results to mammalian skin conditions, sunscreen products were applied on both prepared fresh porcine skin and glass plates, followed by UV irradiation and the determination of depletion of the respective UV filters. Significantly lower recoveries of the UV filters extracted from skin samples than from glass plates indicated the additional reaction of the UV filters with skin constituents, when proteins will be the most important reactants. Among the products tested, BP‐3 showed the greatest differences in recoveries between glass and skin samples of about 13% and 24% after 2 and 4 h of irradiation, respectively, followed by EHS > BM‐DBM > OCR > EHMC > EHT. The obtained results raise the question, whether the common in vitro evaluations of sunscreens, using inert substrate materials like roughened quartz or polymethyl methacrylate (PMMA) plates are really suitable to fully replace in vivo methods, since they cannot include skin‐typical reactions. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-05T06:23:21.603512-05:
      DOI: 10.1111/php.12357
       
  • Inspection of Feasible Calibration Conditions for UV Radiometer Detectors
           with the KI/KIO3 Actinometer
    • Authors: Zhimin Qiang; Wentao Li, Mengkai Li, James R. Bolton, Jiuhui Qu
      Pages: n/a - n/a
      Abstract: UV radiometers are widely employed for irradiance measurements, but their periodical calibrations not only induce an extra cost but also are time‐consuming. In this study, the KI/KIO3 actinometer was applied to calibrate UV radiometer detectors at 254 nm with a quasi‐collimated beam apparatus equipped with a low‐pressure UV lamp, and feasible calibration conditions were identified. Results indicate that a washer constraining the UV light was indispensable, while the size (10 or 50 mL) of a beaker containing the actinometer solution had little influence when a proper washer was used. The absorption or reflection of UV light by the internal beaker wall led to an underestimation or overestimation of the irradiance determined by the KI/KIO3 actinometer, respectively. The proper range of the washer internal diameter could be obtained via mathematical analysis. A radiometer with a longer service time showed a greater calibration factor. To minimize the interference from the inner wall reflection of the collimating tube, calibrations should be conducted at positions far enough away from the tube bottom. This study demonstrates that after the feasible calibration conditions are identified, the KI/KIO3 actinometer can be applied readily to calibrate UV radiometer detectors at 254 nm. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-05T06:23:07.803221-05:
      DOI: 10.1111/php.12356
       
  • Photoactive chitosan: A step towards a green strategy for pollutant
           degradation
    • Authors: Niluksha Walalawela; Alexander Greer
      Pages: n/a - n/a
      Abstract: This article is a highlight of the paper by Ferrari et al. in this issue of Photochemistry and Photobiology. It describes the innovative use of rose bengal‐conjugated chitosan as a reusable green catalyst that photo‐degrades phenolic compounds in aqueous media, and thereby has decontamination potential of polluted waters. Whether a next‐generation photoactive polymer that produces singlet oxygen is a solution to pollutant degradation can be argued. It is as yet unclear what polymeric sensitizer would be practical on a large scale. Nonetheless pursuing this goal is worthwhile. This article is protected by copyright. All rights reserved.
      PubDate: 2014-10-01T01:37:42.714394-05:
      DOI: 10.1111/php.12355
       
  • Opsin Expression in Human Epidermal Skin
    • Authors: Kirk Haltaufderhyde; Rana N. Ozdeslik, Nadine L. Wicks, Julia A. Najera, Elena Oancea
      Pages: n/a - n/a
      Abstract: Human skin is constantly exposed to solar light containing visible and ultraviolet radiation (UVR), a powerful skin carcinogen. UVR elicits cellular responses in epidermal cells via several mechanisms: direct absorption of short wavelength UVR photons by DNA, oxidative damage caused by long wavelength UVR, and, as we recently demonstrated, via a retinal‐dependent G protein‐coupled signaling pathway. Because the human epidermis is exposed to a wide range of light wavelengths, we investigated whether opsins, light‐activated receptors that mediate photoreception in the eye, are expressed in epidermal skin to potentially serve as photosensors. Here we show that four opsins — OPN1‐SW, OPN2, OPN3 and OPN5 — are expressed in the two major human epidermal cell types, melanocytes and keratinocytes, and the mRNA expression profile of these opsins does not change in response to physiological UVR doses. We detected two OPN3 splice variants present in similar amounts in both cell types and three OPN5 splice isoforms, two of which encode truncated proteins. Notably, OPN2 and OPN3 mRNA were significantly more abundant than other opsins and encoded full‐length proteins. Our results demonstrate that opsins are expressed in epidermal skin cells and suggest that they might initiate light‐induced signaling pathways, possibly contributing to UVR phototransduction. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-30T05:57:43.835219-05:
      DOI: 10.1111/php.12354
       
  • Comparison of Templating Abilities of Urea and Thioruea During
           Photodimerization of Bipyridylethyelene and Stilbazole Crystals
    • Authors: Balakrishna R. Bhogala; Burjor Captain, V. Ramamurthy
      Pages: n/a - n/a
      Abstract: Photodimerization of co‐crystals of four bispyridylethylenes and two stilbazoles with urea as a template in the solid state has been investigated following our success with thiourea. Four investigated olefins photodimerized quantitatively to a single dimer in the crystalline state only. The reactivity of urea‐olefin crystals is understood on the basis of their packing arrangements in the crystalline state. In reactive crystals the adjacent reactive molecules are within 4.2 Å and parallel, while the unreactive ones have their adjacent molecules are farther than 4.6Å and non‐parallel. Thus, with the knowledge of crystal packing the reactivity of urea‐olefin crystals is predictable on the basis of Schmidt's topochemical postulates. The templating property of urea, similar to thiourea, derives from its ability to form hydrogen bonds with itself and the guest olefins. Despite the similarities in molecular structures of urea and thiourea their subtle electronic properties, yet to be fully understood, affect the crystal packing and consequently their reactivity in the crystalline state. Further work is needed to fully exploit the templating properties of urea. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-28T21:12:25.943849-05:
      DOI: 10.1111/php.12353
       
  • Highly efficient Photodegradation of Organic Pollutants Assisted by
           Sonoluminescence
    • Authors: Anna V. Volkova; Silke Nemeth, Ekaterina V. Skorb, Daria V. Andreeva
      Pages: n/a - n/a
      Abstract: The mechanism of the photodegradation of azo dyes via ultrasonication is studied using a combination of the high‐performance liquid chromatography and UV‐vis spectroscopy with detailed analysis of the process kinetics. Based on the kinetics studies of the sonodegradation process it was proposed that the sonodegradation of azo dyes was a multistage process that involved: i) the direct attack of azo bonds and phenyl rings of dyes by the sonochemically formed reactive oxygen species; ii) the activation of semiconductor particles by the light emitted during cavitation and the triggering of the photocatalytic pathways of dye degradation; iii) increase of the adsorption capacity of the semiconductor particles due to the sono mechanically induced inter particle collisions. The detailed kinetics study can help in following an effective process up‐scaling. It was demonstrated that extremely short pulses of light flashes in a cavitated mixture activated the surface of photocatalysts and significantly enhanced dye degradation processes. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-26T05:42:46.445568-05:
      DOI: 10.1111/php.12352
       
  • Interleukin‐17 Mediated Inflammatory Responses Are Required for
           Ultraviolet Radiation Induced Immune Suppression;
    • Authors: Hui Li; Ram Prasad, Santosh K. Katiyar, Nabiha Yusuf, Craig A. Elmets, Hui Xu
      Pages: n/a - n/a
      Abstract: Ultraviolet radiation (UVR) induces immunosuppression and is a major factor for development of skin cancer. Numerous efforts have been made to determine mechanisms for UVR induced immunosuppression and to develop strategies for prevention and treatment of UVR induced cancers. In the current study, we use IL‐17 receptor (IL‐17R) deficient mice to examine whether IL‐17 mediated responses have a role in UVB (290‐320) induced immunosuppression of contact hypersensitivity responses. Results demonstrate that IL‐17 mediated responses are required for UVB induced immunosuppression of contact hypersensitivity responses. The systemic immune suppression and development of regulatory T cells are inhibited in UVB treated IL‐17R deficient mice compared to wild type animals. The deficiency in IL‐17R inhibits the infiltration and development of a tolerogenic myeloid cell population in UVB treated skin, which expresses CD11b and Gr‐1 and produces reactive oxygen species. We speculate that the development of the tolerogenic myeloid cells is dependent on IL‐17 induced chemokines and inflammatory mediators in UVB treated skin. The inhibition of the tolerogenic myeloid cells may be attributed to the suppression of regulatory T cells in UVR treated IL‐17R‐/‐ mice. The findings may be exploited to new strategies for prevention and treatment of UVR induced skin diseases and cancers. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-23T10:18:18.213881-05:
      DOI: 10.1111/php.12351
       
