for Journals by Title or ISSN
for Articles by Keywords
help

Publisher: Diponegoro University   (Total: 21 journals)   [Sort by number of followers]

Showing 1 - 21 of 21 Journals sorted alphabetically
Bulletin of Chemical Reaction Engineering & Catalysis     Open Access   (Followers: 2, SJR: 0.192, h-index: 6)
Geoplanning : J. of Geomatics and Planning     Open Access   (Followers: 1)
ILMU KELAUTAN : Indonesian J. of Marine Sciences     Open Access   (Followers: 1)
Intl. J. of Renewable Energy Development     Open Access   (Followers: 5)
Intl. J. of Waste Resources     Open Access   (Followers: 4)
Izumi : Jurnal Bahasa, Sastra dan Budaya Jepang     Open Access  
J. of Biomedicine and Translational Research     Open Access  
J. of Coastal Development     Open Access   (Followers: 2)
J. of the Indonesian Tropical Animal Agriculture     Open Access  
Jurnal Anestesiologi Indonesia     Open Access  
Jurnal Ilmu Lingkungan     Open Access   (Followers: 1)
Jurnal Reaktor     Open Access  
Jurnal Sistem Komputer     Open Access   (Followers: 1)
Jurnal Teknologi dan Sistem Komputer     Open Access  
Jurnal Wilayah dan Lingkungan     Open Access   (Followers: 1)
Kapal     Open Access   (Followers: 1)
Nurse Media : J. of Nursing     Open Access  
Parole : J. of Linguistics and Education     Open Access  
Tataloka     Open Access  
Teknik     Open Access  
Waste Technology     Open Access   (Followers: 3)
Journal Cover Journal of Biomedicine and Translational Research
  [0 followers]  Follow
    
  This is an Open Access Journal Open Access journal
   ISSN (Online) 2503-2178
   Published by Diponegoro University Homepage  [21 journals]
  • Active cytomegalovirus infection in critically ill immunocompeten patients
           admitted in the ICU. A molecular diagnosis approach

    • Authors: Tania Tedjo Minuljo, Muhammad Hussein Gasem, Purnomo Hadi
      Pages: 1 - 5
      Abstract: Active Cytomegalovirus (CMV) infection has been realated to immunocompromise conditions (malignancy, HIV-AIDS, longterm use of corticosteroids, transplant patient). Nowadays, severa studies have shown that immunocompetent critically ill patients were suffered from active CMV infection. Alteration of immune system in critically immunocompetent patient (without clear history of immunocompromise condition), might become the most possible reason enderlying this event. To document the prevalence of active CMV infection in critically ill immunocompetent patient; and to find out the difference in the degree of severity between groups of patients with and without active CMV infection, admitted in the ICU (Intensive Care Unit) . A cross sectional study was conducted from Appril 1st until June 30th 2013. Subjects were patient aged ≥ 14 years, hospitalized in ICU of Dr. Kariadi Hospital, Semarang, Indonesia. Patients having a history of malignancy, HIV-AIDS, longterm use of corticosteroids, and receiving transplatation were excluded from the study. The degree of severity was calculated (using APACHE II score) in the first 24 hours in ICU. EDTA sample for qualitative PCR examination (procedure as described elsewhere) was collected after 4 days of treatment. Primer for CMV were as follow CMV-F: CATGAAGGTCTTTGCCCAGTAC, CMV-R: GGCCAAAGTGTAGGCTACAATAG. Finally, datas ware analyzed using bivariate analysis. From 50 subjects included, 16 patients had active CMV infection. The degree of severity due to APACHE II score were normally distributed with mean 11.8±6.43. The mean of APACHE II score in group with active CMV infection was higher than group without .tive CMV infection, but not differ significantly (12.75 vs. 11.47; p=0,510). The Prevalence of active CMV infection in critically ill immunocompetent patient is relatively high (16/50; 32%) in ICU of Dr. Kariadi Hospital Semarang and the degree of severity due to APACHE II score was higher in group with active CMV infection than group without active CMV infection. A qualitative PCR testing was useful in the diagnosis of active CMV among immunocompeten critically-ill patients in the ICU. Key Words: Immunocompetent, critically ill, active CMV infection, PCR
      PubDate: 2017-06-23
      DOI: 10.14710/jbtr.v3i1.866
      Issue No: Vol. 3, No. 1 (2017)
       