  • The employment of a removable chitosan‐derivatized polymeric
           sensitizer in the photooxidation of polyhydroxylated
           water‐pollutants
    • Authors: Gabriela V. Ferrari; María E. Andrada, José Natera, Vanesa A. Muñoz, M. Paulina Montaña, Carolina Gambetta, María L Boiero, Mariana A. Montenegro, Walter A. Massad, Norman A. García
      Pages: n/a - n/a
      Abstract: The known O2(1Δg)‐sensitizer system Chitosan bounded Rose Bengal (CH‐RB), with Rose Bengal (RB) immobilized by irreversible covalent bonding to the polymer Chitosan (CH), soluble in aquous acidic medium, was employed in the photodegradation of three tri‐hydroxy benzene water‐contaminants (THBs). The system sensitizes the O2(1Δg)‐mediated photodegradation of THBs by a process kinetically favored, as compared to that employing free RB dissolved in the same solvent. Additionally the free xanthene dye, degradable by O2(1Δg) through self‐sensitization upon prolonged light‐exposure, is considerably protected when bonded to CH‐polymer. The polymeric sensitizer, totally insoluble in neutral medium, can be removed from the solution after the photodegradative cycle by precipitation through a simple pH change. This fact constitutes an interesting aspect in the context of photoremediation of confined polluted waters. In other words, the sensitizing system could be useful for avoiding to dissolve dyestuffs in the polluted waters, in order to act as conventional sunlight‐absorbing dye‐sensitizers. In parallel the interaction CH ‐ O2(1Δg) in acidic solution was evaluated. The polymer quenches the oxidative species with a rate constant 2.4x108 M−1s−1 being the process mostly attributable to a physical interaction. This fact promotes the photoprotection of the bonded dye in the CH‐RB polymer. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-20T09:11:29.130189-05:
      DOI: 10.1111/php.12350
       
  • Sun Exposure and Vitamin D Status as Northeast Asian Migrants Become
           Acculturated to Life in Australia
    • Authors: Shuyu Guo; Peter Gies, Kerryn King, Robyn M Lucas
      Pages: n/a - n/a
      Abstract: Vitamin D deficiency is more common in Northeast‐Asian immigrants to western countries than in the local population; prevalence equalizes as immigrants adopt the host country's culture. In a community‐based study of 100 Northeast‐Asian immigrants in Canberra, Australia, we examined predictors of vitamin D status, its association with indicators of acculturation (English language use; time since migration) and mediators of that association. Participants completed a sun and physical activity diary and wore an electronic ultraviolet radiation (UVR) dosimeter for 7 days. Skin colour was measured by reflectance spectrophotometry. Serum concentrations of 25‐hydroxyvitamin D (25(OH)D) and cardio‐metabolic biomarkers were measured on fasting blood. In a multiple linear regression model, predictors for 25(OH)D concentration were season of blood collection, vitamin D supplementation, UVR exposure, body mass index, physical activity and having private health insurance (R2=0.57). Greater acculturation was associated with lower risk of vitamin D deficiency (de‐seasonalized 25(OH)D level 5.0mmol/L) (AOR: 7.48 (95%CI 1.51‐37.0)). Targeted public health approaches are required to manage the high prevalence of vitamin D deficiency in migrants retaining a traditional lifestyle. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-20T00:39:58.163801-05:
      DOI: 10.1111/php.12349
       
  • Skin Responses to Micro Scale Field Size of Solar‐Simulated
           Radiation – Preliminary Evaluation by Reflectance Confocal
           Microscopy in vivo
    • Authors: InSeok Seo; Melissa Chu, Paulo R. Bargo, Nikiforos Kollias
      Pages: n/a - n/a
      Abstract: Erythema and pigment responses of human skin following an acute exposure to ultraviolet radiation (UVR) are frequently used to determine the photosensitivity of the skin. In this study we investigated the responses of the skin to a micro‐scale area of UVR exposure (MiR) and compared the responses to a macro‐scale area of exposure (MaR). Ten human volunteers were tested with solar‐simulated radiation on their upper arm or back using a beam size of 8mm and 0.2mm in diameter. The fluence required to produce a minimally perceptible erythema (MED) using the MiR was found to be higher than that for the MaR. The erythema response extended beyond the exposed area and this became pronounced when the beam size was microscopic. Reflectance confocal microscopy in vivo revealed that MiR induced cellular alterations within a confined area of smaller dimensions than the area of exposure. Pigment responses were confined within the areas of cellular damage. The erythema expression of exposed skin recovered faster for the sites receiving MiR even when the applied fluence was higher than the MED for the MaR. Through the use of MiR we were able to visualize spatially dissimilar skin responses of erythema and pigmentation suggesting different cellular mechanisms. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-20T00:39:43.036009-05:
      DOI: 10.1111/php.12348
       
  • Improving Photoprotection Attitudes in the Tropics: Sunburn vs Vitamin D
    • Authors: Abel A. Silva
      Pages: n/a - n/a
      Abstract: The ultraviolet radiation of type B (the UVB) stimulates both the production of vitamin D (VD) and the incorporation of erythema dose (ED). The UVA also contributes to ED. The turning point between the benefit of producing VD and the harm of incorporating ED cannot be determined easily. However, the casual behavior regarding the exposure to the Sun can be changed in order to improve the protoprotection attitudes and create a trend towards benefit. In the case, people living in the low latitudes should exposure themselves to the Sun for a determined time interval within the noon time and avoid the Sun in other periods. This would produce an adequate amount of VD through the VD dose (207‐214 J/m2) against minimum ED (≈ 105 J/m2) for skin type II. For it, unprotected forearms and hands must be exposed to the noon Sun (cloudless) for 11 min (winter) and 5 min (summer). The exposure at other times different from noon can represent increases of up to 24% in ED and up to 12 times in the time interval to be in the Sun in relation to the minimum amounts of both ED and time interval at noon. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-20T00:39:35.875264-05:
      DOI: 10.1111/php.12347
       
  • MicroRNAs and Photocarcinogenesis
    • Authors: Deeba N. Syed; Rahul K. Lall, Hasan Mukhtar
      Pages: n/a - n/a
      Abstract: As a new class of sequence‐specific regulators of gene expression, the microRNAs (miRNA) form a regulatory network with growth factors and transcription factors participating in various biological processes. It is now being recognized that the various key processes involved in cancer induction are under the control of these small non‐coding RNAs, which regulate ~30% of all human genes by targeting sequences in their 3′‐untranslated regions. Photocarcinogenesis is a complex interplay of signaling events in the UV exposed human skin including DNA damage and repair, apoptosis, cell survival, mutations and the immune system. In this review, we have scrutinized the role of miRNAs in skin cancer biology focusing on the three most common types of skin cancer namely the basal cell carcinoma, squamous cell carcinoma and cutaneous malignant melanoma. An overview of these studies will be useful in gaining insights into the mechanisms of cancer development in the human skin. A better understanding of the functionality of miRNAs will have enormous implications to risk assessment, and to target interventions against signaling events involved in photocarcinogenesis. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-16T19:50:11.367591-05:
      DOI: 10.1111/php.12346
       
  • Forty Years of Research on Xeroderma Pigmentosum at the US National
           Institutes of Health
    • Authors: Kenneth H. Kraemer; John J. DiGiovanna
      Pages: n/a - n/a
      Abstract: In 1968, Dr. James Cleaver reported defective DNA repair in cultured cells from patients with xeroderma pigmentosum. This link between clinical disease and molecular pathophysiology has sparked interest in understanding not only the clinical characteristics of sun sensitivity, damage and cancer that occurred in XP patients but also the mechanisms underlying the damage and repair. While affected patients are rare, their exaggerated UV damage provides a window into the workings of DNA repair. These studies have clarified the importance of a functioning DNA repair system to the maintenance of skin and neurologic health in the general population. Understanding the role of damage in causing cancer, neurologic degeneration, hearing loss and internal cancers provides an opportunity for prevention and treatment. Characterizing complementation groups pointed to the importance of different underlying genes. Studying differences in cancer age of onset and underlying molecular signatures in cancers occurring either in XP patients or the general population has led to insights into differences in carcinogenic mechanisms. The accelerated development of cancers in XP has been used as a model to discover new cancer chemopreventive agents. An astute insight can be a “tipping point” triggering decades of productive inquiry. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-15T03:16:16.941709-05:
      DOI: 10.1111/php.12345
       
  • The Effects of NO3‐ Supply on Mazzaella laminarioides (Rhodophyta,
           Gigartinales) from Southern Chile
    • Authors: Nelso P. Navarro; Félix L. Figueroa, Nathalie Korbee, Andrés Mansilla, Betty Matsuhiro, Tamara Barahona, Estela M. Plastino
      Pages: n/a - n/a
      Abstract: The effects of nitrate supply on growth, pigments, mycosporine‐like amino acids (MAAs), C:N ratios, and carrageenan yield were investigated in Mazzaella laminarioides cultivated under solar radiation. This species is economically important in southern Chile where an increase of nitrogen in coastal waters is expected as a consequence of salmon aquaculture activity. Apical segments were cultivated in enriched seawater with five different NO3− concentrations (0, 0.09, 0.18, 0.38, and 0.75 mM) during 18 days. Although phycoerythrin and phycocyanin content, as well as C:N ratios, were reduced in the control treatment (without NO3− supply), when compared to NO3‐ treatments, total MAA concentration, carrageenan yield, and growth rates were similar in all tested conditions. Nevertheless, during the experiment, an important synthesis of mycosporine‐glycine took place in a nitrate concentration‐dependent manner, with accumulation being saturated around 0.18 mM of nitrate. These results indicate that exposure to high NO3− concentration of more than 100 times the values observed in the nature did not impair the photoprotection system, as determined by MAAs, nor did it have a deleterious effect on growth or carrageenan yield of M. laminarioides, a late successional species from Chile. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-11T11:17:33.355365-05:
      DOI: 10.1111/php.12344
       
  • Development of refractoriness of HO‐1 induction to a second
           treatment with UVA radiation and the involvement of Nrf2 in human skin
           fibroblasts
    • Authors: Julia Li Zhong; Chintan M. Raval, Muhammad Farrukh Nisar, ChunXiang Bian, Jin Zhang, Li Yang, Rex M. Tyrrell
      Pages: n/a - n/a
      Abstract: UVA treatment of cultured human skin fibroblasts (FEK4) has been shown previously to reduce transcriptional activation of hemeoxygenase 1 (HO‐1) following a second dose of UVA radiation, a phenomenon known as refractoriness. This study demonstrates that the levels of HO‐1 protein are also reduced after a second dose of UVA radiation as are Nrf2 levels, and there is less accumulation of Nrf2 in the nucleus where as Bach1 does accumulate in the nucleus. Cell viability is further reduced and cell membrane damage increased as compared with a single UVA treatment when an initial UVA treatment was followed by a second dose. Knockdown of Nrf2 by siRNA (siNrf2) targeting caused additional refractoriness of HO‐1 protein induction to a second UVA or heme treatment and this treatment also further enhanced cell damage by a second dose of UVA radiation. However, transfection with Nrf2 caused less refractoriness of HO‐1 to a second dose of UVA and reduced cell damage by a second dose of UVA radiation. These findings are consistent with the proposal that Nrf2 is involved in HO‐1 refractoriness and could serve as a cytoprotective factor against cell damage caused by repeated exposure to moderate doses of UVA radiation. We propose that protection by the Nrf2‐HO‐1 pathway protection may have clinical relevance since human skin is exposed repeatedly to UVA radiation. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-11T11:17:10.201108-05:
      DOI: 10.1111/php.12343
       
  • UVA irradiation induced heme oxygenase‐1 (HO‐1): A novel
           phototherapy for morphea
    • Authors: Muhammad Farrukh Nisar; Kimberly Suzanne George Parsons, Chun Xiang Bian, Julia Li Zhong
      Pages: n/a - n/a
      Abstract: Long wave UVA radiation (340‐400 nm) causes detrimental as well as beneficial effects on human skin. Studies of human skin fibroblasts irradiated with UVA demonstrate increased expression of both anti‐fibrotic heme oxygenase‐1 (HO‐1) and matrix metalloproteinase 1 (MMP‐1). The use of UVA ‐induced MMP‐1 is well studied in treating skin fibrotic conditions such as localised scleroderma, now called morphea. However, the role that UVA‐induced HO‐1 plays in phototherapy of morphea has not been characterized. In the present manuscript, we have illustrated and reviewed the biological function of HO‐1 and the use of UVA1 wavebands (340‐400 nm) for phototherapy; the potential use of HO‐1 induction in UVA therapy of morphea is also discussed. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-10T07:22:05.461981-05:
      DOI: 10.1111/php.12342
       
  • Photo‐Wolff Rearrangement of
           2‐Diazo‐1,2‐naphthoquinone: Stern–Volmer Analysis
           of the Stepwise Reaction Pathway;
    • Authors: Manfred Ladinig; Markus Ramseier, Jakob Wirz
      Pages: n/a - n/a
      Abstract: 2‐Diazo‐1,2‐naphthoquinone (1) and its derivatives are the photoactive components in Novolak photoresists. A femtosecond infrared study has established that the photoreaction of 1 proceeds largely by a concerted Wolff‐rearrangement yielding the ketene 1H‐inden‐1‐ylidene‐methanone (3) within 300 fs after excitation, but earlier trapping studies gave evidence for a minor reaction path via a carbene intermediate 1‐oxo‐2(1H)‐naphthalenylidene (2) with a lifetime of about 10 ps. Here, we provide a quantitative assessment of the stepwise pathway by Stern–Volmer analysis of the trapping of 2 by methanol to yield 2‐methoxy‐1‐naphthol (4). We conclude that the lifetime of the carbene 2 is at least 200 ps. Moreover, [3+2]cycloaddition of 2 and acetonitrile yielding 2‐methylnaphth[2,1‐d]oxazole (5) was observed. A comparison of the yields of 5 formed upon photolysis and upon thermolysis of 1 in acetonitrile provides evidence that a substantial part of the hot nascent carbene 2 formed photolytically rearranges to the ketene 3 during its vibrational relaxation (hot ground state reaction). This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-05T10:25:51.45167-05:0
      DOI: 10.1111/php.12341
       
  • Specific Features of the Early Stage of the Wound Healing Process
           Occurring Against the Background of Photodynamic Therapy Using Fotoditazin
           Photosensitizer‐Amphiphilic Polymer Complexes
    • Authors: Tatiana G. Rudenko; Anatoly B. Shekhter, Anna E. Guller, Nadezhda A. Aksenova, Nikolay N. Glagolev, Andrey V. Ivanov, Ruben K. Aboyants, Svetlana L. Kotova, Anna B. Solovieva
      Pages: n/a - n/a
      Abstract: There is a growing demand on the studies of the wound healing potentials of photodynamic therapy. Here we analyze the effects of Fotoditazin, an e6 chlorine derivative, and its complexes with amphiphilic polymers, on the early stage of wound healing in a rat model. A skin excision wound model with prevented contraction was developed in male albino rats divided into 8 groups according to the treatment mode. All animals received injections of one of the studied compositions into their wound beds and underwent low intensity laser irradiation or stayed un‐irradiated. The clinical monitoring and histological examination of the wounds were performed. It has been found that all the Fotoditazin formulations have significant effects on the early stage of wound healing. The superposition of the inflammation and regeneration was the main difference between groups. The aqueous solution of Fotoditazin alone induced a significant capillary haemorrhage, while its combinations with amphiphilic polymers did not. The best clinical and morphological results were obtained for the Fotoditazin‐Pluronic F127 composition. Compositions of Fotoditazin and amphiphilic polymers, especially Pluronic F127, probably, have a great potential for therapy of wounds. Their effects can be attributed to the increased regeneration and suppressed reactions changes at the early stages of repair. This article is protected by copyright. All rights reserved.
      PubDate: 2014-09-03T01:25:53.682715-05:
      DOI: 10.1111/php.12340
       
  • Photocatalytic degradation of glyphosate in water by N–doped
           SnO2/TiO2 thin film coated glass fibers
    • Authors: Peerawas Kongsong; Lek Sikong, Sutham Niyomwas, Vishnu Rachpech
      Pages: n/a - n/a
      Abstract: Photocatalytic degradation of glyphosate contaminated in water was investigated. The N–doped SnO2/TiO2 films were prepared via sol–gel method, and coated on glass fibers by dipping method. The effects of nitrogen doping on coating morphology, physical properties, and glyphosate degradation rates were experimentally determined. Main variable was the concentration of nitrogen doping in range 0–40 mol%. Nitrogen doping results in shifting the absorption wavelengths and narrowing the band gap energy those lead to enhancement of photocatalytic performance. The near optimal 20N/SnO2/TiO2 composite thin film exhibited about 2 and 4 folds of glyphosate degradation rates compared to the undoped SnO2/TiO2 and TiO2 films when photocatalytic treatment were performed under UV and solar irradiations, respectively due to its narrowest band gap energy (optical absorption wavelength shifting to visible light region) and smallest crystallite size influenced by N doping. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-28T11:07:39.238249-05:
      DOI: 10.1111/php.12338
       
  • Fisetin inhibits UVB‐induced cutaneous inflammation and activation
           of PI3K/AKT/ NFκB signaling pathways in SKH‐1 hairless mice;
    • Authors: Harish Chandra Pal; Mohammad Athar, Craig A. Elmets, Farrukh Afaq
      Pages: n/a - n/a
      Abstract: Solar ultraviolet B (UVB) radiation has been shown to induce inflammation, DNA damage, p53 mutations, and alterations in signaling pathways eventually leading to skin cancer. In the present study, we investigated whether fisetin reduces inflammatory responses and modulates PI3K/AKT/NFκB cell survival signaling pathways in UVB exposed SKH‐1 hairless mouse skin. Mice were exposed to 180 mJ/cm2 of UVB radiation on alternate days for a total of seven exposures, and fisetin (250 and 500 nmol) was applied topically after 15 min of each UVB exposure. Fisetin treatment to UVB exposed mice resulted in decreased hyperplasia and reduced infiltration of inflammatory cells. Fisetin treatment also reduced inflammatory mediators such as COX‐2, PGE2 as well as its receptors (EP1‐ EP4), and MPO activity. Furthermore, fisetin reduced the level of inflammatory cytokines TNFα, IL‐1β and IL‐6 in UVB exposed skin. Fisetin treatment also reduced cell proliferation markers as well as DNA damage as evidenced by increased expression of p53 and p21 proteins. Further studies revealed that fisetin inhibited UVB‐induced expression of PI3K, phosphorylation of AKT, and activation of the NFκB signaling pathway in UVB exposed mouse skin. Overall, these data suggest that fisetin may be useful against UVB‐induced cutaneous inflammation and DNA damage. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-28T11:03:29.250842-05:
      DOI: 10.1111/php.12337
       