  • Comparison of Effects on Gene Expression Activity of Low-Molecular-Weight
           Lychee Fruit Polyphenol (Oligonol┬«), Adenosine, and Minoxidil in Human
           Dermal Papilla Cells

    • Authors: Koji Wakame, Akifumi Nakata, Keisuke Sato, Yoshihiro Mihara, Jun Takanari, Atuya Sato, Ken-ichi Komatsu
      Pages: 6 - 12
      Abstract: Background: Oligonol® (OLG) is a functional food product and ingredient for cosmetics derived from a lychee fruit polyphenol. It has been reported to act on the skin as an anti-inflammatory and prevent UVB-induced skin damage.Aim: In this study, with the aim of exploring new functionalities of OLG on the scalp, we investigated the effect of OLG on human dermal papilla cells by comparing with adenosine and minoxidil at the genetic level.Method: OLG, adenosine, and minoxidil were applied to human dermal papilla cell lines for 24 h, after which VEGF, FGF-7, WNT5a, and WNT10a mRNA expressions were measured by real-time PCR analysis. Additionally, using DNA microarrays, we investigated the effect on 205 inflammation-related genes.Result: Consequently, in human dermal papilla cell lines, FGF-7 and WNT10a mRNA expression were observed in 100 µg/mL OLG-supplemented cells. The results of the DNA microarray analysis showed that 10 genes were suppressed by OLG.Conclusions: OLG may be expected to affect function of human dermal papilla cell by regulating the expression of genes related to cell proliferation and inflammation.
      PubDate: 2017-06-23
      DOI: 10.14710/jbtr.v3i1.928
      Issue No: Vol. 3, No. 1 (2017)
       
  • Comparison of Prostaglandin Analogue and Selective Laser Trabeculoplasty
           Capability to Maintain Intraocular Pressure Fluctuation on Primary Open
           Angle Glaucoma

    • Authors: Sara Listyani Koentjoro, Maharani Cahyono, Fifin Luthfia Rahmi
      Pages: 13 - 16
      Abstract: Background: Glaucoma patients often come with intraocular pressure (IOP) that reach target pressure, but still have glaucoma progression due to IOP fluctuation. Water drinking test (WDT) can be used as a method to predict IOP fluctuation. Purpose: To compare prostaglandin analogue (PGA) and selective laser trabeculoplasty (SLT) capability to maintain IOP fluctuation on primary open angle glaucoma (POAG). Method: This clinical experimental research was conducted at Dr. Kariadi Hospital. Subjects were POAG patients selected with consecutive sampling. Intraocular pressure was measured before and after WDT. After WDT, IOP was measured every 15 minutes until 1 hour. Peak IOP and IOP fluctuation data were collected then analyzed with t-test. Results: Forty two eyes from 30 POAG patients were analyzed. Twenty six eyes in PGA group and 16 eyes in SLT group. Most of the subjects were male with mild glaucoma degree. WDT increased IOP significantly on both groups. Mean IOP pre WDT was 14.58 ± 2.580 mmHg and 16.94 ± 2.645 mmHg in PGA and SLT groups. Mean peak IOP post WDT was 22.73 ± 4.114 mmHg and 25.75 ± 5.859 mmHg in PGA and SLT groups. Mean IOP fluctuation was 8.15 ± 4.202 mmHg and 8.81 ± 5.344 mmHg in PGA and SLT groups. Peak IOP and IOP fluctuation result analysis on both groups were not significantly different. Conclusion: Prostaglandin analogue and SLT had equal capability to maintain IOP fluctuation but still higher than normal fluctuation (>6 mmHg) that affects glaucoma progression.
      PubDate: 2017-06-23
      DOI: 10.14710/jbtr.v3i1.1206
      Issue No: Vol. 3, No. 1 (2017)
       
  • Multidisciplinary Management of Disorders of Sex Development in Indonesia,
           A Prototype in Developing Country