  • Simultaneous Irradiation with Different Wavelengths of Ultraviolet Light
           has Synergistic Bactericidal Effect on Vibrio parahaemolyticus
    • Authors: Mutsumi Nakahashi; Kazuaki Mawatari, Akiko Hirata, Miki Maetani, Takaaki Shimohata, Takashi Uebanso, Yasuhiro Hamada, Masatake Akutagawa, Yousuke Kinouchi, Akira Takahashi
      Pages: n/a - n/a
      Abstract: Ultraviolet (UV) irradiation is an increasingly used method of water disinfection. UV rays can be classified by wavelength into UVA (320–400 nm), UVB (280‐320 nm), and UVC (
      PubDate: 2014-08-28T06:58:03.637028-05:
      DOI: 10.1111/php.12309
       
  • Photocatalysis of chloroform decomposition by tetrachlorocuprate(II) on
           Dowex 2‐X8
    • Authors: Brent M. Harvey; Patrick E. Hoggard
      Pages: n/a - n/a
      Abstract: Heterogenized on a polystyrene anion exchange resin and in the presence of oxygen, CuCl42‐ catalyzes the photodecomposition of chloroform at wavelengths above 345 nm with greater efficiency than an equivalent amount in homogeneous solution. The reaction is proposed to proceed in two stages, the first stage yielding CCl4 and HO2ˉ as products, the second consisting of a chain reaction resulting from the CuCl42‐‐catalyzed photodissociation of CCl4, yielding phosgene with CCl3 radicals as chain carriers. Photodecomposition is retarded by added Clˉ, CH3CN, C6H12, and C2H5OH, which is ascribed to the displacement of CHCl3 molecules from the vicinity of the copper by attraction to the polystyrene matrix or to the alkylammonium cation sites. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-25T01:48:09.167989-05:
      DOI: 10.1111/php.12336
       
  • MC1R, Eumelanin and Pheomelanin: their role in determining the
           susceptibility to skin cancer;
    • Authors: Tahseen H. Nasti; Laura Timares
      Pages: n/a - n/a
      Abstract: Skin pigmentation is due to the accumulation of two types of melanin granules in the keratinocytes. Besides being the most potent blocker of ultraviolet radiation (UVR), the role of melanin in photo‐protection is complex. This is because one type of melanin called eumelanin is UV absorbent whereas the other, pheomelanin, is photo‐unstable and may even promote carcinogenesis. Skin hyperpigmentation may be caused by stress or exposure to sunlight, which stimulates the release of α‐melanocyte stimulating hormone (α‐MSH) from damaged keratinocytes. Melanocortin 1 receptor (MC1R) is a key signaling molecule on melanocytes that responds to α‐MSH by inducing expression of enzymes responsible for eumelanin synthesis. Persons with red hair have mutations in the MC1R causing its inactivation; this leads to a paucity of eumelanin production and makes red‐heads more susceptible to skin cancer. Apart from its effects on melanin production, the α‐MSH/MC1R signaling is also a potent anti‐inflammatory pathway and has been shown to promote anti‐melanoma immunity. This review will focus on the role of MC1R in terms of its regulation of melanogenesis and influence on the immune system with respect to skin cancer susceptibility. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-22T10:23:59.452431-05:
      DOI: 10.1111/php.12335
       
  • What Caused the Formation of the Absorption Maximum at 421 nm in vivo
           Spectra of Rhodopseudomonas palustris
    • Authors: Chungui Zhao; Huiying Yue, Qianru Cheng, Shicheng Chen, Suping Yang
      Pages: n/a - n/a
      Abstract: A spectral peak at ~421 nm appeared in vivo spectrum of Rhodopseudomonas palustris CQV97 cultured in acetate‐glutamate medium (M1) but not in acetate‐ammonium sulfate medium (M2). However, the spectral origin of 421 nm peak was unclear and frequently attributed to carotenoid component(s). In this study, comparative analysis of the extracted components showed that magnesium protoporphyrin IX monomethylester (MPE) was accumulated as one of the predominate components in M1 culture. The amounts of bacteriochlorophyll a in M1 culture were higher than that in M2 while the amounts of carotenoids were nearly identical in both cultures. A simple, rapid and minimum interference with carotenoid and bacteriochlorophyll method to efficiently extract the compounds involving in the formation of 421 nm peak was developed in this study. Assembly of purified MPE with protein components from R. palustris in vitro demonstrated that MPE caused the formation of 421 nm peak. The localization analysis in vivo demonstrated it is MPE associating to protein components and accounting for the peak at ~421 nm. This work clarified the 421 nm peak in vivo mainly originated from MPE accumulation, and will be very helpful to further explore the physiological roles of MPE or its derivatives in photosynthesis. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-22T10:23:42.936868-05:
      DOI: 10.1111/php.12334
       
  • Antitumor Effect of Sinoporphyrin sodium mediated Photodynamic Therapy on
           Human Esophageal Cancer Eca‐109 cells
    • Authors: Jianmin Hu; Xiaobing Wang, Quanhong Liu, Kun Zhang, Wenli Xiong, Chuanshan Xu, Pan Wang, Albert Wingnang Leung
      Pages: n/a - n/a
      Abstract: The aim of this study was to evaluate the photodynamic effect of Sinoporphyrin sodium (DVDMS). In this study, Eca‐109 cells were treated with DVDMS (5 μg/ml) and subjected to photodynamic therapy (PDT). The uptake and sub‐cellular localization of DVDMS were monitored by flow cytometry and confocal microscopy. The phototoxicity of DVDMS was studied by MTT assay. The morphological changes were observed by scanning electron microscopy (SEM). DNA damage, reactive oxygen species (ROS) generation and mitochondria membrane potential (MMP) changes were analyzed by flow cytometry. Studies demonstrated maximal uptake of DVDMS occurred within 3 hours, with a mitochondrial sub‐cellular localization. MTT assays displayed that DVDMS could be effectively activated by light and the phototoxicity was much higher than photofrin under the same conditions. In addition, SEM observation indicated that cells were seriously damaged after PDT treatment. Furthermore, activation of DVDMS resulted in significant increases in ROS production. The generated ROS played an important role in the phototoxicity of DVDMS. DVDMS mediated PDT (DVDMS‐PDT) also induced DNA damage and MMP loss. It is demonstrated that DVDMS mediated PDT is an effective approach on cell proliferation inhibition of Eca‐109 cells. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-20T07:08:45.390043-05:
      DOI: 10.1111/php.12333
       
  • Design of a Gd‐DOTA‐phthalocyanine conjugate combining
           MRI‐contrast imaging and photosensitization properties as a
           potential molecular theranostic
    • Authors: Duygu Aydın Tekdaş; Ruslan Garifullin, Berna Şentürk, Yunus Zorlu, Umut Gundogdu, Ergin Atalar, Ayse B. Tekinay, Alexander A. Chernonosov, Yusuf Yerli, Fabienne Dumoulin, Mustafa O. Guler, Vefa Ahsen, Ayşe Gül Gürek
      Pages: n/a - n/a
      Abstract: The design and synthesis of a phthalocyanine ‐ Gd‐DOTA conjugate is presented to open the way to novel molecular theranostics, combining the properties of MRI contrast imaging with photodynamic therapy. The rational design of the conjugate integrates isomeric purity of the phthalocyanine core substitution, suitable biocompatibility with the use of polyoxo water‐solubilizing substituents, and a convergent synthetic strategy ended by the use of click chemistry to graft the Gd‐DOTA moiety to the phthalocyanine. Photophysical and photochemical properties, contrast imaging experiments and preliminary in vitro investigations proved that such a combination is relevant and lead to a new type of potential theranostic agent. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-16T01:52:30.89027-05:0
      DOI: 10.1111/php.12332
       
  • Photodynamic inactivation of bacterial and yeast biofilms with a cationic
           porphyrin
    • Authors: Sandra Beirão; Sara Fernandes, Joel Coelho, Maria A. F. Faustino, João P. C. Tomé, Maria G. P. M. S. Neves, Augusto C. Tomé, Adelaide Almeida, Angela Cunha
      Pages: n/a - n/a
      Abstract: The efficiency of 5,10,15,20‐tetrakis(1‐methylpyridinium‐4‐yl)porphyrin tetra‐iodide (Tetra‐Py+‐Me) in the photodynamic inactivation of single‐species biofilms of Staphylococcus aureus, Pseudomonas aeruginosa and Candida albicans and mixed biofilms of S. aureus and C. albicans was evaluated. The effect on the extracellular matrix of P. aeruginosa was also assessed. Irradiation with white light up to an energy dose of 64.8 J cm‐2 in the presence of 20 μM of Tetra‐Py+‐Me Tetra‐Py+‐Me caused significant inactivation in all single‐species biofilms (3 ‐ 6 log reductions), although the susceptibility was attenuated in relation to planktonic cells. In mixed biofilms, the inactivation of S. aureus was as efficient as in single‐species biofilms but the susceptibility of C. albicans decreased. In P. aeruginosa biofilms, a reduction of 81% in the polysaccharides content of the matrix was observed after treatment with a 20 μM PS concentration and a total light dose of 64.8 J cm‐2. The results show that the Tetra‐Py+‐Me causes significant inactivation of the microorganisms, either in biofilms or in the planktonic form, and demonstrate that polysaccharides of the biofilm matrix may be a primary target of photodynamic damage. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-12T00:21:34.055195-05:
      DOI: 10.1111/php.12331
       
  • Proanthocyanidins from Grape Seeds Inhibit UV Radiation‐Induced
           Immune Suppression in Mice: Detection and Analysis of Molecular and
           Cellular Targets
    • Authors: Santosh K. Katiyar
      Pages: n/a - n/a
      Abstract: Ultraviolet (UV) radiation‐induced immunosuppression has been linked with the risk of skin carcinogenesis. Approximately, two million new cases of skin cancers, including melanoma and non‐melanoma, diagnosed each year in the USA and therefore have a tremendous bad impact on public health. Dietary phytochemicals are promising options for the development of effective strategy for the prevention of photodamaging effects of UV radiation including the risk of skin cancer. Grape seed proanthocyanidins (GSPs) are such phytochemicals. Dietary administration of GSPs with AIN76A control diet significantly inhibits UV‐induced skin tumor development as well as suppression of immune system. UV‐induced suppression of immune system is commonly determined using contact hypersensitivity (CHS) model which is a prototype of T cell‐mediated immune response. We present evidence that inhibition of UV‐induced suppression of immune system by GSPs is mediated through: (i) the alterations in immunoregulatory cytokines, interleukin (IL)‐10 and IL‐12, (ii) DNA repair, (iii) stimulation of effector T cells, and (iv) DNA repair‐dependent functional activation of dendritic cells in mouse model. These information have important implications for the use of GSPs as a dietary supplement in chemoprevention of UV‐induced immunosuppression as well as photocarcinogenesis. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-12T00:21:21.261632-05:
      DOI: 10.1111/php.12330
       
  • The effects of UV‐B radiation intensity on biochemical parameters
           and active ingredients in flowers of Qi chrysanthemum and Huai
           chrysanthemum
    • Authors: Xiao‐Qin Yao; Jian‐Zhou Chu, Xue‐Li He, Chao Si
      Pages: n/a - n/a
      Abstract: The paper studied UV‐B‐effects on biochemical parameters and active ingredients in flowers of Qi chrysanthemum and Huai chrysanthemum during the bud stage. The experiment included four UV‐B radiation levels (CK, ambient UV‐B; T1, T2 and T3 indicated a 5%, 10% and 15% increase in ambient UV‐BBE, respectively) to determine the optimal UV‐B radiation intensity in regulating active ingredients level in flowers of two chrysanthemum varieties. Flower dry weight of two cultivars was not affected by UV‐B radiation under experimental conditions reported here. UV‐B treatments significantly increased the rate of superoxide radical production, hydrogen peroxide (H2O2) (except for T1) and malondialdehyde concentration in flowers of Huai chrysanthemum, and H2O2 concentration in flowers of Qi chrysanthemum. T2 and T3 treatments induced a significant increase in penylalanine ammonia lyase enzyme (PAL) activity, anthocyanins, proline, ascorbic acid, chlorogenic acid and flavone content in flowers of two chrysanthemum varieties, and there were no significant differences in PAL activity, ascorbic acid, flavone and chlorogenic acid content between the two treatments. These results indicated that appropriate UV‐B radiation intensity did not result in the decrease in flower yield, and could regulate PAL activity and increase active ingredients content in flowers of two chrysanthemum varieties. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-11T10:56:51.994649-05:
      DOI: 10.1111/php.12329
       
  • Directed improvement of Luciferin Regenerating Enzyme (LRE) binding
           properties: Implication of some conserved residues in luciferin binding
           domain
    • Authors: Roohullah Hemmati; Reza H. Sajedi, Nuredin Bakhtiari, Saman Hosseinkhani
      Pages: n/a - n/a
      Abstract: Luciferin regenerating enzyme (LRE) contributes to in vitro recycling of D‐luciferin to produce persistent and longer light emission by luciferase. Luciferin binding domains I and II among LREs regarded as potential candidates for luciferin‐binding sites. In this study, for the first time, amino acids T69, G75 and K77 located at luciferin binding domain I of LRE from L. turkestanicus (T‐LRE) substituted by using site‐directed mutagenesis. Single mutant T69R increased luciferase light output more than 2‐fold over a longer time in comparison with a wild‐type and other mutants of T‐LRE. Nevertheless, double mutant (K77E/T69R) increased the amount of bioluminescent signal more than 2‐fold over a short time. In addition, G75E, K77E and G75E/T69R mutants didn't improve luciferin‐luciferase in vitro bioluminescence. Based on our results, addition of K77E/G75E and K77E/G75E/T69R mutants caused intermediate changes in bioluminescence from in vitro luciferin‐luciferase reaction. These findings indicated that the amino acids in question are possible to be located within T‐LRE active site. It may also be suggested that substituted Arg69 (Arg218) plays an important role in luciferin binding and the existence of Gly75 as well as Lys77 is essential for T‐LRE which has already evolved to have different functions in nature. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-08T01:36:32.477959-05:
      DOI: 10.1111/php.12328
       
  • A New Series of Fluorescent Indicators for Super Acids
    • Authors: I‐Chih Shih; Yu‐Shan Yeh, I‐Che Wu, You‐Hua Chen, Jiun‐Yi Shen, Yi‐An Chen, Mei‐Lin Ho, Pi‐Tai Chou
      Pages: n/a - n/a
      Abstract: The photophysical properties of fluorescent Hammett acidity indicator derived from 3,4,5,6‐tetrahydrobis(pyrido[3,2‐g]indolo)[2,3‐a:3’,2’‐j]acridine (1a), 6‐bis(pyrido[3,2‐g]indol‐2’‐yl)pyridine (1b) and their analogues have been investigated in sulfuric acid solutions by means of absorption, fluorimetry, relaxation dynamics and computational approach. These new indicators undergo a reversible protonation process in the Hammett acidity range of H0 < 0, accompanied by a drastic increase of the bright blue‐green (1a) or yellow (1b) fluorescence intensity upon increasing the acidity. For 1a in H2SO4, the emission yield increases as large as 200 folds from pH = ‐0.41 to the Hammett acidity range of ‐5.17, the results of which are rationalized by a much increase of the steric hindrance upon third protonation toward the central pyridinic site, together with their accompanied changes of electronic configuration from charge transfer to a delocalized ππ* character in the lowest lying excited state. The combination of 1a and 1b renders a wide and linear range of H0 measurement from ‐1.2 to ‐5.1 detected by highly intensive fluorescence. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-07T02:09:17.116293-05:
      DOI: 10.1111/php.12326
       
  • Self‐aggregation of synthetic zinc chlorophyll derivatives
           possessing 31‐hydroxy or methoxy group and 131‐mono‐ or
           dicyanomethylene moiety in non‐polar organic solvents as models of
           chlorosomal bacteriochlorophyll‐d aggregates
    • Authors: Hitoshi Tamiaki; Masaki Kuno, Masaki Ohata
      Pages: n/a - n/a
      Abstract: Methyl 131‐(di)cyanomethylene‐pyropheophorbides were synthesized by Knoevenagel reactions of the corresponding 131‐oxo‐chlorins prepared from modifying chlorophyll‐a with malononitrile or cyanoacetic acid. Alternatively, methyl 131‐cyanomethylene‐pyropheophorbides were produced by Wittig reactions of 131‐oxo‐chlorins with Ph3P=CHCN. Self‐aggregation of zinc complexes of the semi‐synthetic chlorophyll derivatives possessing a hydroxy or methoxy group at the 31‐position was examined in 1%(v/v) tetrahydrofuran or dichloromethane and hexane by electronic absorption and circular dichroism spectroscopy. Although intermolecular hydrogen‐bonding between the 31‐hydroxy and 131‐oxo groups of bacteriochlorophylls‐c/d/e/f was essential for their self‐aggregation in natural light‐harvesting antenna systems (= chlorosomes), zinc 31‐hydroxy‐131‐di/monocyanomethylene‐chlorins self‐aggregated in the less/lesser polar organic solvents to form chlorosome‐like large oligomers in spite of lacking the 131‐oxo moiety as the hydrogen‐bonding acceptor. Zinc 31‐methoxy‐131‐dicyanomethylene‐chlorin gave similar self‐aggregates regardless of lack of both the 31‐hydroxy and 131‐oxo groups. The present self‐aggregation was ascribable to stronger coordination of the 31‐oxygen atom to the central zinc than the conventional systems, where the electron‐withdrawing cyano group(s) increased the coordinative ability of the central zinc through chlorin π‐system. This article is protected by copyright. All rights reserved.
      PubDate: 2014-08-06T10:35:26.842727-05:
      DOI: 10.1111/php.12327
       
  • Hydroxyl Radical as an unlikely Key Intermediate in the Photodegradation
           of Emerging Pollutants
    • Authors: Gemma M. Rodriguez‐Muñiz; Juan Gomis, Antonio Arques, Ana M. Amat, M. Luisa Marin, Miguel A. Miranda
      Pages: n/a - n/a
      Abstract: In this work a kinetic model, in combination with time‐resolved experiments, is applied to assess the involvement of •OH in the photodegradation of emerging pollutants (EPs) by means of advanced oxidation processes. By contrast with the general assumption, quenching of the short‐lived •OH in the real waters by the (highly diluted) EPs must be very inefficient, so removal of EPs cannot purely rely on the generation and reaction of •OH. This suggests that more complex pathways have to be considered to explain the photodegradation of EPs actually achieved under the employed oxidative conditions, possibly involving other reactive species with longer lifetimes or chain degradation processes. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-28T03:59:40.0529-05:00
      DOI: 10.1111/php.12325
       