    • Authors: Nurin Aisyiyah Listyasari, Achmad Zulfa Juniarto, Sultana MH Faradz
      Pages: 17 - 22
      Abstract: ABSTRACTBackground : Disorder of sex development (DSD) patients require comprehensive management to improve quality of life. A standardized management protocol for patients in Indonesia is not yet available resulting in patients infrequently received a proper diagnosis. This study reported a multidisciplinary management DSD in Indonesia based on minimal diagnostic facilities and expertise in developing country.Objectives : The purpose of the study is to review the management of DSD patients in Indonesia relates to providing appropriate gender assignment and to improving patients quality of life.Methodology : We analyzed the records of DSD patient admitted to the division of Human Genetics Center for Biomedical Research (CEBIOR) Faculty of Medicine Diponegoro University, Semarang, Indonesia from May 2004 - December 2015. Data were collected and analyzed for physical examination, family pedigree karyotyping, hormonal assays and  psychosocial.  Other examination such as ultrasonography, Xray and Cytoscopy were also recorded for selected cases. Bimonthly, Sexual Adjustment Team (SAT) meeting was recorded.Results : From the total 617 DSD cases we found 426 cases (69,04 %) with 46, XY DSD, 117 cases (18,96%) with 46,XX DSD and 74 cases (12%) with sex chromosome DSD. Most of the patients in the group of 46, XY DSD are Unknown Male Undervirilization (UMU) with 256 cases (60.09%). As the majority cases of 46, XX DSD was Congenital Adrenal Hyperplasia with 81 cases (69.23%). The remaining cases were Androgen Action Disorder (AAD) with 140 cases (32.86%), 46, XY DSD Gonadal Dysgenesis with 30 cases (7.04%), Androgen Excess Disorders with 3 cases (2.56%), Defect of Mullerian Development with 19 cases (16,24%), 3 cases (2.56%) of Androgen Excess and 3 cases (2.56%) of 46, XX Gonadal Dysgenesis.Conclusion : Comprehensive management for DSD Patients help patient in diagnosis, gender assignment and support patient to improve quality of life. This multidisciplinary of DSD team is the only team in Indonesia that can be used as a model for other center in Indonesia as well as other developing countries with minimal diagnostic facilities.Keywords: Disorder of Sex Development; Sexual Adjustment Team; Chromosome.
      PubDate: 2017-06-23
      DOI: 10.14710/jbtr.v3i1.1209
      Issue No: Vol. 3, No. 1 (2017)
       
  • CHARGE Syndrome: an Indonesian case report

    • Authors: Jessica Juan Pramudita, Agustini Utari, Tri Indah Winarni, Sultana MH Faradz
      Pages: 23 - 26
      Abstract: Background: CHARGE syndrome is an autosomal dominant congenital and rare genetic disease.The prevalence of CHARGE syndrome approximately 1:12,000 births.In the previous study, the CHD7 gene mutation is responsible in about 2/3 cases of CHARGE syndrome.  The syn­drome associations consist of C-coloboma of the eyes, H-heart disease, A-atresia of the choanae, R-retarded growth and development, G-genital hypoplasia/genitourinary anomalies and E-ear anomalies and/or hearing loss. All defects are not seen in every case and a different spectrum of associations is seen in most of the cases.Method: Case was undergone physical examination by experience pediatricians, pedigree construction, and other diagnostic procedure (X-ray, echo­cardiography, and multi slice computer tomography (MSCT) scan).Results: A boy aged 2 years 9 months with clinical features with match major and minor criterias of CHARGE syndrome.Conclusion: Based on clinical diagnostic criteria this case is fulfilling with definite CHARGE syndrome. 
      PubDate: 2017-06-23
      DOI: 10.14710/jbtr.v3i1.1225
      Issue No: Vol. 3, No. 1 (2017)
       
 
 
JournalTOCs
School of Mathematical and Computer Sciences
Heriot-Watt University
Edinburgh, EH14 4AS, UK
Email: journaltocs@hw.ac.uk
Tel: +00 44 (0)131 4513762
Fax: +00 44 (0)131 4513327
 
Home (Search)
Subjects A-Z
Publishers A-Z
Customise
APIs
Your IP address: 54.81.44.140
 
About JournalTOCs
API
Help
News (blog, publications)
JournalTOCs on Twitter   JournalTOCs on Facebook

JournalTOCs © 2009-2016