  • Rapid sonosynthesis of N‐doped nano TiO2 on wool fabric at low
           temperature: Introducing Self‐cleaning, Hydrophilicity,
           Antibacterial/Antifungal Properties with low Alkali Solubility, Yellowness
           and Cytotoxicity
    • Authors: Amir Behzadnia; Majid Montazer, Abousaeid Rashidi, Mahnaz Mahmoudi Rad
      Pages: n/a - n/a
      Abstract: Nano nitrogen‐doped titanium dioxide were rapidly prepared by hydrolysis of titanium isopropoxide at 75‐80 °C using in situ sonochemical synthesis by introducing ammonia. Various concentrations of titanium isopropoxide were examined to deposit nano nitrogen‐doped titanium dioxide through impregnation of the wool fabric in ultrasound bath followed by curing. The antibacterial/antifungal activities of wool samples were assessed against two common pathogenic bacteria including Escherichia coli and Staphylococcus aureus and the diploid fungus Candida albicans. The sonotreated wool fabrics indicated no adverse effects on human dermal fibroblasts. The presence of nano‐particles on the sonotreated wool fabrics were confirmed by FE‐SEM images and EDS patterns and X‐ray mapping and the crystalline size of nano‐particles were estimated through XRD results. The role of both pH and precursor concentration on the various properties of the fabric was investigated and the optimized conditions introduced using response surface methodology. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-28T03:59:39.080091-05:
      DOI: 10.1111/php.12324
       
  • Hypericin Damages the Ectatic Capillaries in a Roman Cockscomb Model and
           Inhibits the Growth of Human Endothelial Cells More Potently Than
           Hematoporphyrin Does Through Induction of Apoptosis
    • Authors: Zhuo‐heng Li; De‐sheng Meng, Yuan‐yuan Li, Lai‐chun Lu, Cai‐ping Yu, Qian Zhang, Hai‐yan Guan, Chen‐wen Li, Xue Yang, Ruo‐qiu Fu
      Pages: n/a - n/a
      Abstract: Hypericin (HY) is a promising photosensitizer (PS) for use in photodynamic therapy (PDT). Port‐wine stains (PWSs) are congenital superficial dermal capillary malformations. In this study, we evaluated the photocytotoxic effects of HY for PDT in human vascular endothelial cells and a chicken cockscomb model. HY significantly inhibited the growth of human umbilical vein endothelial cells (HUVECs), as determined by colorimetric assays and morphological observation, and flow cytometry assays indicated induction of apoptosis and collapse of the mitochondrial membrane potential. In addition, HY more effectively inhibited growth of and induced apoptosis in HUVECs compared with hematoporphyrin (HP). Further experiments performed in a Roman chicken cockscomb model also showed a clear photocytotoxic effect on the cockscomb dermal capillary upon intravenous injection of HY. This effect may be due to the role of HY in the induction of apoptosis. Transmission electron microscopical analysis showed mitochondrial morphological changes such as incomplete ridges and swelling, and immunohistochemical assays showed an increase in the release of cytochrome c. In conclusion, HY exhibited a greater photocytotoxic activity than did HP toward the growth of endothelial cells and may thus represent a potent PS for PWS PDT. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-26T02:42:55.177775-05:
      DOI: 10.1111/php.12323
       
  • ROS and p53 in Regulation of UVB‐induced HDM2 Alternative Splicing
    • Authors: Lingying Tong; Shiyong Wu
      Pages: n/a - n/a
      Abstract: Alternative splicing plays an important role in proteasome diversity and gene expression regulation in eukaryotic cells. Hdm2, the human homolog of mdm2 (murine double minute oncogene 2), is known to be an oncogene as its role in suppression of p53. Hdm2 alternative splicing, occurs in both tumor and normal tissues, is believed to be a response of cells for cellular stress, and thus modulate p53 activity. Therefore, understanding the regulation of hdm2 splicing is critical in elucidating the mechanisms of tumor development and progression. In this study, we determined the effect of ultraviolet B light (UVB) on alternative splicing of hdm2. Our data indicated that UVB (50 mJ cm−2) alone is not a good inducer of alternative splicing of hdm2. The less effectiveness could be due to the induction of ROS and p53 by UVB because removing ROS by L‐NAC (10 mm) in p53 null cells could lead to alternative splicing of hdm2 upon UVB irradiation. Hdm2, the human homologue of mdm2 (murine double minute oncogene 2), is an oncogene for its role in suppression of p53. Hdm2 alternative splicing, occurs in both tumor and normal tissues, is suggested to be a response of cells for cellular stress, and thus modulate p53 activity. In this study, we demonstrated that UVB is weaker inducer of alternative splicing than UVC is. We also provided evidences that the UV‐induced alternative splicing is promoted by DNA‐damage, but suppressed by ROS formation and p53 activity of the irradiated cells.
      PubDate: 2014-07-26T00:02:01.70935-05:0
      DOI: 10.1111/php.12306
       
  • UVB Irradiation Enhances TiO2 Nanoparticle‐induced Disruption of
           Calcium Homeostasis in Human Lens Epithelial Cells
    • Authors: Qiuxin Wu; Dadong Guo, Yuxiang Du, Dongmei Liu, Daoguang Wang, Hongsheng Bi
      Pages: n/a - n/a
      Abstract: Currently, titanium dioxide nanoparticles (TiO2 NPs) have been widely used in various applications including cosmetics, food additives and biomedicine. However, there are few reports available using TiO2 NPs to treat ocular diseases. Posterior capsular opacification (PCO) is the most frequent complication after cataract surgery, which is induced by the proliferation and migration of lens epithelial cells. Thus, inhibiting the proliferation of lens epithelial cells will efficiently reduce the occurrence of PCO. In this study, we investigated the effects of TiO2 NPs on HLE B‐3 cells with or without ultraviolet B (UVB) irradiation in vitro. We found that TiO2 NPs can inhibit HLE B‐3 cell growth, cause the elevation of intracellular [Ca2+], produce excessive reactive oxygen species (ROS), further reduce Ca2+‐ATPase activity and decrease the expression of plasma membrane calcium ATPase 1 (PMCA1), finally disrupt the intracellular calcium homeostasis and induce cell damage. Importantly, UVB irradiation can apparently enhance these effects on HLE B‐3 cells in the presence of TiO2 NPs. Taken together, the generation of excessive ROS and the disruption of intracellular calcium homeostasis may be both involved in TiO2 nanoparticle‐induced HLE B‐3 cell damage under UVB irradiation. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-24T11:09:55.145055-05:
      DOI: 10.1111/php.12322
       
  • Photooxidation of Tryptophan Leading to 2‐Aminoacetophenone ‐
           A Possible Reason for the Untypical Aging Off‐flavor in Wine
    • Authors: Nora Horlacher; Wolfgang Schwack
      Pages: n/a - n/a
      Abstract: 2‐Aminoacetophenone (AAP) was recognized as the key compound for the so‐called untypical aging off‐flavor (UTA) in Vitis vinifera wines. In this study, it was shown that AAP can be formed by photooxidation of free and protein‐bound tryptophan (TRP) in combination with a subsequent storage in model wine. Solutions of TRP and lysozyme were exposed to artificial sunlight both in the presence and in the absence of the photosensitizer riboflavin. Aliquots of the irradiation batches were stored in model wine solutions containing tartaric acid, sulfite, and ethanol in different combinations. AAP formation could be identified from both free and bound (lysozyme) TRP, while free TRP resulted in higher yields. The presence of riboflavin during irradiation generally favored the AAP formation. AAP formation increased with increasing irradiation times, but AAP was not detectable, if TRP was directly incubated in model wine. Not only the irradiation time but also the storage time of model wines favored the formation of AAP. Concerning the model wine composition, it became evident that the presence of tartaric acid resulted in the highest AAP formation during storage. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-22T01:48:41.844654-05:
      DOI: 10.1111/php.12321
       
  • Validation and application of a model of oxygen consumption and diffusion
           during photodynamic therapy in vitro
    • Authors: Mark A. Weston; Michael S. Patterson
      Pages: n/a - n/a
      Abstract: The photophysical parameters for the photosensitizer Pd(II) meso‐Tetra(4‐carboxyphenyl) porphine (PdT790) acquired in a previous study were incorporated into the PDT oxygen diffusion models for cell suspensions and cell monolayers. The time dependent phosphorescence signals generated by the diffusion models are shown to match signals previously measured by Weston and Patterson when reasonable physical and photophysical parameters are used. Simulations were performed to investigate the effects of metabolic and photodynamic oxygen consumption rates on the PDT dose in each of the treatment geometries. It was found that in cell suspensions of less than 1 million cells per mL, PDT should not be inhibited by hypoxia if the photodynamic consumption rate is less than 1 mM s−1. For cell monolayers the optimal photodynamic oxygen consumption rate was found to depend on the metabolic rate of oxygen consumption. If cells remained well oxygenated in the absence of PDT, then maximum PDT dose was delivered with the lowest practical photodynamic oxygen consumption rate. Simulations of PDT treatments for multicell tumor spheroids showed that large anoxic cores develop within the spheroids and, as a consequence, less PDT dose is delivered in comparison to similar treatments in cell suspensions and cell monolayers. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-21T01:28:08.557303-05:
      DOI: 10.1111/php.12320
       
  • Enhanced Light‐Harvesting Capacity by Micellar Assembly of Free
           Accessory Chromophores and LH1‐like Antennas
    • Authors: Michelle A. Harris; Tuba Sahin, Jianbing Jiang, Pothiappan Vairaprakash, Pamela S. Parkes‐Loach, Dariusz M. Niedzwiedzki, Christine Kirmaier, Paul A. Loach, David F. Bocian, Dewey Holten, Jonathan S. Lindsey
      Pages: n/a - n/a
      Abstract: Biohybrid light‐harvesting antennas are an emerging platform technology with versatile tailorability for solar‐energy conversion. These systems combine the proven peptide scaffold unit utilized for light harvesting by purple photosynthetic bacteria with attached synthetic chromophores to extend solar coverage beyond that of the natural systems. Herein, synthetic unattached chromophores are employed that partition into the organized milieu (e.g., detergent micelles) that house the LH1‐like biohybrid architectures. The synthetic chromophores include a hydrophobic boron‐dipyrrin dye (A1) and an amphiphilic bacteriochlorin (A2), which transfer energy with reasonable efficiency to the bacteriochlorophyll acceptor array (B875) of the LH1‐like cyclic oligomers. The energy‐transfer efficiencies are markedly increased upon covalent attachment of a bacteriochlorin (B1 or B2) to the peptide scaffold, where the latter likely acts as an energy‐transfer relay site for the (potentially diffusing) free chromophores. The efficiencies are consistent with a Förster (through‐space) mechanism for energy transfer. The overall energy‐transfer efficiency from the free chromophores via the relay to the target site can approach those obtained previously by relay‐assisted energy transfer from chromophores attached at distant sites on the peptides. Thus, the use of free accessory chromophores affords a simple design to enhance the overall light‐harvesting capacity of biohybrid LH1‐like architectures. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-21T01:28:02.651894-05:
      DOI: 10.1111/php.12319
       
  • Effect of Immunosuppressants Tacrolimus and Mycophenolate Mofetil on the
           Keratinocyte UVB Response
    • Authors: Mei Ming; Baozhong Zhao, Lei Qiang, Yu‐Ying He
      Pages: n/a - n/a
      Abstract: Non‐melanoma skin cancer, derived from epidermal keratinocytes, is the most common malignancy in organ transplant recipients, causes serious morbidity and mortality, and is strongly associated with solar ultraviolet (UV) exposure. Preventing and treating skin cancer in these individuals has been extraordinarily challenging. Following organ transplantation, the immunosuppressants are used to prevent graft rejection. Until now, immunosuppression has been assumed to be the major factor leading to skin cancer in this setting. However, the mechanism of skin carcinogenesis in organ transplant recipients has not been understood to date; specifically, it remains unknown whether these cancers are immunosuppression‐dependent or ‐independent. In particular, it remains poorly understood what is the mechanistic carcinogenic action of the newer generation of immunosuppressants including tacrolimus and mycophenolate mofetil (MMF). Here we show that tacrolimus and MMF impairs UVB‐induced DNA damage repair and apoptosis in human epidermal keratinocytes. In addition, tacrolimus inhibits UVB‐induced checkpoint signaling. However, MMF had no effect. Our findings have demonstrated that tacrolimus and MMF compromises proper UVB response in keratinocytes, suggesting an immunosuppression‐independent mechanism in the tumor‐promoting action of these immunosuppressants. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-21T01:27:27.76301-05:0
      DOI: 10.1111/php.12318
       
  • In Vitro Investigations on the Effect of Dermal Fibroblasts on
           Keratinocyte Responses to Ultraviolet B Radiation
    • Authors: Tara L Fernandez; Derek R Van Lonkhuyzen, Rebecca A Dawson, Michael G Kimlin, Zee Upton
      Pages: n/a - n/a
      Abstract: Exposure to ultraviolet radiation (UVR) is closely linked to the development of skin cancers in humans. The ultraviolet B (UVB) radiation wavelength (280‐320 nm), in particular, causes DNA damage in epidermal keratinocytes, which are linked to the generation of signature pre‐malignant mutations. Interactions between dermal fibroblasts and keratinocytes play a role in epidermal repair and regeneration after UVB‐induced damage. To investigate these processes, established two and three‐dimensional culture models were utilised to study the impact of fibroblast‐keratinocyte crosstalk during the acute UVB response. Using a co‐culture system it was observed that fibroblasts enhanced keratinocyte survival and the repair of cyclobutane pyrimidine dimers (CPDs) after UVB radiation exposure. These findings were also mirrored in irradiated human skin co‐culture models employed in this study. Fibroblast co‐culture was shown to play a role in the expression and activation of members of the apoptotic cascade, including caspase‐3 and Bad. Interestingly, the expression and phosphorylation of p53, a key player in the regulation of keratinocyte cell fate post‐irradiation, was also shown to be influenced by fibroblast‐produced factors. This study highlights the importance of synergistic interactions between fibroblasts and keratinocytes in maintaining a functional epidermis while promoting repair and regeneration following UVB radiation‐induced damage. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-18T03:00:24.137746-05:
      DOI: 10.1111/php.12317
       
  • Red‐Light interferes in UVA‐induced Photoaging of Human Skin
           fibroblast Cells
    • Authors: Tianhui Niu; Yan Tian, Qu Ren, Lizhao Wei, Xiaoxin Li, Qing Cai
      Pages: n/a - n/a
      Abstract: The possible regulation mechanism of red light was determined to discover how to retard UVA‐induced skin photoaging. Human skin fibroblasts were cultured and irradiated with different doses of UVA, thus creating a photoaging model. Fibroblasts were also exposed to a sub‐toxic dose of UVA combined with a red light‐emitting diode (LED) for 5 continuous days. Three groups were examined: control, UVA and UVA plus red light. Cumulative exposure doses of UVA were 25 J/cm2, and the total doses of red light were 0.18 J/cm2. Various indicators were measured before and after irradiation, including cell morphology, viability, β‐galactosidase staining, apoptosis, cycle phase, the length of telomeres and the protein levels of photoaging‐related genes. Red light irradiation retarded the cumulative low‐dose UVA irradiation‐induced skin photoaging, decreased the expression of senescence‐associated β‐galactosidase, up‐regulated SIRT1 expression, decreased matrix metalloproteinase MMP‐1 and the acetylation of p53 expression, reduced the horizon of cell apoptosis, and enhanced cell viability. Furthermore, the telomeres in UVA‐treated cells were shortened compared to those of cells in the red light groups. These results suggest that red light plays a key role in the anti‐photoaging of human skin fibroblasts by acting on different signaling transduction pathways. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-12T06:29:10.737088-05:
      DOI: 10.1111/php.12316
       
  • The injury and cumulative effects on human skin by UV exposure from
           artificial fluorescence emission
    • Authors: Yan. Tian; Wei. Liu, TianHui. Niu, CaiHong. Dai, Xiaoxin. Li, Caijuan. Cui, Xinyan. Zhao, Yaping. E, Hui. Lu
      Pages: n/a - n/a
      Abstract: The injury and cumulative effects of UV emission from fluorescence lamp were studied. UV intensity from fluorescence lamp was measured, and human skin samples (hips, 10 volunteers) were exposed to low dose UV irradiation (three times per week for 13 consecutive weeks). Three groups were examined: control group without UV radiation; low dose group with a cumulative dose of 50 J/cm2 which was equivalent to irradiation of the face during indoor work for 1.5 years; and high dose group with 1000 J/cm2 cumulative dose equivalent to irradiation of the face during outdoor activities for 1 year. Specific indicators were measured before and after UVA irradiation. The findings showed that extending the low dose UVA exposure decreased the skin moisture content and increased the transepidermal water loss as well as induced skin colour changes (decreased L* value, increased M index). Furthermore, irradiated skin showed an increased thickness of cuticle and epidermis, skin oedema, light colour and unclear staining collagen fibres in the dermis, and elastic fibre fragmentation. In addition, MMP‐1, p53 and SIRT1 expression was also increased. Long‐term exposure of low dose UVA radiation enhanced skin photoageing.The safety of the fluorescent lamp needs our attention. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-11T01:39:39.948528-05:
      DOI: 10.1111/php.12315
       
  • Study of the Photodegradation Kinetics and Pathways of Hexaflumuron in
           Liquid Media
    • Authors: Lu Chengying; Xing Yin, Xiaofeng Liu, Minghua Wang
      Pages: n/a - n/a
      Abstract: Hexaflumuron, one of the benzoylphenylurea insect growth regulators, can be leached into surface water and thus having a potential impact on aquatic organisms In this study, the photodegradation processes of hexaflumuron under high‐pressure mercury lamp irradiation were assessed. The photodegradation kinetics were studied, as were the effects of pH,different light sources, organic solvents and environmental substances, including nitrate ions (NO3−), nitrite ions (NO2−), ferrous ions (Fe2+), ferric ions (Fe3+), humic acid, sodium dodecyl sulfate (SDS) and hydrogen peroxide (H2O2). Three photodegradation products in methanol were identified by gas chromatography‐mass spectrometry (GC‐MS). In general, the degradation of hexaflumuron followed first‐order kinetics. In the four media studied, the photodegradation rate order was n‐hexane > methanol > ultrapure water > acetone. Faster degradation was observed under high‐pressure mercury lamp irradiation than under xenon lamp irradiation. The pH had a considerable effect, with the most rapid degradation occurring at pH 5.0. The photodegradation rate of hexaflumuron was promoted in the presence of NO3−, NO2−, Fe2+, humic acid, SDS and H2O2 but inhibited by Fe3+. Moreover, the presumed photodegradation pathway was proposed to be the cleavage of the urea linkage. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-11T01:39:36.74197-05:0
      DOI: 10.1111/php.12314
       
  • Observation of in vivo morphologic changes after carbon dioxide ablative
           fractional laser in a mouse model using non‐invasive imaging
           modalities and comparison with histologic examination
    • Authors: Kwang Ho Yoo; Tae Rin Kwon, So Young Kim, Yi Seop Song, Young Sook Cheon, Yu Mi Kim, In Kwon Yeo, Eun Jung Ko, Kapsok Li, Myeung Nam Kim, Beom Joon Kim
      Pages: n/a - n/a
      Abstract: Ablative fractional carbon dioxide (CO2) lasers have been widely used for several types of cosmetic dermatosis. A number of previous studies have evaluated this technique in animals or human beings by observing morphologic changes using an invasive modality such as skin biopsy. In this study, we assessed in vivo skin changes after CO2 ablative fractional laser treatment in a mouse model using non‐invasive imaging modalities (Folliscope® and Visioscan 98®), and each results was compared with data from histologic examination. An ablative fractional CO2 laser was applied with different pulse energy between 7 to 35 mJ/microspot. As results of above methods, we also confirmed that the CO2 ablative fractional laser generated injuries with increasing width and depth with increasing pulse energy. Although numerous papers have described application of this laser in vivo skin specimens, our study evaluated the feasibility of using relative non‐invasive imaging modalities for assessing the outcome of laser ablation. Based on our data, we suggest that these technologies may be useful alternative modalities for assessing laser ablation that are easier to perform and less invasive than skin biopsy. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-11T01:39:34.393127-05:
      DOI: 10.1111/php.12313
       
  • Sun‐protection Provided by Regulation School Uniforms in Australian
           Schools: An Opportunity to Improve Personal Sun‐protection During
           Childhood
    • Authors: Denise Turner; Simone Lee Harrison
      Pages: n/a - n/a
      Abstract: Childhood sun‐exposure is linked to excessive pigmented mole development and melanoma risk. Clothing provides a physical barrier, protecting skin from ultraviolet radiation (UVR). Extending sleeves to elbow‐length and shorts to knee‐length has been shown to significantly reduce mole acquisition in pre‐schoolers from tropical Queensland. We used publicly‐available uniform images and guidelines from primary schools in Townsville (latitude 19.25°S, n=43 schools), Cairns (16.87°S, n=46), and the Atherton Tablelands (17.26°S, n=23) in tropical Australia to objectively determine the body surface proportion covered by regulation school uniforms. Uniforms of non‐government, large (≥800 students), urban, educationally‐advantaged schools with comprehensive sun‐protection policies covered more skin than those of government schools (63.2% Vs 62.0%; p
      PubDate: 2014-07-09T11:57:44.861834-05:
      DOI: 10.1111/php.12312
       
  • Cellular Changes Associated with the Acclimation of the Intertidal Sea
           Anemone Actinia tenebrosa to Ultraviolet Radiation.
    • Authors: Victor Mauricio Cubillos; Miles D. Lamare, Barrie M. Peake, David J. Burritt
      Pages: n/a - n/a
      Abstract: To assess the relative importance of long‐ and short‐term cellular defence mechanisms in seasonally UV‐R acclimated Actinia tenebrosa (Anthozoa, Actiniidae), individuals were exposed to summer doses of PAR, UV‐A, UV‐B and enhanced UV‐B (20%) for a period of 4 days. Mycosporine‐like amino acids (MAAs) and cyclobutane pyrimidine dimer (CPD) concentrations were quantified, while oxidative damage to lipids and proteins, and the activities/levels of the antioxidant enzymes SOD, CAT, GR, GPOX and total glutathione were determined. Our results show that summer UV‐R acclimated individuals had a higher UV‐R tolerance, with no significant increases in CPDs levels, than winter acclimated sea anemones possibly due to higher MAA concentrations. Summer acclimated individuals showed increased lipid and protein oxidation and GPOX activity only when they were exposed to UV‐B at 20% above ambient UV‐R levels. In contrast, winter acclimated sea anemones showed elevated levels of oxidative damage, GPOX and SOD activities after exposure to UV‐A or UV‐B at ambient and elevated levels. Thus, this study indicates that long‐term UV‐R acclimation mechanisms such as the accumulation of MAAs could be more important than short term increases in antioxidant defences with respect to reducing indirect UV‐R damage in intertidal sea anemones. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-05T10:29:03.403438-05:
      DOI: 10.1111/php.12310
       
  • Photoactive hybrid materials of lanthanide (Eu3+, Tb3+, Sm3+)
           beta‐diketonates and polymer resin through ionic liquid bridge
    • Authors: Ying Mei; Bing Yan
      Pages: n/a - n/a
      Abstract: A special multifunctional ionic liquid compound (1‐methyl‐3‐(2‐(thiocarboxyoxy)‐ethyl)‐2H‐imidazole‐1,3‐diium bromide (SHIL)) is used as the chemical bridge to link lanthanide beta‐diketonates and polymer resin, which are designated as Ln(L)4‐SHIL‐WR/MR (Ln = Eu, Tb, Sm; L= thenoyltrifluoroacetonate (TTA), acetylacetonate (AA), dibenzoylmethane (DBM); WR = Wang resin, MR = Merrifield resin). Among SHIL and polymer resin are assembled to form covalently bonded system through condensation reaction. Then tetrakis lanthanide beta‐diketonates are linked to SHIL through ion exchange reaction. Physical characterization and especially the photoluminescent performance of the multi‐component hybrids are studied. The hybrid materials possess good stability and excellent luminescent property. The results provide useful path to obtain luminescent hybrids for further practical application. This article is protected by copyright. All rights reserved.
      PubDate: 2014-07-02T00:20:22.559681-05:
      DOI: 10.1111/php.12307
       
  • Xeroderma Pigmentosum in the United Kingdom;
    • Authors: Alan R Lehmann
      Abstract: The seminal discovery by James Cleaver of defective DNA repair in xeroderma pigmentosum (XP) opened up an ever‐expanding field of DNA repair‐related disorders. In addition it put XP on the map and has led to improved diagnosis, care and management of affected patients. In the UK, we recently established a multi‐disciplinary specialist clinic for XP patients. All XP patients in the UK are able to visit the clinic where they are examined and advised by a team of specialists with detailed knowledge of the different aspects of XP. This article is protected by copyright. All rights reserved.
      PubDate: 2014-06-19T01:55:47.802274-05:
      DOI: 10.1111/php.12301
       
  • Editorial (2014, issue 6)
    • Authors: Jean Cadet
      Pages: 1215 - 1215
      PubDate: 2014-11-14T00:45:12.704265-05:
      DOI: 10.1111/php.12364
       
  • Effect of Light on Expression of Clock Genes in Xenopus laevis
           Melanophores
    • Authors: Maria Nathália Moraes; Maristela Poletini, Bruno Cesar Ribeiro Ramos, Leonardo Henrique Ribeiro Graciani Lima, Ana Maria Castrucci
      Pages: n/a - n/a
      Abstract: Light‐dark cycles are considered important cues to entrain biological clocks. A feedback loop of clock gene transcription and translation is the molecular basis underlying the mechanism of both central and peripheral clocks. Xenopus laevis embryonic melanophores respond to light with melanin granule dispersion, response possibly mediated by the photopigment melanopsin. In order to test whether light modulates clock gene expression in Xenopus melanophores, we used qPCR to evaluate the relative mRNA levels of Per1, Per2, Clock and Bmal1 in cultured melanophores exposed to light‐dark (LD) cycle or constant darkness (DD). LD cycles elicited temporal changes in the expression of Per1, Per2 and Bmal1. A 10‐min pulse of blue light was able to increase the expression of Per1 and Per2. Red light had no effect on the expression of these clock genes. These data suggest the participation of a blue‐wavelength sensitive pigment in the light‐dark cycle‐mediated oscillation of the endogenous clock. Our results add an important contribution to the emerging field of peripheral clocks, which in non‐mammalian vertebrates have been mostly studied in Drosophila and Danio rerio. Within this context, we show that Xenopus laevis melanophores, which have already led to melanopsin discovery, represent an ideal model to understanding circadian rhythms. This article is protected by copyright. All rights reserved.
      PubDate: 2013-12-26T07:09:26.462616-05:
      DOI: 10.1111/j.1751-1097.2013.12230.x
       
 
 
JournalTOCs
School of Mathematical and Computer Sciences
Heriot-Watt University
Edinburgh, EH14 4AS, UK
Email: journaltocs@hw.ac.uk
Tel: +00 44 (0)131 4513762
Fax: +00 44 (0)131 4513327
 
About JournalTOCs
API
Help
News (blog, publications)
JournalTOCs on Twitter   JournalTOCs on Facebook

JournalTOCs © 2009-2014